The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River

Transcription

1 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River 2013 Prepared by: Jacques Mazerolle February 4, rue St. Georges street, suite 405 Moncton, NB, E1C 1W

2 This page was intentionally left blank.

3 The 2013 Petitcodiac River Striped Bass (Morone saxatilis) Monitoring Report 2013 This project was made possible thanks to the generosity of these funders: Atlantic Salmon Conservation Foundation, Environment Canada, Fort Folly Habitat Recovery, NB Wildlife Trust Fund

4 This page was intentionally left blank.

5 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River Table of Contents Table of Contents... I List of Figures... II List of Tables... III List of Acronyms... IV Acknowledgements... V Executive Summary... VI 1.0 Introduction Methodology Results Discussion Recommendations References Appendix February 2014 Page I

6 The Petitcodiac Watershed Alliance List of Figures Figure 1: Map showing the natural distribution of striped bass (Morone saxatilis) along the Atlantic coastline of North America Figure 2: Photograph of a striped bass (Morone saxatilis) captured in the Petitcodiac River on July 18, Figure 3: Area covered for the three designatable units of striped bass (Morone saxatilis) recognized by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC). Figure 4: Construction of the Moncton to Riverview causeway in Figure 5: Total striped bass (Morone saxatilis) captured in the Petitcodiac River from Figure 6: Map of the Petitcodiac River Watershed Figure 7: Box net used for fish monitoring on the Petitcodiac River. Figure 8: Fishing weirs (fyke nets) used for fish monitoring in the Petitcodiac River. Figure 9: Side view of the two fyke nets used for fish monitoring in the Petitcodiac River. Figure 10: A striped bass (Morone saxatilis) having a visible implant elastomer inserted in the anal fin. Figure 11: Total striped bass (Morone saxatilis) captured in the Petitcodiac River from Figure 12: Monthly total of striped bass (Morone saxatilis) captured in the Petitcodiac River between May 21 and November 07, Figure 13: Daily total of striped bass (Morone saxatilis) captured in the Petitcodiac River between May 21 and November 07, Figure 14: Length frequency distribution for striped bass captured in the Petitcodiac River during the monitoring season of P a g e II February 2014

7 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River List of Tables Table 1: Scott and Scott (1998) s classification of striped bass (Morone saxatilis) age based on length measurements. February 2014 Page III

8 The Petitcodiac Watershed Alliance List of Acronyms COSEWIC Committee on the Status of Endangered Wildlife in Canada DNA- Deoxyribonucleic Acid PFRC- Petitcodiac Fish Recovery Coalition SARA- Species at Risk Act YOY- Young of the Year P a g e IV February 2014

9 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River Acknowledgements We would like to sincerely acknowledge the support and mentorship of Fort Folly Habitat Recovery, notably Tim Robinson, Edmund Redfield and Tom Johnson who took us under their wing and ensured a collaborative approach to the work at hand and were willing to share their knowledge, findings and expertise. We would also like to thank Dr. Alyre Chiasson from the University de Moncton for his in-kind contribution of fish tags, as well as Dr. Paul Bentzen from Dalhousie University for his contribution towards the genetic component of the study. Furthermore, we would like to thank our Project Manager Susan Linkletter, for her mentorship and support throughout the delivery of this work and to our field staff in 2013 Jacques Mazerolle and Courtney Smith. February 2014 Page V

10 The Petitcodiac Watershed Alliance Executive Summary The purpose of this report is to summarize the 2013 monitoring results obtained for striped bass in the Petitcodiac River. The project was in successful collaboration with the Petitcodiac Fish Recovery Coalition, notably Fort Folly Habitat Recovery. As part of the collaboration the Petitcodiac Watershed Alliance and Fort Folly Habitat Recovery shared staff and resources. From May 21 to November 07, 2013, striped bass were monitored in the Petitcodiac River. The results revealed a similar trend to the previous two years: YOY were the predominant age group of striped bass found in the Petitcodiac River. However, contrary to previous years, two year old striped bass began increasing in abundance. In order to be certain that the data was not biased by capturing the same individuals repeatedly, the recapture rate of striped bass was quantified and proven to be minimal (<1%). This increase in two year individuals suggests that the Petitcodiac River provides good nursery habitat for striped bass by allowing the YOY to survive and return the following year. Furthermore, to determine the origin of the captured individuals, genotype testing using fin and tissue samples of 200 striped bass was completed by Dr. Bentzen s laboratory at Dalhousie University. The results confirm the theory proposed by COSEWIC that striped bass present in the Petitcodiac River originate from the Shubenacadie River, the only confirmed striped bass spawning site in the Bay of Fundy. P a g e VI February 2014

11 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River 1.0 Introduction Striped bass, Morone saxatilis, are native to the Atlantic coastline of North America (Figure 1) (AquaMaps, 2014). Their average size range between cm and kg and they are believed to be able to live up to 30 years (COSEWIC, 2004). Similarly to other members from the Moronidae family, they have a streamline shape and are mostly silver in colour. One characteristic that makes striped bass easy to identify is their seven, or sometimes eight, dark horizontal stripes that run along their body (Figure 2). Being anadromous, striped bass spawn in fresh water before moving to brackish and salt water to feed and mature (COSEWIC, 2004). Figure 1: Map showing the natural distribution of striped bass (Morone saxatilis) along the Atlantic coastline of North America (AquaMaps, 2014). February 2014 Page 1

12 The Petitcodiac Watershed Alliance According to the Committee on the Status of Endangered Wildlife in Canada (COSEWIC), five native striped bass populations exist in Canada. These populations are divided into three distinct sectors corresponding to the three designatable units recognized by COSEWIC: the Bay of Fundy, the Southern Gulf and the St. Lawrence Estuary (Figure 3). The Bay of Fundy striped bass population, which is the unit considered in this study, are only known to spawn at a single known location, the Shubenacadie River, although there is historically evidence of spawning in the Saint John and Annapolis River (COSEWIC, 2012). Furthermore, they continue to be susceptible to exploitation from recreational fishing, by-catch in commercial fisheries, and poaching (COSEWIC, 2012). As a result, striped bass of the Bay of Fundy unit were designated endangered by COSEWIC in November However, they are still being considered for listing under the federal Species at Risk Act (SARA) (SARA Registry, 2014) during the time this report was written. Figure 2: Photograph of a striped bass (Morone saxatilis) captured in the Petitcodiac River on July 18, P a g e 2 February 2014

13 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River Figure 3: Area covered for the three designatable units of striped bass (Morone saxatilis) recognized by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC) (Striper.ca, 2013). Prior to the construction of the Moncton to Riverview Causeway in 1968 (Figure 4), striped bass were known to be common in the Petitcodiac River Watershed (PFRC, 2011). The introduction of this barrier prohibited striped bass from entering the Petitcodiac River and as a result, striped bass, along with numerous other species such as Atlantic salmon (Salmo salar), were extirpated from the area. During the spring of 2010, the causeway gates were opened, re-establishing free tidal flow and fish passage to the watershed for the first time in 42 years. Immediately following this event, monitoring studies were done to determine whether anadromous fish species would return to the watershed. According to the Petitcodiac Fish Recovery Coalition (PFRC) (2011), the presence of striped bass following the opening of the gates was first seen in 2011 (i.e. no individuals were caught in 2010), where 158 individuals were captured (Figure 5). In 2012, a total of 706 individuals were captured, surpassing the previous year s total by more than four times (Redfield, 2013). This report details the results of the monitoring for striped bass in the Petitcodiac River during 2013, the fourth monitoring year following the opening of the Moncton to Riverview causeway gates. February 2014 Page 3

14 number of individuals The Petitcodiac Watershed Alliance Figure 4: Construction of the Moncton to Riverview causeway in 1968 (Vintage Moncton, 2014) Year Figure 5: Total striped bass (Morone saxatilis) captured in the Petitcodiac River from P a g e 4 February 2014

15 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River 2.0 Methodology The study monitoring striped bass was conducted on the Petitcodiac River between May 21 and November 7, The monitoring took place near the village of Salisbury, before the mouth of the Little River (Figure 6). However, due to heavy rainfall, resulting in large and heavy debris passing through the site location and damaging the equipment, no data was collected for numerous days, leaving large gabs in the data. Specifically, no data was gathered between May 25 - June 21, July 24 - August 13, and August 22 - September 10. Furthermore, large silt deposits at the site location made it impossible to continue monitoring fish passage with the initial trap set-up and required modifications to the design mid-way through the season. Figure 6: Map of the Petitcodiac River Watershed (Cornforth, 2010) From May 21 st to August 22 nd, a box net was used to monitor the striped bass population and other fish present in the river (Figure 7). The body of the trap consisted of a netted 3 m wide, 12 m long and 3 m deep box. This box contained a netted floor, an open top, and a 10 cm mouth, which was open on the downstream end. This assembly was suspended from a frame constructed out of rebar pickets driven into the river substrate, joined together by 2x4 beams (brails), and was raised and lowered using a series of ropes and pulleys. The rebar pickets were 25 mm in diameter, and the tops were stabilized from swaying with rope tethers (stub lines) that were attached to posts driven February 2014 Page 5

16 The Petitcodiac Watershed Alliance into the stream bank. The mesh size of the net was 9.5mm However, due to a build-up of silt in the end of August, the low water levels made it impossible to continue with this system. Figure 7: Box net used for fish monitoring on the Petitcodiac River in On September 10 th, the box net was replaced by two fyke nets (Figures 8 and 9). Both nets were set up side by side, slightly upstream of the previous box net location, where fewer amounts of silt had settled. The square opening of the first fyke net (i.e. the mouth) was 1.75 m. This net also contained a 21 m left arm and a 12.8 m right arm. The width of the v-shaped trap was 12.8 m. The circular opening of second fyke net was 1.2 m. Its outside arm measured 25 m, its inner arm measured 7.7 m, and the width of this v-shaped trap was 9.1 meters. Both fyke nets had a mesh size of 3 millimeters. Furthermore, both nets were sewed together through their inner arms, resulting in a w-shaped structure measuring 42.8 meters in width. The monitoring of fish in the Petitcodiac River was done from Monday to Friday between May and November. Once emptied and cleaned, the nets were removed each Friday and reset on Sundays. The traps were checked each morning at approximately 9:30 am and if the forecast called for heavy rain, the nets were brought to shore. This removal avoided large debris, carried by the river as a result of elevated water levels, to damage the equipment. Each fish found inside the trap, including mortalities, was recorded. If a striped bass was captured, the individual was examined to P a g e 6 February 2014

17 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River determine whether it contain a tag. If tagged, its colour and position was recorded prior to releasing the fish. If no tag was present, the individual s length and weight were recorded. For the first 200 captured striped bass, scale and tissue samples were removed and sent to Dr. Paul Bentzen of Dalhousie University to determine from which breeding population the fish originated. Furthermore, prior to their release, each of the 200 individuals was marked using a visible implant elastomer (i.e. a tag) (Figure 10) (Northwest Marine Technology, 2011). The colour and position of the tag changed weekly, making it possible to determine the exact week of capture for previously tagged individuals. Due to the high risk of injuring small fish during processing, scale or tissue samples weren t removed, and no tag was placed, on individuals below 12 cm in length (i.e. only their length and weight were recorded). Figure 8: Fishing weirs (fyke nets) used for fish monitoring of the Petitcodiac River in February 2014 Page 7

18 The Petitcodiac Watershed Alliance Figure 9: Side view of the two fyke nets used for fish monitoring of the Petitcodiac River in Figure 10: A striped bass (Morone saxatilis), captured in the Petitcodiac River during 2013, having a visible implant elastomer (circled in red) inserted in the anal fin. P a g e 8 February 2014

19 number of individuals The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River 3.0 Results In 2013, 456 striped bass were captured at the monitoring station. Using the results obtained by Bagnall (2010) and Redfield (2013), it was possible to examine changes in the Petitcodiac River striped bass population since the opening of the causeway gates (Figure 11). Although there is a decline in this year s total number of striped bass captured compared to 2012 (706), it remains greater than those obtained in 2011 (158) and 2010, where no striped bass were found Year Figure 11: Total striped bass (Morone saxatilis) captured in the Petitcodiac River from The monthly total of striped bass captured this year appeared to increase throughout the season, with the exception of November, where only one week of data was gathered (Figure 12). When examining the total number of striped bass captured daily, the results vary tremendously throughout each month (Figure 13). When comparing the daily catch of striped bass with tide data available online (Gemtec, 2014), it s evident that large catches were directly related to high tides. The fork length of striped bass captured ranged from 6 to 37 cm with an average of 15 cm for the entire 2013 season. According to Scott and Scott (1998), the age of striped bass can be estimated based solely on length measurments (Table 1). Using this classification system, the results suggests that, similarly to the last two years, the majority of striped bass captured in 2013 was young of the year (YOY) (Figure 14). Although not as frequent as YOY, two year old individuals were seen much more frequently this year than in the past. On the contrary, very few striped bass over three years of age were observed. February 2014 Page 9

20 number of individuals per day The Petitcodiac Watershed Alliance Figure 12: Monthly total of striped bass (Morone saxatilis) captured in the Petitcodiac River between May 21 and November 07, May 11-Jun 02-Jul 23-Jul 13-Aug 03-Sep 24-Sep 15-Oct Figure 13: Daily total of striped bass (Morone saxatilis) captured in the Petitcodiac River between May 21 and November 07, P a g e 10 February 2014

21 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River Table 1: Scott and Scott (1998) s classification of striped bass (Morone saxatilis) age based on length measurements. Age Underyearling to one year old Two year old Three to five year old Length cm cm cm Figure 14: Length frequency distribution for striped bass captured in the Petitcodiac River during Among the 200 scale and tissue samples sent for genetic testing, only 168 samples were analysed. The remaining 32 samples failed to meet the minimal requirements needed for analysis, which lickely resulted from the degradation of deoxyribonucleic acid (DNA) during sampling or while the sample was in storage. For each of the 168 individuals examined, the genotype was mostly derived from the Shubenacadie River type (Appendix 1). Specifically, of the 168 striped bass in the Petitcodiac River examined, 161 (96%) had genomes that were predominantly ( 92%) derived from the Shubenacadie River. As for the remaining seven fish, three had genomes estimated to be 82-88% of Shubenacadie type, two had genomes estimated to be 73-79% Shubenacadie type, and two contained a genetic mix between the Shubenacadie and Miramichi type. These results suggest that, although two individuals showed signs of mixed ancestry between the Shubenacadie and Miramichi populations, each of the 168 striped bass genetically tested was likely born in the the Shubenacadie River. February 2014 Page 11

22 The Petitcodiac Watershed Alliance Among all the striped bass captured in 2013, only a single individual carrying a tag was re-captured (September 20, 2013). Using the colour and area where the tag was placed, it was determined that the individual was first encountered during the last week of August. P a g e 12 February 2014

23 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River 4.0 Discussion Although the striped bass captured in 2013 were fewer in number than in 2012, there remains a growing trend in the population since the 2010 opening of the Moncton to Riverview causeway gates. Furthermore, large gaps of missing data, resulting from the trap being removed from the river due to damaged equipment, are likely the cause of fewer striped bass being captured in 2013 in comparison to the previous year. For instance, if the results obtained in 2012 were used to fill this year s gabs of data, the number of striped bass captured in 2013 would surpass those of In 2013, the monthly total of striped bass captured increased throughout the season, with the exception of November, where only one week of data was gathered. According to COSEWIC (2004), the Bay of Fundy striped bass population spawn in the Shubenacadie River during spring. The resulting juveniles will then move downstream during the summer, where they will continue to feed and grow in estuaries and coastal bays. Finally, during fall they will return upstream, in this case the Petitcodiac River, where they will overwinter in an attempt to avoid low ocean temperatures. Therefore, the results obtained in 2013 follow this profile perfectly. When examining the daily results, the total capture of striped bass varies greatly throughout each month. Since these fluctuations were shown to be related to the intensity of the tide, our results, like other studies such as Redfield (2012), suggest that juvenile striped bass use the re-established tidal flow of the Petitcodiac River to disperse widely within the inner Bay of Fundy. In 2013, YOY and one year old striped bass greatly outnumbered other age groups. This trend was also seen during 2011 and 2012 (Redfield, 2013). However, one difference seen this year was an increase in the number of two year old striped bass. Assuming that the YOY captured in the Petitcodiac River survive and return following their time at sea, signs of an increase in abundance of older and larger individuals (i.e. three to five year olds) should be present. Although this relationship has yet to be seen, the elevated presence of two year olds in 2013 suggests that the Petitcodiac River does provide a good nursery habitat for striped bass, allowing YOY to survive and return the following year. It remains unknown why a similar increase in two year old striped bass was not observed in 2012 by Redfield (2013). Through genetic comparison using scale and tissue samples, it was determined that each individual tested was most likely born in the Shubenacadie River. These results support the theory proposed by COSWEIC (2012) that juvenile striped bass originating from the Shubenacadie River migrate well into the Bay of Fundy in search for optimal habitat. Future genetic testing should be done on striped bass found in the Petitcodiac River to further support this theory, as well as to examine at which extent the Shubenacadie population interbreed with other populations, such as those found in the United Sates. It remains unclear why there is no evidence of ancestry from the putative native population in the Saint John River, which is closer to the Petitcodiac River than the Shubenacadie River. Following the opening of the Moncton to Riverview causeway gates, 2013 was the first year where the recapture rate for striped bass was quantified. However, based upon visual inspection for damage resulting from tissue sampling, the rate of recapture in striped bass was previously estimated to be low (Redfield, 2013). This theory was supported by the results obtained in 2013, which determined that the recapture rate of striped bass was below 1 %. However, it remains February 2014 Page 13

24 The Petitcodiac Watershed Alliance unknown why an individual tagged in late August would return to the trap site location one month later. In summary, although, fewer striped bass were captured in 2013 than during the previous year, the increased presence of two year-olds observed in 2013 provides evidence that the Petitcodiac River provides good nursery habitat for the specie, allowing YOY to survive. Ongoing monitoring for striped bass of the Petitcodiac River should continue to determine if similar trends will be observed in the future and whether older individuals (e.g. 3 to 5 years old) will begin to increase their presence in the river. Furthermore, as previously mentioned, more genetic data should be collected to examine at which extent the Shubenacadie River striped bass populations are mixing with other nearby populations. P a g e 14 February 2014

25 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River 5.0 Recommendations It is our recommendation that: - The PWA, in collaboration with the PFRC, continues to monitor the occurrence of striped bass through the use of fish trap(s) on the Petitcodiac River. - The PWA, in collaboration with the PFRC, continues using visible plastic elastomers to assure that the data is not being inflated by high recapture rates. - The PWA continue to use genetic analysis to determine the origin of striped bass captured in the Petitcodiac River and also to better understand the relationship among different populations. February 2014 Page 15

26 The Petitcodiac Watershed Alliance 6.0 References Aquamaps: Computer Generated Native Distribution Map for (Morone saxatilis) (Striped bass). version of Aug Web. Accessed 5 Feb Bagnall, J. (2010). Petitcodiac River Fish Trap Interpretation of Results from AMEC Earth and Environmental. Fredericton, New Brunswick. Cornforth (2010). Map of the Petitcodiac River Watershed. Web Accessed 3 Feb COSEWIC (2012). COSEWIC assessment and status report on the Striped Bass Morone saxatilis in Canada. Committee on the Status of Endangered Wildlife in Canada. Ottawa. iv + 79 pp.( Gemtec (2014). Real Time Gauges, Salisbury. = &StartTime=&Site2=1&EndDate= &EndTime=&ctlSearch=Apply+Changes. Web Accessed 3 Feb Northwest Marine Technology, Inc. (2011). Manual Elastomer Injection Systems: Instruction for 10:1 visible implant elastomer. Shaw Island, WA., USA. 6 pages. PFRC (2011). Re-establishing native species in the Petitcodiac River. Petitcodiac Fish Recovery Coalition. Pamphlet. Redfield, E. (2013). Petitcodiac Fish Recovery Coalition Fish Trap Results, 2012 Season. Fort Folly Habitat Recovery, Dorchester New Brunswick. 49 pages. SARA Registry (2014). Species at Risk Public Registry- Species Profile (Morone saxatilis). Web Accessed 2 Feb Striper.ca (2012): About Striped Bass. Web Accessed 5 Feb Vintage Moncton. The Causeway. Web Accessed 3 Feb 2014 P a g e 16 February 2014

27 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River 7.0 Appendix 1 REPORT: GENETIC ANALYSIS OF STRIPED BASS COLLECTED IN THE PETITCODIAC RIVER SUBMITTED TO Petitcodiac Watershed Alliance/L'Alliance bassin versant Petitcodiac 236 St George Street, Suite 405 Moncton, NB E1C 1W1 FEBRUARY 3, 2014 Paul Bentzen, Meghan McBride, Ian G. Paterson, Department of Biology, Marine Gene Probe Laboratory Dalhousie University Halifax, Nova Scotia Paul.Bentzen@dal.ca tel : P a g e 1 February 2014

28 The Petitcodiac Watershed Alliance SUMMARY A molecular genetic analysis was undertaken to evaluate the origins of 200 juvenile striped bass sampled in the Petitcodiac River estuary in DNA was isolated from fin clips, and genetic variation at 11 microsatellite DNA loci was analyzed. The data obtained from these fish were compared to genetic baseline data for two other known Canadian populations, Miramichi River and Shubenacadie River, three U.S. populations, Kennebec (ME), Hudson (NY) and Chesapeake Bay (MD), and striped bass from the Saint John River that are believed to represent the native breeding population in that river. Data from mature striped bass sampled in the Annapolis River and southern Gulf of St. Lawrence, and a large collection of mixed-stock bass sampled in the Saint John River were also included for comparative purposes. Although extraction of high quality DNA and microsatellite genotyping were attempted on 200 Petitcodiac striped bass tissue samples, 32 samples showed signs of DNA degradation, and did not yield genotypic data of adequate quality for further analysis. Bayesian clustering analyses conducted on the data obtained from the remaining168 samples as well as the baseline reference data from other populations indicated that 161 (96%) of them derived 92% of their genetic ancestry from the Shubenacadie River breeding population. Another five individuals derived an estimated 73-88% of their ancestry from the Shubenacadie stock. The remaining two juvenile striped bass had mixed ancestry from the Shubenacadie and Miramichi stocks. It is likely that all 168 juvenile striped bass sampled in the Petitcodiac were born in the Shubenacadie River and dispersed from there to the Petitcodiac River. These results confirm that juvenile striped bass from the Shubenacadie River disperse widely within the inner Bay of Fundy. February 2014 P a g e 2

29 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River INTRODUCTION Although striped bass (Morone saxatilis) occur widely in the coastal waters of Atlantic Canada, the presence of this ecologically and economically important species in Canadian waters is supported by only two confirmed breeding populations in Canada, along with temporary (nonbreeding) migrants from U.S. populations. Of the two Canadian populations, one spawns in the Miramichi River, in New Brunswick, and another in the Shubenacadie River, and its tributary, the Stewiacke River, in Nova Scotia. Breeding populations in the Annapolis River, Nova Scotia, and St. Lawrence River, Quebec, were extirpated several decades ago, and another in the Saint John River, New Brunswick, was also thought extirpated (reviewed in COSEWIC 2012), although genetic data from striped bass sampled within the Saint John River, New Brunswick suggest that a small remnant breeding population may persist there (Bentzen et al. 2009). Striped bass that spawn in the Bay of Fundy drainage were recently assessed by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC) as Endangered (COSEWIC 2012), which highlights the importance of understanding the distributional limits and habitat use of remaining populations of the species. The tendency of striped bass to disperse and migrate extensively at juvenile, sub-adult and adult stages presents a challenge for efforts to determine the distributional limits of populations, and to identify the population of origin for individual striped bass when they occur in mixed population aggregations. Fortunately, however, this challenge can be overcome using DNA-based methods to determine the population of origin of individual striped bass. Previous research has shown that the remaining Canadian breeding populations are genetically distinct from each other, and from U.S. populations (Bentzen et al. 2009, Bentzen unpublished data). The same work has documented the occurrence of mixed stock assemblages within the Saint John River comprising migrating striped bass from the Shubenacadie River and U.S. populations, as well as a group believed to be native to the Saint John River, and also the presence of many U.S.-origin striped bass in the Annapolis River. Several complementary methodologies make the genetic identification of the population origin of individual striped bass possible. First, small but sufficient quantities of DNA can be P a g e 3 February 2014

30 The Petitcodiac Watershed Alliance isolated from almost any small part of a fish, including small fin clips, or scales. Second, the striped bass DNA can be used to selectively amplify and analyze specific DNA sequences known as microsatellites. These are short stretches of simple repetitive DNA sequence (e.g., CACACACACACA ) that are found scattered on the chromosomes of all multicellular organisms, and that are highly prone to mutations that cause them to gain or lose individual repeating segments of DNA sequence (± CA, in the example above; Wright and Bentzen 1994). One consequence of this rapid mutation rate is that when the same microsatellite sequences are examined in different individuals, they often differ in the number of repeating units that are present; however, when individuals are compared within and among populations, individuals within the same populations tend to have more similar microsatellites than those from different populations. These differences within and among populations can be analyzed using the third set of methodologies, computational methods that use population genetic data to estimate how populations are related, how much mixing occurs between them, and (most critically for this report) the most likely population source of individuals, when this is not known by other means. This report uses these methods to determine the source population(s) for juvenile striped bass sampled in the Petitcodiac River in DNA was isolated from fin clips, 11 microsatellite loci were amplified and analyzed for each fish, and the data were analyzed in various ways. Of critical importance for these analyses, comparable genetic data from striped bass from key known populations were used as baseline data to enable classification of the Petitcodiac striped bass to population of origin. February 2014 P a g e 4

31 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River METHODS Samples Striped bass (N = 200) were collected from live traps in the Petitcodiac River estuary during 2013 by the Petitcodiac Watershed Alliance. These samples were analyzed together with data from additional striped bass samples from the following locations and dates: Choptank and Potomac Rivers, Maryland, 1999 (N = 93); Hudson River, New York, 1989 (N = 94); Kennebec River, Maine, 2002 (N = 48); Shubenacadie River, Nova Scotia, 2003 (N = 81); Miramichi River, New Brunswick, 1994, 1995 and 2000 (N = 81); Saint John River, New Brunswick, (N = 720); Annapolis River, Nova Scotia, (N = 111). Striped bass from the Miramichi River in , from the Annapolis River, and most fish from the Saint John River, were collected as adults, but all fish collected from the Miramichi River in other years and from other locations were young of the year (YOY). Striped bass from the two Maryland locations were pooled and treated as a single population ( Chesapeake ) based on information that there is no detectable genetic differentiation among Chesapeake Bay populations (M. Hamilton, pers. com.). DNA genotyping DNA was isolated from fin clips (Petitcodiac River, Saint John River, southern Gulf of St. Lawrence), scales (Miramichi River, Annapolis River, Saint John River), and muscle tissue (Chesapeake, Kennebec River and Shubenacadie River) following Elphinstone et al. (2003). Hudson River samples were provided as DNA by I. Wirgin. Genetic data were collected for 11 microsatellite loci using primers listed in Table1. Amplifications were conducted in 5 L or 10 L reaction volumes containing 20 mm Tris-HCl ph8.8, 10 mm KCl, 10 mm (NH4)2SO4, 2 mm MgSO4, 0.1% Triton X-100, 200 µm dntps, nm fluorescently labelled primer, nm unlabelled primer, U Taq DNA polymerase, and ~ ng template DNA. Amplifications were performed in MJ Research or Eppendorf thermocyclers using an initial 94 C 3 min denaturing step, then 30 cycles of 94 C 30s, primer specific TA (see Table 1) 30s, 72 C 30s, and a final 72 C 2m step. PCR products were visualised in 6% denaturing polyacrylamide gels on a LICOR DNA analyzer. Microsatellite alleles were sized by reference to DNA standards composed of known microsatellite alleles run on each gel. P a g e 5 February 2014

32 The Petitcodiac Watershed Alliance Statistical analyses The quality of the microsatellite data was evaluated using standard procedures and programs (GENEPOP v. 3.4, Raymond & Rousset 1995; MicroChecker, van Oosterhout et al. 2004). Tests for departures from HWE were performed for each locus-population combination using an exact test where the P-values were estimated without bias using a Markov chain method following the algorithm of Guo & Thompson (1992). Tests for genotypic linkage disequilibrium for all pairs of loci within each population and tests for allelic heterogeneity between populations were also made using the Markov chain method. Log-likelihood (G)-based exact tests were performed at each locus and over all loci among all populations, and between all possible population pairs by estimating an unbiased P-value. For all Markov chain tests, default parameters in GENEPOP for dememorization number, batches and iterations were invoked. Tests were combined across loci or populations using Fisher s method. Genetic differentiation (FST, calculated as θ; Weir and Cockerham 1984) was calculated between all possible pairs of populations and tested for significance using permutations in FSTAT (Goudet 1995). A Neighbour-joining (NJ) dendrogram based on Cavalli-Sforza Edwards (1967) chord genetic distances between groups of striped bass were created using the program Populations (1.2.28; Langella 2001) Statistical support for clusters on the NJ trees were estimated by bootstrapping across loci (3000 replicates) using Populations. Genetic relationships of Alewife populations were also assessed with a Principle Coordinates Analysis (PCoA) of pairwise F ST values generated by FSTAT, using GenAlEx (v.6.41; Peakall and Smouse 2006). Bayesian model-based clustering, implemented in STRUCTURE (v.2.2; Pritchard et al. 2000, Falush et al. 2007) was used to identify homogenous genetic clusters (approximately equivalent to genetically distinct populations). Analyses employed the admixture model, correlated allele frequencies among populations and location prior parameter setting, with a burn in period of Markov Chain Monte Carlo (MCMC) steps followed by an MCMC chain of steps. A total of 33 STRUCTURE runs were conducted to evaluate the probabilities of different values of K, the number of homogenous genetic clusters. The most likely value of K was estimated using the ΔK statistic proposed by Evanno et al. (2005) and implemented by Structure Harvester (Earl and vonholdt 2012). February 2014 P a g e 6

33 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River RESULTS AND DISCUSSION Data quality Although efforts were made to genotype DNA from 200 striped bass at all 11 microsatellite loci, results from 32 samples failed to meet a minimum acceptable threshold of at least six successfully genotyped microsatellite loci per sample. This was likely due to DNA degradation that occurred in these samples during fish collection or sample storage. For the remaining 168 samples that were retained in the analysis, the mean number of microsatellite locus genotypes that were scored per fish was 9.4. Statistical tests of data quality, including tests for null (non-amplifying) alleles, and departures from Hardy Weinberg equilibrium confirmed that the microsatellite data from all 11 loci were suitable for use in further analyses. Relationship of Petitcodiac striped bass to known breeding populations A variety of analyses revealed that striped bass sampled in the Petitcodiac River were genetically similar to striped bass native to the Shubenacadie River. First, a dendrogram (Figure 1) depicting relationships among population samples, grouped the Petitcodiac River sample with YOY striped bass sampled in the Shubenacadie River. Statistical support, derived by bootstrapping, for the Shubenacadie-Petitcodiac cluster in Figure 1, was 100%. By contrast, other populations appeared unrelated to the Shubenacadie-Petitcodiac samples. Second, a principle coordinates analysis based on estimates of FST (a measure of genetic distance) between population samples also showed that the Shubenacadie and Petitcodiac striped bass samples were genetically similar to each other, but very distinct from samples from the U.S., the Annapolis River, and the Gulf of St. Lawrence. This analysis also showed that the Petitcodiac striped bass sample was genetically distinct from the striped bass that comprised the putative native group found in the Saint John River. Third, a clustering analysis using the program STRUCTURE also supported the genetic similarity of the Petitcodiac striped bass to those in the Shubenacadie River breeding population, and provided the most detailed information about the genetic makeup of individual fish. A detailed description of the STRUCTURE results follows. When STRUCTURE clustering analysis was conducted on all striped bass in the data set, it revealed four genetic types ( clusters ) of striped bass, each one associated with a particular P a g e 7 February 2014

34 The Petitcodiac Watershed Alliance breeding population (or group of breeding populations within a geographic region). For convenience in this report, each genetic cluster was assigned a colour. The yellow cluster was associated with the Miramichi River, the red cluster was associated with U.S. populations (Chesapeake Bay, Hudson River, Kennebec River), the blue cluster comprised the putative native population in the Saint John River, and the green cluster was associated with the Shubenacadie River breeding population. The STRUCTURE analysis estimated the relative contribution of each genetic cluster to each individual s genome, regardless of where the individual was actually sampled. In theory, an individual striped bass could derive its entire ancestry from a single population, or it could have mixed ancestry from two or more of the striped bass genetic clusters. Figure 3 shows the estimated proportions of each fish s recent ancestry that were derived from particular genetic clusters. Within each breeding population, most fish had genomes that were predominantly derived ( 90%) from the local genetic cluster, although a few individuals showed evidence of partial ancestry from other genetic clusters. Appendix 1 provides information about the relative contribution of each genetic cluster to the genome of each fish, along with sampling date, and size of the fish. As shown in Appendix 1, and also evident in Figure 3, the great majority (161 fish, 96%) of the 168 striped bass sampled in the Petitcodiac River that were successfully genotyped had genomes that were predominantly ( 92%) derived from the Shubenacadie/green cluster. Of the remaining seven fish, three (1.8%) had genomes estimated to be 82-88% of Shubenacadie type, two more (1%) had genomes estimated to be 73-79% Shubenacadie type, and two individuals (1%), both sampled on September 18, 2013 had genomes that appeared to be a mix of Shubenacadie and Miramichi ancestry. The most plausible interpretation of these results is that all of the juvenile striped bass sampled in the Petitcodiac River were born in the Shubenacadie River, and dispersed from there to the Petitcodiac estuary. The traces of non-shubenacadie ancestry detected in a few individuals were likely due either to analysis artifacts, or the result of occasional migrants from other populations to the Shubenacadie River in past generations. The latter explanation is most likely for the two individuals that showed significant Miramichi ancestry. It is also worth noting that none of the striped bass sampled in the Petitcodiac River showed any convincing evidence of ancestry from the putative native population in the Saint John River, even though this river is closer to the Petitcodiac River than the Shubenacadie River. One fish, sampled on September 18, 2013, was estimated to have February 2014 P a g e 8

35 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River approximately18% Saint John River ancestry, but this level of inferred ancestry is inconclusive, and may lie within the limits of estimation uncertainty for the genetic markers used. The problem of failed samples and how to avoid them in the future The number of samples that failed to yield acceptable data, 32 (16%) was unusually high for a study of this type. A failure rate of less than 5% would be more typical. As can be seen in Appendix 1, the samples the samples that failed were not distributed randomly through the data set; rather, the majority occurred on two sampling dates, August 22, when all but one sample failed, and September 10, when 18 ( 30%) failed. This pattern points to systematic problems on those sampling dates, and sporadic problems with sample handling on other dates. Effective preservation of DNA in tissue samples depends on two factors: the quality of the DNA when it is first preserved, and the preservation conditions. If the sample (fin clip) is taken from a live or freshly dead fish, the initial DNA quality should be excellent. If lethal sampling is occurring, and the fish are to be used for purposes in addition to genetic analysis, the tissue sample for DNA analysis should be taken as soon as possible, and the fish should be kept cold, preferably on ice, until the fin clip is taken. For preservation in ethanol, as was used in this study, the quality and concentration of the ethanol are important. The ethanol should be 95 or 100% concentration. One possibility is that the ethanol became diluted when the samples were added to the vials. This could happen in a couple of ways: First, insufficient ethanol could have been added to some tubes, or spillage or evaporation could have happened after the ethanol was added. Second, water could have been added to the tubes when the samples were added. This could happen inadvertently if fin clips were too large and contributed water from within the tissue and clinging to the fin clip. For DNA analysis, more tissue is not necessarily better; a 5x5mm piece of fin is ample, and half tissue is also adequate. P a g e 9 February 2014

36 The Petitcodiac Watershed Alliance REFERENCES Bentzen P, Paterson IG, Bradford RG Greater genetic differentiation and complex migratory behavior of striped bass in the Canadian Portion of the species range. p American Fisheries Society Symposium 69. Brown KM, Baltazar GA, Weinstein BN, Hamilton MB Isolation and characterization of nuclear microsatellite loci in the anadromous marine fish Morone saxatilis. Molecular Ecology Notes 3: Cavalli-Sforza LL, Edwards AWF Phylogenetic analysis: models and estimation procedures. American Journal of Human Genetics 19: COSEWIC COSEWIC assessment and status report on the Striped Bass Morone saxatilis in Canada. Committee on the Status of Endangered Wildlife in Canada. Ottawa. iv + 79 pp. ( Earl DA, von Holdt BM STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conservation Genetics Resources 4, 1 3. Elphinstone MS, Hinten GN, Anderson MJ, Nock CJ (2003) An inexpensive and high-throughput procedure to extract and purify total genomic DNA for population studies Molecular Ecology Notes 3: Evanno G, Regnaut S, Goudet J Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14: Falush D, Stephens M, Pritchard JK Inference of population structure using multilocus genotype data: dominant markers and null alleles. Molecular Ecology Notes 7: Goudet J FSTAT, a program to estimate and test gene diversities and fixation indices (version ). Available from February 2014 P a g e 10

37 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River Guo SW, Thompson EA Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics, 48, Langella, O Populations Population genetic structure (individual or population distances, phylogenetic trees). Available at Peakall R, Smouse PE GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6: Pritchard JK, Stephens M, Donnelly P Inference of population structure using multilocus genotype data. Genetics, 155: Raymond M, Rousset F (1995). GENEPOP Version 1.2.: population genetics software for exact tests and ecumenism. Journal of Heredity 86: Rexroad, C., Vellejo, R., Coulibaly, I., Couch, C., Garber, A., Westerman, M., Sullivan, C Identification and characterization of microsatellites for striped bass from repeat-enriched libraries. Conservation Genetics 7: Ross K, Wang X, O Malley KG, Gatlin DMIII, GOLD JR Microsatellite DNA markers for parental assignment in hybrid striped bass (Morone saxatilis Morone chrysops). Molecular Ecology Notes 4: Roy NK, Maceda L, Wirgin I Isolation of microsatellites in striped bass Morone saxatilis (Teleostei) and their preliminary use in population identification. Molecular Ecology 9: van Oosterhout C, Hutchinson WF, Wills, DPM, Shipley P Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: Weir BS, Cockerham CC Estimating F-statistics for the analysis of population structure. Evolution 38: P a g e 11 February 2014

38 The Petitcodiac Watershed Alliance Wright JM, Bentzen P Microsatellites: genetic markers for the future. Reviews in Fish Biology and Fisheries 4: February 2014 P a g e 12

39 The 2013 Striped Bass (Morone saxatilis) Monitoring Report of the Petitcodiac River Table 1. Microsatellite primers used in this study. Locus 1 Repeat 2 Primer sequence 3 GenBank 4 AT 5 MSM1628 (TAGA)16 AATCCCACATGGAGTTGTAG BV size range 6 Reference Rexroad et al CCAGACCAATAAAACGTCCC MSM1592 (TAGA)33 CGGCACTGGATAAAGTTAC BV Rexroad et al TACAATTTCCCTCGGGATG MSM1604 (ATCT)32 ATTAGTCTGTGGATACCGCTGGA BV Rexroad et al ACAGGGCTGCAGTGGAAGGTAAG MSM1625 (ATCT)20 AAGCTTCCATATAGTGCACCC BV Rexroad et al TGTCCGAGTTTGCCTGATCTC MSM1645 (CTAT)16 CAATGCACCACTCTTATAC BV Rexroad et al GGAACACAGCCATCATTAG MSM1357 (GATA)21 GTACCTGACACGCATAATG BV Rexroad et al CCAAGCAAACCGTTTAGTG MSM1584 (ATCT)19 CTCTAAGGCTAATGGGGTTAC BV Rexroad et al P a g e 13 February 2014

40 The Petitcodiac Watershed Alliance CTGTTCTGCGTTTTAGTTGGA Msa1-AC25-6#12 (TG)n ACCCAGTGGTCCAATCATGG AY Brown et al GTATCAGATCATTTCCAAGTCC Msa2-SB11-1F (GTTT)8 CGAGACAAGACAACTCAG AF TATCTACGGGAGGTGACG 58-53TD Roy, Maceda & Wirgin 2000 Msa4-AG25-1#1 (CTTT)n GCTTCCGCAAGTTTAGTTGC AY Brown et al AACGCAGAATCCTGCCTGC Msa5-AT150-2#12 (GT)n TTCCAGCTTGTGAAGTGAGC AY TD Brown et al TTCTGTCTATTGCACAGACTC Msa8-AT150-2#4 (GT)n TATGACGCCATGTGTTGGCAC AY Brown et al Table 1 (continued) ATGTATGAGTTGATAGCATGAGG Msa10-AT150-2#21 (GT)n GGGTGCCTCTCCTAAGTGC AY Brown et al CTCTGCTTGTATTGCTGTTGG Hsb-1B (GT)60 GCAGCAGAAGTTGGGACTGGT AY Ross et al : name of the microsatellite as used in this report; GGCACCAAACAAGACATATAGTGA 2: the type of repeat motif present in the microsatellite, and the number of copies of the repeating unit in the DNA sequence from which it was first cloned; February 2014 P a g e 14