Effects of gamma radiation on growth and development in Arabidopsis thaliana. Dajana Blagojevic. Master Thesis credits

Transcription

1 Norwegin University of Life Sciences Fculty of Biology Deprtment of Plnt Sciences Mster Thesis credits Effects of gmm rdition on growth nd development in Arbidopsis thlin Djn Blgojevic

2 Norwegin University of Life Sciences (NMBU) Norges miljø- og biovitenskpelige universitet Mster Thesis Effects of gmm rdition on growth nd development in Arbidopsis thlin Djn Blgojević Deprtment of Plnt Sciences Ås, 2015 The Norwegin University of Life Sciences P.O. Box 5003, 1432 Ås, Norwy. 1

3 2

4 ABSTRACT Different types of biotic stresses re known to hve strong impct on morphologicl development of plnts. Exposure of plnts to ionizing rdition such s gmm rdition is potentilly dmging, but effects my vry with species, rdition dose nd life stge. Exposure of biologicl system to gmm rdition my involve two types of effects within the cells, direct nd indirect. Direct trgets involve wter, in which gmm rdition results in electron excittion or wter rdiolysis nd further leds to chin rections tht produce secondry oxygen species (ROS). On the other hnd, indirect effects of rdition ffects the DNA helix, depending on the dose; it induces DNA breks, which my led to chromosoml nd genomic bnormlities. In order to defend themselves, plnts possess cell cycle checkpoints nd systems repiring DNA dmges. In A. thlin the trnscription fctor Long Hypocotyl 5 (HY5), which is crucil in photomorphogenic development nd formtion of flvonoids cting s ntioxidnts, plys mjor role in light nd UV signling. The ubiquitin ligse Constitutive Photomorphogenesis 1 (COP1) is essentil in controlling HY5 by degrdtion of HY5 in drkness in contrst to in light. In A. thlin HY5 ws shown to ply crucil role in stem elongtion nd flvonoid biosynthesis under UV-exposure nd lowered temperture. The purpose of this study ws to investigte fter effects of gmm rdition t the moleculr, morpho-structurl nd physiologicl levels in the A. thlin wild type (WT) Ler nd the hy5 mutnt treted with different gmm doses rnging from 21.6 to 90.7 Gy. This included evlution of expression of the RAD51 RECOMBINASE (RAD51) nd TRANSAPARENT TESTA (TT4) gene, which ply roles in DNA double strnd brek repir nd biosynthesis of flvonoids, respectively, in plnts cells. In ddition, High performnce liquid chromtogrphy (HPLC) nlysis ws lso performed in order to study production of phenolic cids nd flvonoids. Investigtions on the physiologicl level included recording of: rosette lef formtion, lef re, stem elongtion nd time to visible flower buds. As lte s 51 dys fter the gmm exposure, reltive trnscript levels of RAD51 were incresed in the WT under the highest gmm exposure doses 90.7 Gy nd 72.2 Gy, compred to the unrdited control, indicting tht the up-regultion of RAD51 by gmm rdition is quite persistent, while the TT4 gene did not show ny significnt differences between tretments. 3

5 The totl level of flvonoids in the WT displyed significnt differences between the highest gmm dose (90.7 Gy) compred to the control, while the totl level of phenolic cids did not differ between the dose s. At the physiologicl level, only smll differences were observed between different gmm tretments compred to control, in both genotypes. 4

6 ACKNOWLEDGEMENT First, I would like to thnk my supervisors, Prof. Jorunn E. Olsen nd co-supervisors Prof. YeongKyeong Lee nd Prof. Ole C. Lind for ll the knowledge they thought me, support nd help in order to write my thesis. I lso pprecite nd thnk Tone I. Melby nd Lind Ripel for guiding nd helping me with lbortory work. Mny thnks to grdener Mrit Siir tht helped me with tking cre of lmost two thousnd plnts nd Prof. Line Nybkken nd Prof Knut A. Solhug in helping me with flvonoid nlysis nd mesurements of fluorescence. I pprecite lso Prof. Dg A. Brede, PhD students Yetneberk A. Kssye nd Elisbeth L. Hnsen in helping me with setting up the gmm rdition experiment. I would lso like to thnk Prof. Jorunn E. Olsen, Prof Ole C. Lind nd Prof. Dg A. Brede to ttend the 5 th Annul CERAD (Center for the Environmentl Rdioctivity) Meeting in Oslo nd thus present my experimentl results. Most of ll I would like to thnk my der prents Milen nd Brnislv Blgojevic in giving me support through ll my yers of eduction nd for being lwys there for me. Specil thnks to my brother Miln Blgojevic in supporting nd encourging me through this work. I dedicte this thesis to my prents, Milen nd Brnislv. 5

7 ABBREVIATIONS ATM Atxi Telngiectsi Mutted Pthwy ATR Atxi Telngiectsi nd Rd3-relted protein pthwy bzip bsic Leucine Zipper protein CHS CHALCONE SYNTHASE, sme s TT4 COP1 Constitutive Photomorphogenesis 1 DDR DNA Dmge Response DSB Double Strnd Brek HPLC High performnce liquid chromtogrphy HY5 Long Hypocotyl 5 HYH HY5 Homolog HR Homologous Recombintion NEHJ Non-homologous End Joining IR Ionizing Rdition RAD51 RAD51 RECOMBINASE ROS Rective Oxygen Species RT-PCR Rel Time Polymerse Chin Rection TT4 TRANSPARENT TESTA, sme s CHS WT Ler Wild type Lndsberg erect PSII Photosystem II 6

8 CONTENTS 1. INTRODUCTION 1.1 The effect of gmm rdition on plnt cells A. thlin s moleculr model to study plnt development Hy5 dvntges nd disdvntges in self-defense ginst UV-B light DNA Dmge Response (DDR) in plnts Defense system in plnts ginst gmm rys Flvonoid biosynthesis s n essentil fctor in UV-B- nd IR-defense High Performnce Liquid Chromtogrphy (HPLC) method AIMS OF THE STUDY MATERIALS AND METHODS 3.1 Plnt mteril nd growth conditions Gmm ( 60 Co source) rdition of plnts ROS (Rective Oxygen Species) stining of plnt tissue Growth conditions nd growth mesurements fter gmm tretment Chlorophyll fluorescence mesurements RNA extrction nd gene nlysis (RT-PCR) Quntifiction of phenolic compounds from lef mteril High Performnce Liquid Chromtogrphy (HPLC) nlysis Sttisticl nlysis RESULTS 4.1 Experiment 1: Effects of gmm rdition ( Gy) on WT Ler nd hy Effect of 60 Co gmm rdition on number of rosette leves Effects of 60 Co gmm rdition on plnt development t flowering stdium Effects of 60 Co gmm rdition on bolting stem length

9 4.2 Experiment 2: Effects of gmm rdition (30.2 Gy Gy) on WT Ler nd hy Effect of 60 Co rdition on number of rosette leves Effects of 60 Co gmm rdition on plnt development t flowering stdium Effects of 60 Co gmm rdition on bolting stem length Effect of 60 Co gmm rdition on lef size Effect of 60 Co Gmm rdition on reltive gene expression: TT4 nd RAD Effect of 60 Co gmm rdition on phenolic cids nd flvonoid biosynthesis Effects of 60 Co gmm rdition on PSII system DISCUSSION 5.1 Effects of low gmm rdition Effects of gmm rdition on rosette lef formtion, flowering stge nd bolting stem length Effects of gmm rdition on reltive gene expression: RAD51 nd TT Effects of low gmm irrdition on phenol cids/flvonoid synthesis nd PSII system ROS production response to gmm rdition CONCLUSION SUGGESTIONS FOR FURTHER RESEARCH REFERENCE LIST APPENDIX. 56 8

10 1. INTRODUCTION 1.1 The effect of gmm rdition on plnt cells Since plnts in nturl nd mn-mde ecosystems my be exposed to different types of ionizing rdition, either from nturl sources or due to ccidentl releses, it is importnt to evlute sensitivity of plnts to such rdition of which gmm rdition is the most energetic nd thus most dmging (Wi et l. 2007). Rdioctive rdition cn interct directly with wter nd cuse excittions nd ioniztions resulting in production of free rdicls, which in turn leds to production of secondry rective oxygen species (ROS; Figure 1). The OH free rdicl cn be responsible for extensive cell dmges, becuse it cn rect rpidly with ll types of molecules: lipids, proteins nd nucleic cids (Esnult et l. 2010). Therefter, secondry rections re produced where one of the most crucil ROS species is hydrogen peroxide (H2O2). Whether plnt re strongly ffected by gmm rys depends on the dose but lso fctors such s species, plnt ge, cultivrs, physiology nd the size nd stte of the plnt genome (De Micco et l. 2011). For seeds differences between dry or fresh seed lso plys mjor role in gmm sensitiveness. Not-fully developed nd germinting seeds re more sensitive to gmm rdition thn dry seeds since wter content is higher nd the embryo esier to rech by the structures ffecting ion cpcity (Qin et l. 2007). After the Chernobyl ccident, it ws shown tht plnts with hiry leves such s Cydoni oblong nd Mespilus germnic, or old (lower) leves of Ze mys with lrge surfce, bsorbed higher mount of rdioctive elements (Swidis, 1988). In response to ionizing rdition, Arbidopsis thlin hs been shown to express different genes depending on rdition type nd dose. Previous studies reveled tht cute gmm rdition rther ffects genes relted to nucleic cids, while chronic gmm rdition, hs n impct on genes essentil for plnt flowering (Kovlchuk et l. 2007). According to Kovlchuk et l. 2000, exposing A. thlin nd Nicotin tbcum to cute or chronic gmm rys, increse frequency of homologous recombintion (HR). On the other hnd, in higher plnts DNA double strnd breks (DSBs) is suggested to be processed by nonhomologous end joining (NHEJ; Britt, 1999). In ddition, becuse of ionizing rdition some plnts exhibit lso loss of photosystem II (PSII) functionlity (De Micco et l. 2011). 9

11 PRIMARY REACTIONS SECONDARY REACTIONS Figure 1. Gmm rys ffecting trget (H 2O) directly within cell nd cusing excittion nd ioniztion. This leds to production of primry nd secondry rections (free rdicl formtion tht negtively ffect plnts nd other orgnisms; Esnult et l. 2010). 1.2 A. thlin s moleculr model to study plnt development A. thlin, which is smll weed plnt belonging to the mustrd fmily ws lredy suggested to be used s n experimentl model plnt in the 1940s becuse of its bility to self-fertilize, smll size nd short genertion time. A. thlin cn tolerte different environmentl stresses nd thus dpt to vrious geogrphicl res. Lter discoveries bout A. thlin such s possession of one of the smllest genomes (pproximtely genes 125 Mbp), mong higher plnts nd the esiness of trnsformtion nd muttion, contributed to the fct of becoming n experimentl model in moleculr genetics from the 1980s. Further, the totl number of genes is orgnized long five chromosomes, where ech one is built up of specific sequences, pproximtely one gene per 5 kb (Koorneef nd Scheres, 2001). Centromeric nd telomeric regions consist of highly repeted elements (trnsposons), described s heterochromtin, while euchromtin represents genes coding for functionl proteins. Severl studies hve been performed in order to nlyze how different light spectr re ffecting plnts dpttion nd development. THE LONG HYPOCOTYL (HY5) trnscription fctor is known for its interction with light responsive promoters nd thus stimulting light controlled trnscriptionl ctivity (Chttopdhyy et l.1998). Thus, muttion in the HY5 gene ffects plnt cell elongtion, cell prolifertion nd chloroplst development (Oym et l. 1997). 10

12 Previous studies lso observed tht deficiency in HY5 ffects flvonoid biosynthesis, which my be ffected by gmm rdition. Trnscriptionl regultion of chlcone synthse i.e. the type denoted TRANSPARENT TESTA 4 (TT4; further described below) s the first enzyme involved in production of flvonoids, which ct s ntioxidnts, ws therefore chosen to be nlyzed in WT nd the hy5 mutnt fter gmm rdition in order to observe whether there ws fter-effect on gmm rys nd flvonoid biosynthesis. In ddition, the RAD51 RECOMBINASE (RAD51) gene in A. thlin is crucil in defense ginst gmm rys, becuse it is involved in the homologous DNA repir system. Therefore, effects of gmm rys on RAD51 ctivtion ws nlyzed in the present study (explined further below). 1.3 Hy5 dvntges nd disdvntges in defense ginst UV-B rdition One of the crucil biotic fctors for plnts is light, which is known s source of energy nd s signl controlling growth nd development. Plnts uses different photoreceptor systems in order to coordinte their biologicl processes with the environmentl conditions. In A. thlin the most well-known photoreceptor systems re phytohcromes (phy), which include phya-e (perceiving the red/fr-red spectrl region), cryptochromes (cry), which include cry1 nd -2, phot1 nd -2 (blue/uv-a spectrl region) nd the UV resistnce locus 8 (UVR8) photoreceptor (UV-B spectrl regions) (Ulm nd Heijde, 2012). Trnsition of plnts from light to drkness or vice vers hs significnt impct on the orgnism s further growth nd the responses depend on set of trnscription fctors. One of the crucil proteins tht promotes photomorphogenesis of young seedlings is HY5. It hs been proposed to work s positive regultor downstrem of photoreceptor signling pthwy under hypocotyl elongtion (Koorneef et l. 1980). In ddition, erlier moleculr nlysis of HY5 in A. thlin reveled tht the HY5 gene encodes bsic leucine zipper protein (bzip) loclized in the nucleus nd regulting development of roots nd the hypocotyl (Oym et l. 1997). During drkness, HY5 is trgeted by the ubiquitin ligse CONSTITUTIVE PHOTOMORPHOGENESIS 1 (COP1) for degrdtion by the protesome complex, in contrst to during the light period when HY5 is llowed to ccumulte nd thus exert its effect s trnscription fctor (Osterlund et l. 2000). Previous studies reveled tht upon A. thlin exposure to UV-B light, HY5 hs n essentil role in defense ginst oxidtive dmge. 11

13 In response UV B COP1 binds to the UV-B receptor UVR8 (Figure 2) HY5 expression is promoted which results in plnt defense ginst UV-B light (Figure 3; Orvecz et l. 2006; Jenkins, 2014). However, the mode of ction of UV-B on HY5 ppers to be complex since more degrdtion of HY5 ws observed in cop1 mutnts thn in the wild type (Jenkins 2014). In ddition, Ulm et l. (2004) showed tht HY5 s well s HYH, which intercts with HY5, re ctivted independently of phya nd phyb upon exposure to UV-B light. Figure 2. High-fluence UV-B light ctivtes UVR8 pthwy nd cell deth. Therefter A) Mitogenctivted protein kinse (MAPK) gets ctivted nd leds to regultion of progrmmed cell deth (PCD); B) ROS gets relesed from chloroplst nd mitochondri which cuses membrne lipid nd protein dmge. This further led to cytochrome c relese nd DNA lddering. *Dotted lines shows pthwys stimulted by n unknown UV photoreceptor;? indictes unknown UV photoreceptor (Nwkr et l. 2013). 12

14 Figure 3. UVR8-medited signlling. UVR8 is presented minly s homodimer, which binds to COP1 under UV-B light nd thus enhnces HY5 trnscription. The HY5 trnscription fctor gets stbilized. Thus UVB response genes re ctivted, which include genes encoding proteins crucil in UV protection (e.g. phenylpropnoid biosynthesis pthwy, including CHS) nd dmge repir (e.g. UVR3). Abbrevitions: CHI, CHALCONE ISOMERASE; CHS, CHALCONE SYNTHASE; CRY, cryptochrome; COP1, CONSTITUTIVELY PHOTOMORPHOGENIC 1; ELIP1 nd ELIP2,EARLY LIGHT-INDUCIBLE PROTEIN 1 nd 2; FLS, FLAVONOL SYNTHASE; HY5, ELONGATED HYPOCOTYL 5; MYB12 nd MYB111, MYB DOMAIN PROTEIN 12 nd 111; PHR1, PHOTOLYASE 1; PHY, phytochrome; RUP1 nd RUP2, REPRESSOR OF UV-B PHOTOMORPHOGENESIS 1 nd 2; UV-B, ultrviolet-b rdition; UVR3, UV REPAIR DEFECTIVE 3; UVR8, UV RESISTANCE LOCUS 8; WL, white light (Ulm nd Heijde, 2012). 13

15 1.3 DNA Dmge Response (DDR) in plnts An orgnism is constntly exposed to DNA dmging fctors; therefore, it is crucil to possess DNA dmge response system in order to sense nd repir DNA dmge. DDR represents cluster of cellulr networks, which re ctivted due to exposure to ionizing rdition (IR) nd estblish DNA repir, cell cycle rrest nd poptosis in order to remove prticulr genetic mteril. However, plnts, like nimls, contin mny similr DNA dmge response fctors but re missing one of the importnt regultors, the p53 tumor suppressor tht is crucil in preventing DNA dmging fctors. Yoshiym et l. (2013), suggest tht suppressor of gmm response 1 (SOG1), plnt specific trnscription fctor, my ply crucil role in response to DNA dmge. DNA dmge recognition involves the txi telngiectsi mutted pthwy (ATM), ctivted by double strnd brek, nd txi telngiectsi nd Rd3-relted protein pthwy (ATR), ctivted by single strnd DNA brek. Yoshiym et l. (2013), showed lso tht expression level of the gene encoding RAD51, sensor involved in MRE11-RAD50-NBS1 (MRN) complex in ATM pthwy, is immeditely induced fter plnt exposure to DNA dmge. Thus the gene encoding protein Brest cncer 1 (BRCA1), requires the MRN complex in order to enhnce SOG1 (Figure 4). It hs lso been identified tht wide rnge of genes gets upregulted fter exposure to IR, wheres none is ctivted in the sog1-1 mutnt, which indictes tht severl trnscriptionl regultions re mintined through SOG1 (Yoshiym et l. 2009). In ddition, A. thlin tm mutnts showed hypersensitivity to gmm rdition but no sensitivity under UV exposure (Grci et l. 2003). In ddition, severl erlier studies reveled tht plnts with lrge chromosomes re more sensitive to ionizing rdition, compred to plnts with smller chromosomes, which re more resistnt. Species with predominntly crocentric chromosomes showed greter sensitivity to ionizing irrdition thn species with metcentric chromosomes. Moreover, incresed degree of ploidy increses degree of resistnce, thus plnt cell re less sensitive to irrdition tht niml cells, which rrely possess polyploidy (Sprrow nd Woodwell, 1962). 14

16 Figure 4. DNA dmge response in plnts. MRN complex involves the RAD51 gene which further enhnces SOG1 ctivtion nd thereby severl pthwys such s: DNA repir, Checkpoint, Progrmmed cell deth nd Endoredupliction. *Dotted lines indicte hypotheticl situtions (Yoshiym et l. 2013). 1.5 Defense systems in plnts ginst gmm rys Overproduction of free rdicls nd other ROS species triggers plnts self-defense, where pths of detoxifying enzymes re ctivted, such s peroxidses, scorbte peroxidse, superoxide dismutses nd glutthione reductse etc. (Esnult et l. 2010). Vnhoudt et l. (2014), illustrted tht superoxide dismutse (SOD) nd scorbte peroxidse (APX) incresed in A. thlin in roots, fter gmm exposure. In ddition, chronic exposure of rice (Oryz stiv) or A. thlin to cesium resulted in incresed expression of genes involved in cell defense, stress response nd detoxifiction (Rkwl et l. 2009; Shr et l. 2005). Kim et l. (2007) discovered tht 2165 gmm inducible nd 1735 gmm repressible genes were ctivted 9 dys fter irrdition of A. thlin. In ddition, trnscription of certin genes: RAD51, BRCA1 nd B type mitotic cyclin (CYCB1) were strongly induced within 8 hours fter gmm rdition (Cullign et l. 2006). 15

17 1.6 Flvonoid biosynthesis s n essentil fctor in UV-B- nd IR- defense Flvonoids re plnt secondry products tht re present in epiderml cell lyers of leves nd other tissues tht re sensitive to UV light such s pollen nd picl meristem (Shirley, 2002). A common chemicl structure of flvonoids is three ring (C6-C3-C6) structure. Flvonoids cn be divided in four mjor clsses: nthocynins, flvnols, flvnols nd pronthocynidins or tnnins (Figure 5A). The hve ntioxidnt ctivity ply crucil roles in plnts defense ginst UV exposure nd defense ginst phytopthogens, control of uxin physiology nd mle fertility (Petruss et l. 2013). Flvonoid biosynthesis follows the phenylpropnoid pthwy, where set of enzymes represented in Figure 5B, is ctivted by UV-B nd severl other environmentl conditions. One of the first enzymes to be ctivted in flvonoid biosynthesis is chlcone synthse (CHS) nd chlcone isomerse (CHI). In A. thlin there re three CHSlike genes representing smll gene fmily. One of them, AtCHS (TT4) hs been shown to be involved in flvonoid synthesis. Muttion in AtCHS lcks pronthocynidin formtion in the seed cot nd mutnt of in this gene is nmed trnsprent test (tt4; Shirley et l. 1995, Sito et l. 2013). Some erlier studies on A. thlin showed UV-hypersensitive phenotypes when chlcone synthse is deficient (Li et l. 1993; Christie nd Jenkins, 1996). 16

18 Figure 5. (A) Flvonoid biosynthesis pthwy in plnt cells with the enzymes involved: CHS, chlcone synthse; CHI, chlcone isomerse; F3H, flvnone 3-hydroxylse; F3'H, flvonoid 3'-hydroxylse; F3'5'H, flvonoid 3',5'-hydroxylse; DFR, dihydroflvonol reductse; LDOX, leuconthocynidin oxidse; UFGT, UDP-glucose flvonoid 3-O-glucosyl trnsferse; MT, methyltrnsferse). Pronthocynidins (PAs) synthesis brnches off the nthocynin pthwy (LAR, leuconthocynidin reductse; ANR, nthocynidin reductse; STS, stilbene synthse). (B) Chemicl structures of different flvonoid groups (Petruss et l. 2013). 17

19 1.6.1 High Performnce Liquid Chromtogrphy (HPLC) method High Performnce Liquid Chromtogrphy is method used to seprte components from mixture, determine their biologicl chrcteristics nd thus nlyze them. This method is used for different purposes such s identifying vitmin D in blood, drugs in urine, seprtion of compounds from complex biologicl structures nd in nlysis of phrmceuticl products. The HPLC method works on the sme principle s pper chromtogrphy, where mobile phse moves to solid sttionry phse. In order to crete mobile phse, pump moves the solvent through the chromtogrphic system. Furthermore, n injection system is needed to inject the probes into system by which the smple reches the sttionry phse nd seprtion occurs. After being seprted, the smples reches detector, moves through it nd sends signls to computer softwre (Figure 6). Figure 6. High Performnce Liquid Chromtogrphy method (Czplicki, 2013). 18

20 2. AIMS OF THE STUDY To study rdiosensitivity in A. thlin we exposed young seedling of two genotypes, WT Ler nd mutnt hy5 for gmm rditions, including tretments from 21.6 to 90.7 Gy. Aim of the study ws to investigte dose-response reltionship by testing out: Physiologicl structure, i.e. number of rosette leves, lef size, stem length nd time to visible flower buds. Reltive trnscript levels of RAD51 RECOMBINASE (RAD51) nd TRANSPARENT TESTA (TT4) Synthesis of phenolic compounds Production of rective oxygen species (ROS) 3. MATERIALS AND METHODS 3.1 Plnt mterils nd growth conditions Arbidopsis thlin (A. thlin) WT Ler nd mutnt hy5 seeds were surfce sterilized in Tween solution (1 ml of sodium hypochlorite solution, 9 ml of EtOH nd two drops of Tween), rinsed five times in distilled wter, nd once in EtOH 96%. Sterilized seeds were plced on filter pper for drying nd then evenly sown on ½ MS medium (Duchef Biochemie, Hrleem, Netherlnd), 0.8% gr. In order to strtify the seed, petri dishes (5 cm in dimeter, 2 cm height) were covered with luminum foil nd plced for 4 dys t 4 C. The strtified A. thlin seeds were then germinted for 3 dys under bout 30 µmol m -2 s -1 irrdince (TL-D 58W/840 lmps, Phillips, Eindhoven, Netherlnds) with the temperture set t 21 C. 3.2 Gmm ( 60 Co source) rdition of plnts Gmm tretment included exposure of three dys old seedlings with doses rnging from 0 to 90.7 Gy, using 60 Co gmm source (THE NMBU LOW DOSE GAMMA RADIATION EXPOSURE FACILITY). Co-60 gmm irrdition source t CERAD/NMBU provides dose rte field from 2.5 Gy/h (t source) down to 300 µgy/h (Figure 8). The climte control conditions for the experimentl hll were: 4-37 C (+/- 1 C), c lux with utomtic dimer, 40-65% (ScnClime) humidity nd ventiltion t 300 m 3 /h (HEAPA filtered). 19

21 Two gmm tretment experiments were performed, where the first irrdition lsted for 72 h, while the second lsted for 168 h (Tble 1). Petri dishes with seedlings on germintion medium were plced verticlly in front of the collimtor (42.5 cm from rdition source nd 0.5 mm from the collimtor edge) divided in two rows (WT Ler nd hy5 mutnt). The first experiment hd two rows nd ech contined four columns with five Petri dishes in ech, while the second experiment included two rows contining five columns with four Petri dishes in ech respective column (Figure 7). Gmm tretments in both experiments re shown in Tble 1, s clculted in the middle of the Petri dishes t the different distnces from the gmm source. During the rdition the room temperture ws set t 20 C with 12 h dily light period with photon flux density of bout 55 µmol m -2 s -1 provided by High pressure Metl Hlid lmps (HPI-T plus 250W lmps, Phillips, Eindhoven, The Netherlnds). The irrdince ws mesured t the top of the petri dishes with Li-Cor Quntum/Rdiometer/Photometer (model LI-250, LI-COR, Lincoln, NE, USA). The red/fr red-rtio ws 3.5 (mesured by Sky Instruments, 660/730 sensor, Powys, Wles, UK) sensor. The lmps were plced 1.40 m bove the surfce of the uppermost Petri dishes with seedlings. During the rdition, s mentioned bove, the Petri dishes were plced upon ech other within ech respective row. In order to insure more equl light intensity nd gmm rdition effect, in the middle of ech experiment the Petri dishes were rotted 180 degrees nd the two upper nd two lower dishes were interchnged. Control smples (12 petri dishes in three columns) were plced out of the rdition sector, protected by led boxes nd plced under light nd temperture conditions s described for the rdited seedlings. Tble 1. Exposure of A. thlin plnts to gmm rdition using 60 Co source. Ech respective row (including four columns of Petri dishes with five dishes in ech in 1 st experiment nd five columns of Petri dishes with four dishes in ech in 2 nd experiment, i.e. t different distnces from the gmm source) bsorbed specific mount of the gmm rdition, represented both s dose rte (dose h -1 ) nd totl dose. 1 st experiment 2 nd experiment Row Dose h -1 Totl dose (72 h) Dose h -1 Totl dose (168 h) Gyh Gy 0.54 Gyh Gy Gyh Gy 0.43Gyh Gy Gyh Gy 0.35Gyh Gy Gyh Gy Gyh Gy Gyh Gy 20

22 Figure 7. A. thlin WT Ler nd hy5 mutnt seedlings in Petri dishes plced in front of collimtor nd treted with gmm rdition from 60 Co gmm source. Petri dishes were orgnized into two rows of columns (wild type vs hy5 mutnt). The figure represents the second experiment, contining five columns, while the first experiment contined four columns. Figure 8. The NMBU low dose gmm rdition exposure fcility (FIGARO), plce where A. thlin seedling were plced t different distnced from the gmm rdition source. Control plnts (no rdition) were plced in the sme room nd shielded by led. 21

23 3.3 ROS (Rective Oxygen Species) stining of plnt tissue DAB (3, 3 - diminobenzidin) stining of H2O2 Immeditely fter gmm exposure, 3-4 A. thlin seedlings were plced in 1 ml pre-prepred queous solution of DAB (10% DAB (100 µl) diluted in 900 µl milliq- H2O) in order to test the plnt tissue for its H2O2 content. Seedlings from ech gmm tretment including unrdited control smples, were incubted in n Eppendorf tube for pproximtely 18 h. Therefter the seedlings were boiled for 15 min in 96% EtOH t temperture set t 100 C nd exmined using microscope. Presence of H2O2 is indicted by reddish-brown color, (Thordl- Christensen et l. 1997) NBT (Nitro blue tetrzolium) stining super oxide nion A similr procedure ws followed for NBT stining of superoxide nion. Seedlings were incubted in drkness for 30 min in Nitro blue tetrzolium (Promeg, Mdison, USA). After incubtion, seedlings were wshed in H2O in order to stop the rection nd therefter boiled in 96% EtOH for 15 min t temperture set t 100 C. Microscopy nlysis followed. Beyer et l. (1987) described super oxide nion presence s deposits of drk-blue insoluble formzn compounds. 3.4 Growth conditions nd growth mesurements fter gmm tretment Right fter gmm tretment, plnts were plced t the sme conditions s before gmm exposure, bout 30 µmol m -2 s -1 irrdince with the temperture set t 21 C. The dy fter, plnts were trnsferred to pots (12 cm dimeter, 7 cm height) filled with S- soil (45% low moist pet, 25% high moist pet, 25% pelite nd 5 % snd). Five plnts per pot of A. thlin WT Ler nd hy5 mutnt were cultivted in growth chmber (Conviron, Growth Chmbers, Controlled Environments Ltd, Winnipeg, Cnd) with dily light period t 12 h with photon flux intensity t 50 µmol m -2 s -1 from fluorescent tubes (60W lmps, Phillips, Eindhoven, Netherlnds). Temperture ws set t 20 C nd red/ fr-red rtio ws djusted to 1.7 with incndescent lmps (Osrm, Munich, Germny) nd the reltive ir humidity (RH) ws djusted to 78% corresponding to 0.56 kp wter vpour pressure deficiency. Chnge of irrdince followed fter seven dys, when light period ws set t 8h with 100 µmol m -2 s -1 irrdince (Cool White 215W lmps, V. H. O, Ontrio, Cnd). 22

24 The ide ws tht since shorter dylight (nd thus lower light sum) results in slower development tht longer dylength, it might be esier to distinguish fter-effects of different doses of gmm rdition given tht these ffects growth nd development differently. Temperture, red/fr-red rtio nd RH remined the sme. Growth recordings were performed for 20 plnts from ech tretment per gmm; number of rosette leves, flower bud registrtions, height of the inflorescence (bolting) stem, lef length (petiole nd lmin) nd lef width. Number of rosette leves (leves >5 mm) ws recorded t dy 19, 24, 29 fter gmm tretment for the first experiment nd for the second experiment t dy 18, 22 nd 26 fter gmm exposure, i.e. until the first flower bud ws visible. Reproductive growth, recorded s time to visible flower buds, ws registered ech dy, but visible flower buds were seen t dy 32, 35 nd 38 fter the gmm irrdition tretment. Registrtion of reproductive growth for the second experiment followed t dy 26, 29 nd 33 fter gmm tretment, i.e. until ll plnts hd visible flower buds. Length of the bolting stem (distnce from the bse to the first flower on the stem) ws mesured t the end of the second experiment (51 st dy fter gmm rdition) by using ruler. Lef size prmeters were mesured for rosette lef number six from the bse of the plnt by mesuring the length nd width of the lef lmin nd petiole length by using digitl slide cliper. 3.5 Chlorophyll fluorescence mesurements In order to obtin informtion bout the photosystem II (PSII) efficiency, 28 dys fter the gmm tretment in experiment 2, pots were plced in the drk for 15 min. A modulted fluorometer (PAM-2000, Wlz, Effeltrich, Germny) ws then used to mesure optiml PSII efficiency by chlorophyll fluorescence. Mesurements were performed on 35 plnts from ech gmm tretment. Fm nd Fo were mesured for drk dpted leves using sturting pulse of 0 6 s. Therefter, Fv/Fm ws clculted by Fv/Fm = (Fm - Fo)/Fm (Stvng et l. 2010). 23

25 3.6 RNA extrction nd gene nlysis (RT-PCR) For studies of gene expression plnts (entire rosettes) were hrvested into liquid nitrogen 51 dys fter the gmm tretment, nd stored t -80 C until nlyses. Totl RNA ws extrcted 51 dys fter gmm tretment from the WT Ler nd mutnt hy5 leves using the RNesy Plnt Mini Kit (Qigen, Chtsworth, CA) following the mnufcturers specifiction. In order to test RNA qulity for further nlyses n Agilent 2100 Bionlyzer with n RNA 6000 NnoKit ws used (Agilent technologies, Wldbronn, Germny).The resulting cdna ws diluted 1:5 nd 2 µl were used in the quntittive mplifiction rection for the smples AtACTIN (ACT) ws used s internl stndrd for quntifiction of trnscript levels of AtRAD51 nd AtTT4. qrt- PCR ws performed in 20 µl with Pltinum Quntittive PCR Supermix-UDG, SYBRGreen nd using specific primers shown in Tble 2. In order to investigte the trnscript levels in the wild type nd the hy5 mutnt nd to compre different gmm tretments with control, cycle threshold (Ct) vlues were clculted for treted smples (Ct trget treted Ct referencetreted smple) nd clibrtor smple (Ct trget clibrtor Ct referenceclibrtor smple ). Furthermore, the ΔΔCt vlue ws clculted for ech of the gmm treted smples (ΔΔCttreted smples= ΔCttreted smple ΔCtclibrtor smple). In order to determine rtio of expression levels in hy5 versus wild type nd different gmm tretments for specific genes (RAD51 nd TT4) results were presented s fold difference in log2 scle: Fold difference = Log2 (RQ) = -ΔΔCt. Tble 2. Forwrd nd reverse sequences for A. thlin genes: ACT, RAD51 nd TT4 used in qpcr Primer Forwrd sequence (5-3 ) Reverse sequence (5-3 ) AtACT TCAGATGCCCAGAAGTCTTGTTCC CCGTACAGATCCTTCCTGATATCC AtRAD51 GCCTATGCGAGGGCGTATAA CGAAAGCTCTCCCCTTCCAG AtTT4 ACATGCCTGGTGCTGACTAC CACGTGCTCCACGATTGTTC method 24

26 3.7 Quntifiction of phenolic compounds from lef mteril 65 dys fter exposing A. thlin for different gmm tretments, plnt mteril ws collected in order to exmine phenolic compounds. Before collection, the inflorescence stem ws removed by using sclpel. Therefter plnts were freeze dried for 24 h nd pproximtely 20 mg plnt mteril ws weight by micro scle (Mettler Toledo, Oslo, Norwy). Ech smple contined one plnt nd in totl eight plnts were nlyzed seprtely for ech respective tretment. To ech smple 2 ml Eppendorf tube, one stinless steel bed (5mm in dimeter) ws dded. Therefter 600 µl MeOH ws dded to ech vil nd the smples were homogenized for 30s in centrifuge t 6500rpm (Retsch, Hn, Germny). The vils where plced in n ice bth for 15 min nd therefter centrifuged for 3 min t mx speed rpm. The superntnt ws pour into mrked regent vil (10 ml size) nd procedure ws repeted for ech smple 4 times, without the 15 min on ice bth, leving the debris colorless. After collecting of the extrcts, the MeOH ws evported by use of SpeedVc (SAVANT SC210A, Thermo Scientific, Weverville NC, USA) vcuum centrifuge (Eppendorf tubes 15 ml) nd the dried extrcts were dissolved in 200 µl MeOH with the help of n ultrsound bth, nd diluted with 200 µl Millipore-wter. The liquid extrcts were therefter trnsferred by Psteur pipette to 1.5 ml Eppendorf vil nd centrifuged. Therefter, the extrcts were poured into HPLC vils, cpped nd nlyzed on HPLC High-performnce liquid chromtogrphy (HPLC) nlysis Phenolic compounds were nlyzed by HPLC (Agilent, Series 1100, Germny). The different metbolites were seprted by use of 50 x 4.6 mm ODS Hypersil column (Thermo Fisher Scientific Inc, Wlthm, MA, USA). The smples were eluted (flow rte 2 ml min-1) using MeOH: wter grdient from X-Y% (Nybkken et l. 2012). The totl injection volume ws 20 µl, nd the column temperture ws 30 C. The identifiction of the phenolic compounds ws bsed on retention times, UV spectr nd comprison with those of commercil stndrds. The chromtogrm peks were used to mesure quntity of phenolic cids nd flvonoid compounds. The following formul ws used: 25

27 Quntity = A x RF x V dissolved V injected x Weight mg A = Are under the pek RF = Response Fctor V dissolved = 200µl MeOH nd 200µl Millipore-wter used in order to solve plnt mteril V injected = mount of smple injected, here 20µl Weight = dry lef mteril (mg), here totl plnt without bolting stem 3.8 Sttisticl nlyses For the recorded growth prmeters, two wy nlyses of vrince were done using ANOVA generl liner model in Minitb sttisticl softwre (Minitb 17, Minitb Inc, PA, USA) for effects of the two fctors, genotype nd tretment (p 0. 05). In order to detect differences between mens, Tukey s test ws used. Regression nlysis (Minitb 16, Minitb INC, PA, USA) ws used for nlyses of effect of different gmm doses on time to visible flower bud. 26

28 Number of rosette leves 4. RESULTS 4.1 Experiment 1: Effects of gmm rdition ( Gy) on WT Ler nd hy Effect of 60 Co gmm rdition on number of rosette leves In order to investigte effects of different gmm rdition doses on lef formtion in A. thlin WT Ler nd the hy5 mutnt, the number of rosette leves ws recorded (Figure 9 nd 10) 19, 24 nd 29 dys fter gmm irrdition. Sttisticl nlysis done for dy 29 showed some significnt differences with the highest dose showing significntly lower lef number thn the control. However, overll, the number of rosette leves between different gmm tretments did not vry systemticlly with gmm dose in ny of the genotypes Time fter gmm rdition (dy) b bc cd d Control WT Ler 39.6 Gy 31.7 Gy 25.9 Gy 21.6 Gy Figure 9. Number of rosette leves in WT Ler A. thlin fter exposure to 60 Co gmm rdition. Results re men of 20 plnts, ± SE for ech tretment. Different letters indicte significnt differences, while sme letter showing no difference (p 0.05). 27

29 Number of rosette leves b b b Time fter gmm rdition (dy) Control hy Gy 31.7 Gy 25.9 Gy 21.6 Gy Figure 10. Number of rosette leves in the hy5 mutnt in A. thlin fter 60 Co gmm rdition. Results re men of 20 plnts, ± SE for ech tretment. Different letters indicte significnt differences, while sme letter show no difference (p 0.05) Effects of 60 Co gmm rdition on flower bud development Number of rosette leves t visible flower buds were recorded for A. thlin WT nd mutnt hy5 fter gmm rdition (Figure 11). Sttisticl nlysis exhibited smll significnt differences between control nd the highest gmm tretments 39.6 nd 31.7 Gy in hy5 mutnt. Control plnts in hy5 mutnt exhibited higher mount of rosette leves t visible flower buds (20%) compred to the highest gmm doses 39.6 nd 31.7 Gy. On the other hnd, WT plnts did not show ny mjor differences between different tretments. 28

30 Number of leves t first visible flower bud bc bc bc bc c Control 39,6 31,7 25,9 21,6 Gmm tretment (Gy) b bc b bc WT Ler hy5 Figure 11. Number of rosette leves t visible flower buds in A. thlin WT nd hy5. Results re men of 20 plnts, ± SE for ech tretment. Different letters indicte significnt differences, while sme letters show no differences (p 0, 05). Percentge of flower buds in A. thlin WT nd mutnt hy5 ws recorded t dy 32, 35 nd 38 fter gmm rdition (Figure 12 nd 14). In order to determine whether different gmm tretments exhibit significnt differences, regression nlysis for dy 32 were done for both genotypes (Figure 13 nd 15). The WT control then exhibited higher percentge of plnts with flower buds (25%) compred to the highest gmm tretment (39.6 Gy; Figure 13). Since R-sq vlue for WT showed 29.6%, no mjor liner reltionship between tretment nd response. In mutnt hy5 no significnt differences ws observed between the control nd the highest gmm tretments (Figure 15). R- sq vlue for hy5 showed 11.9%. 29

31 Plnts with flower buds (%) Time fter gmm rdition (dy) Control WT Ler 39.6 Gy 31.7 Gy 25.9 Gy 21.6 Gy Figure 12. Number of rosette leves t the first visible flower buds in A. thlin WT fter gmm tretment. Results re men of 20 plnts, ± SE for ech tretment. Sctterplot of Plnts with flower buds (%) WT vs Gmm tretment (Gy) 90 Plnts with flower buds (%) WT Gmm tretment (Gy) Figure 13. Regression nlysis on plnts with flower buds (%) in WT A. thlin fter gmm tretments. R-sq vlue: 29.6%. 30

32 Plnts with flower buds (%) Time fter gmm rdition (dy) Control hy Gy 31.7 Gy 25.9 Gy 21.6 Gy Figure 14. Number of rosette leves t visible flower buds in A. thlin mutnt hy5 fter 60 Co gmm tretment. Results re men of 20 plnts, ± SE for ech tretment. Sctterplot of Plnts with flower buds (%) hy5 vs Gmm tretment (Gy) 70 Plnts with flower buds (%) hy Gmm tretment (Gy) Figure 15. Regression nlysis on plnts with flower buds (%) in hy5 A. thlin fter gmm tretments. R-sq vlue: 11.9%. 31

33 Stem lenght (cm) Effects of 60 Co gmm rdition on bolting stem length Finl length of the bolting stem for both genotypes ws mesured 51 dys fter gmm exposure (Figure 16). Overll, there were no significnt differences between the different gmm dose s nd the control. For the hy5 mutnt the sttisticl test exhibited significnt difference between the lowest dose compred to the highest dose nd control, but no relevnt difference between the control nd the highest dose (39.6 Gy). 20 bc c bc c bc bc bc b bc WT Ler hy5 5 0 Control 39,6 31,7 25,9 21,6 Gmm tretment (Gy) Figure 16. Finl length of the bolting stem in A. thlin WT nd mutnt hy5 t 51 st dy fter gmm rdition tretment. Results re men of 20 plnts with ± SE. Different letters indicte significnt differences, while sme letter denote no significnt differences (p 0.05). 32

34 Number of rosette leves 4.2 Experiment 2: Effects of gmm rdition ( Gy) on WT Ler nd hy Effect of 60 Co rdition on number of rosette leves Compred to the first experiment, the second experiment included gmm tretment with longer exposure time, thus higher gmm dose. Compring different gmm tretments with control in both genotypes (Figure 17 nd 18), generl liner model nlysis showed no significnt differences in number of rosette leves t dy 26 fter gmm rdition Control WT Ler 90.7 Gy 72.2 Gy 58.8 Gy 48.7 Gy 30.2 Gy Time fter gmm rdition (dy) Figure 17. Number of rosette leves in A. thlin WT fter different gmm rdition doses. Results re presented s men of 20 plnts, ± SE. 33

35 Number of rosette leves Control hy Gy 72.2 Gy 58.8 Gy 48.7 Gy 30.2 Gy Time fter gmm rdition (dy) Figure 18. Number of rosette leves in A. thlin mutnt hy5 t dy 18, 22 nd 26 fter gmm rdition. Results re men of 20 plnts with ± SE Effects of 60 Co gmm rdition on plnt development t flowering stdium Observtions on number of rosette leves t first visible flower buds were recorded fter gmm tretment in A. thlin WT Ler nd mutnt hy5 (Figure 19). By compring control nd the highest gmm dose (90.7 Gy) in ech respective genotype, no significnt differences were observed. On the other hnd, compring controls nd the highest dose (90.7 Gy) between WT nd hy5 mutnt, WT exhibited reduced number of leves t first visible flower buds compred to hy5. 34

36 Number of leves t fisrt visible flower bud b b b b b b b b b b b 10 WT Ler hy5 5 0 Control Gmm tretment (Gy) Figure 19. Number of rosette leves t first visible flower buds in A. thlin WT nd mutnt hy5. Results re showed s men of 20 plnts ± SE. Different letters indicte significnt differences (p 0.05). Percentge of plnts with flower buds were determined on dy 26, 29 nd 33 fter gmm rdition for A. thlin WT nd mutnt hy5 (Figure 20 nd 22). On 34 th dy fter gmm rdition, pictures were tken of unrdited control plnts nd doses 90.7 nd 48.7 Gy (Figure 24). Regression nlysis for dy 29 were done in order to investigte the gmm dose response reltionship for ech respective genotype (Figure 21 nd 23). For the WT (Figure 20), the two highest doses, 90.7 Gy nd 72.2 Gy differed significntly from the control t dy 29. C 90% of the control plnts hd flower buds t dy 29, while plnts exposed for 90.7 Gy nd 72.2 Gy hd less number of plnts with flower buds, round 40% (Figure 21). Generlly, it ppered tht flowering ws delyed with incresing gmm dose (R-sq t 73.4%). The hy5 mutnt showed lowest percentge of plnts t visible flower buds in tretment 90.7 Gy (Figure 22). In comprison with the hy5 control (c 30% plnts with flower buds), no systemtic difference between the gmm doses ws observed. However, for the other gmm tretments, picture ws less cler thn for the WT since the control exhibited second lowest percent of plnts with flower buds (bout 30 %) t dy 29 fter rdition. 35

37 Plnts with flower buds (%) Time fter rdition (dy) Control WT Ler 90.7 Gy 72.2 Gy 58.8 Gy 48.7 Gy 30.2 Gy Figure 20. Percent A. thlin WT Ler plnts with flower buds (%) fter gmm exposure. Results re men of 20 plnts from ech tretment. Sctterplot of Plnts with flower buds (%) WT vs Gmm tretment (Gy) 100 Plnts with flower buds (%) WT Gmm tretment (Gy) Figure 21. Regression nlysis for A. thlin WT Ler t dy 29 fter gmm exposure. R-sq vlue: 73.4%. 36

38 Plnts with flower buds (%) Time fter rdition (dy) Control hy Gy 72.2 Gy 58.8 Gy 48.7 Gy 30.2 Gy Figure 22. Percent A. thlin hy5 mutnt plnts with flower buds (%) fter gmm exposure. Results re men ± SE of 20 plnts from ech tretment. Sctterplot of Plnts with flower buds (%) hy5 vs Gmm tretment (Gy) 60 Plnts with flower buds (%) hy Gmm tretment (Gy) Figure 23. Regression nlysis for A. thlin hy5 t dy 29 fter gmm exposure. R-sq vlue: 6%. 37

39 hy5 Control WT Ler Control hy Gy WT Ler 90.7 Gy hy Gy WT Ler 48.7 Gy Figure 24. A. thlin hy5 mutnt nd WT 34 dys fter gmm tretment. Ech pot contins five plnts nd represent specific Effects of 60 gmm tretment. Co gmm rdition on length of the bolting stem 38

40 Stem length (cm) Effects of 60 Co gmm rdition on bolting stem length To investigte the effect of gmm rdition on length of the bolting stem in A. thlin WT nd mutnt hy5, totl length of the stem ws mesured 51 dy fter gmm rdition (Figure 25). Pictures of the unrdited control nd respective doses: 90.7, 72.2, 58.8, 48.7 nd 30.2 Gy were tken for both genotypes (Figure 26). In WT length of the bolting stem ws significntly shorter (35%) for the highest gmm dose (90.7 Gy) compred to the control, wheres the other doses did not differ significntly from the control. For the hy5 mutnt no significnt differences were observed b d cd cd bcd bcd b bcd bcd bc WT Ler hy Control Gmm tretment (Gy) Figure 25. Length of the bolting stem for A. thlin WT Ler nd mutnt hy5. 51 dy fter gmm exposure. Results re presented s men of 20 plnts with SE. Sme letters represent no significnt differences, while different letters differ significntly (p 0.05). 39

41 Control 90,7Gy 72,2Gy 58,8Gy 48,7Gy 30,2Gy A. thlin hy5 Figure 26. A. thlin WT Ler nd hy5 51 dys fter gmm exposure. Ech pot contins five plnts. 40

42 Lef size (cm) Effect of 60 Co gmm rdition on lef size Lef size (length nd width) of led 6 (fully extended lef) counted from the bse of the plnt, ws mesured 51 dys fter gmm tretment on A. thlin WT nd mutnt hy5 (Figure 27 nd 28). Lmin nd petioles mesurements gve totl lef length. In the WT lef width ws slightly, but significntly lower t the highest gmm dose compred to the control (Figure 27). The hy5 mutnt exhibited significnt reduction in lef length t the two highest gmm doses compred to the other gmm tretments nd control (Figure 28). 35,0 30,0 25,0 b b b b b 20,0 15,0 10,0 c bc bc b Lef lenght Lef width 5,0 0,0 Control WT Ler Gmm tretment (Gy) Figure 27. Lef size (lef length nd width) of A. thlin in WT Ler. Results re represented s men of 20 ±SE. Sme letters show no significnt differences, while different letters differ significntly (p 0.05). 41

43 Lef size (cm) 35,0 30,0 25,0 20,0 b b 15,0 10,0 bc bc b Lef lenght Lef width 5,0 0,0 Control hy Gmm tretment (Gy) Figure 28. Lef size (lef length nd width) of A. thlin in mutnt hy5. Results re represented s men of 20 plnts ±SE. Sme letters show no significnt differences, while different letters differ significntly (p 0.05) Effect of 60 Co Gmm rdition on reltive gene expression: TT4 nd RAD51 Reltive gene expression of TRANSAPRENT TESTA (TT4) nd RECOMBINASE RAD51 (RAD51) ws nlyzed by RT-PCR in the A. thlin WT nd hy5 from experiment 2 (Figure 29 nd 30). Plnts tested for reltive gene expression were exposed to the following tretments: 90.7 Gy, 72.2 Gy, 48.7 Gy nd control. No significnt differences in trnscript levels of TT4 between different gmm tretments nd control for ny of the genotypes were observed, only slight trend of incresed expression with incresing gmm dose in the WT (Figure 29). On the other hnd, reltive expression level of RAD51 (Figure 30) showed significnt difference (70-50%) in the WT between the control nd the highest gmm doses, 90.7 Gy nd 72.2 Gy. In the hy5 mutnt, no significnt differences in RAD51 trnscript levels were observed. 42

44 Reltive expression level of RAD51 gene Reltive expression level of TT4 gene 4,5 4 3,5 3 2,5 2 90,7Gy 72,2Gy 48,7Gy 1,5 1 Control 0,5 0 hy5 WT Ler Figure 29. Reltive expression level of the TT4 gene in A. thlin fter gmm exposure of genotypes WT nd hy5. Results re presented s men of three smples consisting of three plnts ech. The trnscript levels were normlized ginst ctin nd therefter ginst the control within ech genotype. All smples were nlyzed in triplicte. Sme letters represent no significnt differences, while different letters differ significntly (p 0.05) ,7Gy 3 2 b b 72,2Gy 48,7Gy Control 1 b b b b 0 hy5 WT Ler Figure 30. Reltive expression level of the RAD51 gene in A. thlin fter gmm exposure of genotypes WT nd hy5. Results re presented s men of three smples consisting of three plnts ech. The trnscript levels were normlized ginst ctin nd therefter ginst the control within ech genotype. All smples were nlyzed in triplicte. Sme letters represent no significnt differences, while different letters differ significntly (p 0.05). 43

45 Sum of phenolic cids (mg g-1 DW) Effect of 60 Co gmm rdition on phenolic cids nd flvonoid biosynthesis HPLC nlysis of phenolic cids nd flvonoids ws performed in the A. thlin WT nd hy5 mutnt for the gmm dose s: 90.7 Gy, 72.2 Gy, 48.7 Gy nd control (Figure 31 nd 32). Sum of the concentrtion of the phenolic cids, presented in Figure 31, indictes significnt difference between control nd the highest gmm tretment (90.7 Gy) in the WT. WT plnts exposed to the highest gmm tretment, displyed 20% higher content of phenolic cids thn control. For the hy5 mutnt there ws similr trend, lthough not sttisticlly significnt. The totl flvonoid level, displyed in Figure 32, lso differed significntly between the genotypes. The hy5 mutnt exhibited lower levels (50%) of flvonoids compred to the WT. In ddition, by compring mount of flvonoids only in WT, the control exhibited significntly higher concentrtion (25%) of flvonoid compounds compred to the highest gmm tretment (90.7 Gy). 1,8 1,6 1,4 1,2 1,0 0,8 0,6 b b b b b b Control 90.7 Gy 72.2 Gy 48.7 Gy 0,4 0,2 0,0 hy5 WT Ler Figure 31. Sum of phenolic cids in A. thlin WT nd mutnt hy5. Results re men of eight smples ech contining one plnt ± SE. Equl letter re showing no significnt differences, while different letters differ significntly (p 0.05). 44

46 Sum of Flvonoids (mg g-1 DW) 0,7 0,6 0,5 0,4 0,3 0,2 0,1 c c c c b b Control 90.7 Gy 72.2 Gy 48.7 Gy 0,0 hy5 WT Ler Figure 32. Sum of flvonoids in A. thlin WT nd mutnt hy5. Results re men of eight smples, ech contining one plnt ± SE. Equl letter re showing no significnt differences, while different letters differ significntly (p 0.05). We identified 14 different phenolic compounds. The pek number shows specific phenolic compounds (Tble 3). We identified four kempferol-glycosides, the rest were tenttively identified s phenolic cids. With the equipment nd stndrds vilble, further specifiction of phenolic cids ws not possible. Tble 3. Different phenolic compounds detected t pek number by using HPLC method. Pek number Compound 1 Phenolic cid 2 Phenolic cid 3 Phenolic cid 4 Phenolic cid 5 Phenolic cid 6 Phenolic cid 7 Kempferol-3glctoside 8 Kempferol-3glucoside 9 Phenolic cid 10 Phenolic cid 11 Phenolic cid 12 Kempferol-3rbinoside 13 Phenolic cid 14 Kempferol-3rhmnoside 45