Biochemical and Biophysical Research Communications 308 (2003)

Biochemical and Biophysical Research Communications 308 (2003) 469 473 BBRC www.elsevier.com/locate/ybbrc Precise quantitation of 5a-reductase type 1 mrna by RT-PCR in rat liver and its positive regulation by testosterone and dihydrotestosterone Jesus M. Torres and Esperanza Ortega * Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Granada, Avda. de Madrid s/n., 18012 Granada, Spain Received 3 July 2003 Abstract The liver is a multifunctional organ responsible for steroid hormones catabolism. Thus, the enzymes responsible for steroid catabolism are located in the liver, including the steroid 5a-Reductase (5a-R) (EC 1.3.99.5) which catalyzes the conversion of compounds with D 4;5 double bonds such as testosterone (T) into their respective reduced derivatives such as dihydrotestosterone (DHT), which are more hydrosoluble, therefore facilitating their excretion. We present precise measurements of mrna levels of steroid 5a-Reductase type 1 isozyme (5a-R1) in the liver of male rats with different androgen status, using a quantitative RT-PCR coupled to laser-induced fluorescence capillary electrophoresis (LIF-CE). By means of this technique, we demonstrate a high level of expression of the gene that encodes 5a-R1 isozyme in male rat liver, and both T and DHT exert a positive control on the genetic expression of liver 5a-R1 isozyme. Since DHT does not contain a D 4;5 double bond, our results raise the possibility that hepatic 5a-R type 1 not only participates in the catabolism of steroids with D 4;5 double bonds, but also in other physiological functions, perhaps in the masculinization of the external genitalia in males with 5a-R type 2 gene deficiency. Ó 2003 Elsevier Inc. All rights reserved. Keywords: Quantitative RT-PCR; 5a-Reductase type 1; Testosterone; Dihydrotestosterone; Liver The liver is a multifunctional organ responsible for some catabolic functions, including steroid hormone catabolism. The hepatic catabolism of steroids in rat and the enzymes implicated in these events, including the enzyme steroid 5a-Reductase (5a-R) (EC 1.3.99.5), have been known for a long time [1,2]. In some target tissues, including the liver, testosterone (T) is converted to 5a-dihydrotestosterone (DHT) by the enzyme 5a-R [3]. It has recently been demonstrated that 5a-R occurs as two isozymes, 5a-Reductase type 1 (5a-R1) and 5a- Reductase type 2 (5a-R2), which have different biochemical properties and may, therefore, be expected to have different physiological roles. 5a-R2 is the predominant enzyme in the prostate gland and other androgen-dependent organs [3], whereas 5a-R1 is the predominant enzyme in extraprostatic tissues, such as skin and liver. * Corresponding author. Fax: +34-95-824-90-15. E-mail address: esortega@ugr.es (E. Ortega). In peripheral tissues (e.g., liver), 5a-R type 1 and reductive 3a-hydroxysteroid dehydrogenase isoforms work consecutively to eliminate androgens and protect against excess hormone [4]. Hepatic 5a-reduction of T could not only be a mechanism to obtain more hydrosoluble 5a-reduced metabolites of this hormone, facilitating in this way their excretion, but could also allow the production of DHT, an androgen with a much higher affinity for the androgen receptor than T itself. DHT is now considered not only as a metabolite of T intracellularly produced in androgen-dependent organs, but also as a true hormone, with all the corresponding characteristics [3]. In fact, DHT produced in organs such as the skin and liver circulate in the blood and could exert their effects in different and distant organs. We recently demonstrated that the isozyme 5a-R1 is under the positive control of both androgens T and DHT in rat prostate [5]. We also found that the regulation of the 5a-Reductase isozymes by both T and DHT is 0006-291X/$ - see front matter Ó 2003 Elsevier Inc. All rights reserved. doi:10.1016/s0006-291x(03)01423-2

470 J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) 469 473 different in rat prostate than in brain [6]. Two questions are raised by these findings: whether hepatic 5a-Reductase is regulated by the androgens T and DHT; and how 5a-Reductase is regulated by T and DHT in the liver. If hepatic 5a-Reductase is under the positive control of DHT (with no D 4;5 double bond in its molecule), it is clear that hepatic 5a-Reductase not only exerts a catabolic role, transforming T into a more hydrosoluble metabolite DHT, but may also play other important physiological functions. The role of 5a-R type 1 could be decisive in the masculinization during puberty of the external genitalia in individuals with 5a-Reductase type 2 isozyme deficiency. Steroid 5a-Reductase deficiency is a rare autosomal recessive disorder caused by mutations in the SRD5A2 gene, resulting in diminished dihydrotestosterone (DHT) formation and, hence, in a severe virilization deficit of the external genitalia. In this paper we have applied a novel, rapid, accurate, and modestly labor-intensive RT-PCR method coupled to laser-induced fluorescence capillary electrophoresis (LIF-CE), developed in our laboratory [7,8], in order to: (a) precisely quantitate the mrna levels of 5a-R type 1 isozyme in the liver of the male rat, (b) determine the possible regulation of hepatic 5a-R by both T and DHT, and (c) establish whether 5a-Reductase plays an important physiological role besides its catabolic function. Materials and methods Animals. Adult male Wistar rats weighing 260 280 g were housed in an air-conditioned room with fluorescent lights on from 7.00 to 19.00 h, and were given standard laboratory pellet chow and water ad libitum. Experiments were made in strict accordance with the NIH guide for the Care and Use of Laboratory Animals. The experimental groups studied were: intact rats (I), intact rats plus T (I + T), intact rats plus DHT (I + DHT), castrated rats (C), castrated rats plus T (C + T), and castrated rats plus DHT (C + DHT). The castrated animals underwent bilateral orchidectomy under ether anesthesia. Groups I + T and C + T were subcutaneously (s.c.) injected with oil vehicle (20% ethanol in sesame oil) containing testosterone propionate (T p ; 1 mg/kg body weight/day) [9] on days 0, 3, 6, 9, and 12, and a final injection was given 3 h before decapitation on day 15. To enable comparison of the effects of T and DHT, groups I + DHT and C + DHT were s.c. injected with oil vehicle (20% ethanol in sesame oil) containing dihydrotestosterone propionate (D p ; 1 mg/kg body weight/ day) [9] on the same days (days 0, 3, 6, 9, 12, and 15). I and C groups were s.c. injected on the same days with oil vehicle alone. There were ten rats per group. The animals were decapitated, and the liver was removed and weighed. Liver samples were frozen in liquid nitrogen and stored at )80 C until analysis. Blood samples were collected in heparinized tubes. After coagulation, the blood was centrifuged at 2000 rpm for 10 min. The plasma was separated and stored at )20 C until the hormonal measurements were performed. Hormone assays. Plasma T concentrations were measured by RIA using a commercial DiaSorin (Vercelli, Italy) kit without modification. The intra- and inter-assay coefficients of variation were 7.6% and 12.0%, respectively, and the sensitivity was 0.05 g/ml. Plasma DHT concentrations were measured by direct ELISA (Diagnostic Biochem Canada, Ontario, Canada). The intra- and inter-assay coefficients of variation were 5.9% and 7.5%, respectively, and the sensitivity was 6.0 pg/ml. Oligonucleotides used for amplifications. Sequence of rat 5a-R type 1 isozyme was obtained from GenBank and the sequence of plasmid pegfp-c1 was obtained from the Clontech web page. These sequences were used to design the primer pairs. Primers for 5a-R type 1 isozyme were 20 bp of length, whereas primers used to synthesize the competitor molecule were 40 bp of length. All forward primers were end-labeled with 6-carboxy-fluorescein (6-FAM). Oligonucleotides were synthesized by PE-Applied Biosystems, UK. Primer sequences (5 0 3 0 ) and PCR product sizes were as follows: Name Primer sequence (5 0 3 0 ) Size (bp) R1-F GAGATATTCAGCTGAGACCC 185 R1-R TTAGTATGTGGGCAGCTTGG IS1-F GAGATATTCAGCTGAGACCCAC 300 GTAAACGCCCACAAGTTC IS1-R TTAGTATGTGGGCAGCTTGGT CTTGTAGTTGCCGTCGTCC Construction of the internal standard template. A synthetic internal standard (IS) DNA of 300-bp was synthesized from the sequence of plasmid pegfp-c1 (Clontech, Palo Alto, CA). A set of primers of 40 nucleotides was used to synthesize the competitive molecule, IS-1 (competitor DNA of 5a-R1). The first 20 nucleotides at 5 0 ends correspond to the forward and reverse primers that amplify 5a-R1 fragment, and 20 nucleotides at 3 0 ends correspond to the opposite strands of the plasmid sequence. The 300 bp-fragment IS-1 was obtained after two consecutive amplifications from pegfp-c1, with 5 0 and 3 0 ends modified to contain the same nucleotide sequences as SRD5A1 [7,8]. Reverse transcription reaction-polymerase chain reaction. Total RNA was extracted from 25 mg of rat liver tissues by acid guanidinium thiocyanate phenol chloroform [10]. The RNA was resuspended in diethyl pyrocarbonate (DEPC)-treated water and spectrophotometrically quantitated for analysis. First-strand cdna was synthesized according to Torres and Ortega [8]. The PCR profile was: denaturing, 94 C for 30 s; annealing, 55 C for 30 s; and extension, 72 C for 30 s. In each case the number of cycles was 35. PCR was carried out in a Perkin Elmer 2400 Thermal Cycler. Analysis of PCR products. A CE system with LIF detection was used to characterize RT-PCR products. After amplification, an aliquot of the sample (1 ll) was diluted 1/20 with 18.5 ll of formamide and 0.5 ll of GeneScan-500 TAMRA Size Standard (Applied Biosystem, Warrington, UK) and denatured at 95 C for 3 min. Capillary electrophoresis was carried out in a 47 cm-silica capillary containing POP- 4 polymer (Applied Biosystem, USA). The separation capillary was first filled with the polymer solution. The sample was then injected into the separation capillary for 5 s. The temperature of the separation capillary was 60 C and each sample ran during 24 min at 100 V/cm. We performed LIF-CE in an ABIPRISM 310 Genetic Analyzer (Applied Biosystem, USA). The ratio of fluorescence of 5a-R1/IS-1 was plotted against the amount of competitive DNA IS-1 and the concentration of target DNA in the sample was calculated according to Torres et al. [7,8]. The concentration of problem cdna was corrected by the correction factor K. The correction factor K depends on the RT-PCR characteristics and is the product of three components that represent the correction due to: the difference in size between problem and standard; the correction due to the addition of the internal standard in DNA form, and the efficiency of the retrotranscription [7,8]. Statistical analysis. Statistical analysis of the results was performed using the Student s t test.

Results and discussion Serum hormonal levels J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) 469 473 471 Castrated animals had significantly lower T levels with respect to intact animals (Fig. 1). As may be expected, there was a significant increase in T levels after T treatment in both intact and castrated rats. After DHT treatment, there was a significant decrease in T levels in intact rats in comparison with their pre-treatment levels. The DHT levels in castrated animals were lower than those in intact animals. After T treatment, there was a significant increase in DHT levels in both intact and castrated animals with a higher effect in the castrated rats. After DHT treatment, there was an increase in DHT levels in both intact and castrated animals in comparison with their respective pre-treatment levels. Quantitation of 5a-R1 mrna levels in liver tissues The amount of mrna was expressed as number of mrna copies per lg of total RNA. After cdna was generated from total RNA by RT reaction, it was coamplified in the presence of decreasing amounts of the competitive DNA (64 10 6 0.5 10 6 molecules). We co-amplified 5a-R1 cdna and the competitive standard DNA IS-1 using the same pair of primers. With decreasing amounts of the competitive DNA, the relative intensity of amplified product of target DNA increased. The mean amount of 5a-R1 mrna in the liver of the different experimental groups is displayed in Fig. 2. The 5a-R1 mrna levels in castrated animals were significantly lower than in intact animals. After T treatment, there was a significant increase in 5a-R1 mrna levels in both intact and castrated rats in comparison with their Fig. 1. Effects of testosterone (T) and dihydrotestosterone (DHT) on plasma T and DHT levels of intact (I) and castrated (C) animals; *p < 0:05 or less vs. I animals; #p < 0:05 or less vs. C animals. Fig. 2. Effects of testosterone (T) and dihydrotestosterone (DHT) on hepatic steroid 5a-Reductase 1 (5a-R1) mrna levels of intact (I) and castrated (C) animals; *p < 0:05 or less vs. I animals; #p < 0:05 or less vs. C animals. respective pre-treatment levels. After DHT treatment, there was a significant increase in 5a-R1 mrna levels in both intact and castrated animals in comparison with their respective pre-treatment levels. Our results demonstrate, to our knowledge for the first time, a high level of expression of the gene that encodes the 5a-R type 1 enzyme in the male rat liver. These data are consistent with findings by other authors who demonstrated high 5a-Reductase activity in the rat liver [1,2,11 13]. Our study represents a further advance in this field, contributing a precise quantitation of the gene expression of 5a-R type 1 in liver. This was achieved by the use of an RT-PCR method coupled to LIF-CE developed by our group in order to quantitate the mrna expression of the 5a-R type 1 isozyme in the liver of male rat. This method combines the strengths of competitive PCR with the sensitivity of LIF-CE. Our strategy was to obtain an exogenous internal standard rapidly and simply after two consecutive PCR amplifications, and then to subject both standard and unknown to PCR amplification using the same set of primers [7]. In our view, the development of the RT-PCR procedure has provided a technique that is more specific and sensitive than traditional methods of RNA analysis, such as Northern or dot blot analysis and RNA protection assay, and which has therefore become the method of choice for studying gene expression [14 18]. We were able to establish that in the intact animal, 5a-R type 1 expression in the liver is two-fold higher than its expression in the prostate [5]. This finding may be of physiologic interest, because the liver requires a large amount of 5a-R type 1 to catalyze the reduction of D 4;5 double bonds in a variety of substrates such as T. Moreover, 5a-R type 1 is thought to play a catabolic role in steroid hormone metabolism. In the prostate,

472 J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) 469 473 however, 5a-R type 1 is expressed in epithelial cells and may be responsible for synthesizing DHT, which acts in an autocrine manner to stimulate the cells differentiation and in a paracrine fashion to stabilize or stimulate the division of the adjacent androgen-dependent luminal epithelium [3]. The results of our experiments demonstrated that 5a- R1 isozyme is regulated positively by androgens in the liver of male rat, because the mrna levels of 5a-R1 isozyme were significantly decreased after castration (Fig. 2), when circulating levels of both T and DHT are low (Fig. 1). Conversely, 5a-R type 1 expression increased in both intact and castrated animals after T and DHT treatment. The effects of T on the 5a-R type 1 gene could be expected, as it seemed logical that an increase in the concentration of substrates with D 4;5 double bond such as T would increase 5a-R type 1 gene expression, thereby enhancing the hepatic metabolism of T, as known for many years [1,2]. With respect to DHT, our data revealed that in the liver, as in the prostate gland, DHT positively regulates the genetic expression of 5a- R1 enzyme, demonstrating at transcriptional level the feed-forward control exerted by DHT on its own biosynthesis through the increased expression of 5a-R1 gene. It has been proposed that feed-forward regulation plays a key role in various developmental systems, especially in situations in which the local concentration of a molecule such as a morphogen must be dramatically increased to bring about a defined pattern of expression [19]. In the prostate, the DHT produced by 5a-R type 1 in epithelial cells may act by a feed-forward mechanism on 5a-R type 2 expression in the stroma of the prostate to induce the development of the gland [3]. The induction of the 5a-R type 1 gene in liver by DHT appears to demonstrate that the catabolism of steroid derivates with D 4;5 double bond is not the only mission of 5a-R type 1. The development of the male phenotype in mammals can be divided into three time stages, beginning with the establishment of chromosomal sex at the time of fertilization. Thereafter, gonadal sex is determined by the expression of a key regulatory gene on the Y chromosome (the testis-determining gene or SRY) [20]. Expression of this gene transforms a bipotential gonad into a fetal testis capable of synthesizing T and other hormones required for the third phase of sexual development, the establishment of male phenotypic sex. In this last stage, T acts in concert with the product of the androgen receptor gene to initiate the formation of internal male reproductive structures. In the embryonic urogenital tract, T is converted to DHT, which in turn binds to the androgen receptor and drives the differentiation of the external genitalia and the prostate gland. The outlines of this complex developmental process have been deduced from animal experimentation [21] and the study of naturally occurring mutations in key genes that alter the male phenotype. The failure to synthesize DHT leads to alterations in the development of the external genitalia and prostate, but does not affect other steps in the developmental pathway [22]. Some genotypically masculine individuals of a family in the Dominican Republic were reported to present mutations in the 5a-Reductase type 2 gene. They were born with normal internal masculine organs (masculinized by T) but non-masculinized external organs (masculinized by DHT). At puberty, their external genitalia masculinized and they became phenotypically normal men. The induction of the 5a-Reductase type 1 gene in the liver by DHT may explain, at least in part, this important biological phenomenon. In fact, the increase in testicular T secretion produced at puberty by these individuals could induce 5a-R type 1 in the liver and perhaps in the skin. All this produces an increase in the amount of DHT that further induces the expression of 5a-R type 1 gene (feed-forward mechanism). The greatly increased amount of circulating DHT that results could be capable of producing the masculinization of the external genitalia. Thus, DHT acts as a true hormone and the liver as a true endocrine gland. In summary, we have demonstrated, using our technique of RT-PCR coupled to LIF-CE: (1) high levels of expression of the gene that encodes 5a-R type 1 enzyme in male rat liver; (2) that T exerts a positive control on the genetic expression of liver 5a-R1 isozyme; and (3) that DHT exerts a positive control on the genetic expression of liver 5a-R1 isozyme. Our results raise the possibility that hepatic 5a-R type 1 not only participates in the catabolism of steroids with D 4;5 double bond, but also in other physiological functions, possibly including the masculinization of the external genitalia in males with 5a-R type 2 gene deficiency. Acknowledgments We thank R. Davies for revising the English text and the San Cecilio University Hospital of Granada for allowing us use of the ABIPRISM 310 Genetic Analyzer. This work was funded in part by DGICYT PM97-0177, FIS PI-021625, and Andalusian Regional Government (Endocrinology & Metabolism Group). References [1] J.A. Gustafsson, A. Stenberg, Irreversible androgenic programming at birth of microsomal and soluble rat liver enzymes active on androstene-3,17-dione and 5-alpha-androstane-3alpha,17betadiol, J. Biol. Chem. 249 (1974) 711 718. [2] J.A. Gustafsson, A. Stenberg, Neonatal programming of androgen responsiveness of liver of adult rats, J. Biol. Chem. 249 (1974) 719 723.

J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) 469 473 473 [3] D.W. Rusell, J.D. Wilson, Steroid 5a-Reductase: two genes/two enzymes, Annu. Rev. Biochem. 63 (1994) 25 61. [4] Y. Jin, T.M. Penning, Steroid 5a-reductases and 3a-hydroxysteroid dehydrogenases: key enzymes in androgen metabolism, Best Pract. Res. Clin. Endocrinol. Metab. 15 (2001) 79 94. [5] J.M. Torres, E. Ruiz, E. Ortega, Development of a quantitative RT-PCR method to study 5-alpha-Reductase mrna isozymes in rat prostate in different androgen status, Prostate 56 (2003) 74 79. [6] J.M. Torres, E. Ortega, Differential regulation of steroid 5a- Reductase isozymes expression by androgens in the adult rat brain, FASEB J (2003) in press. [7] J.M. Torres, J.A. Gomez-Capilla, E. Ortega, Quantitative reversetranscriptase polymerase chain reaction assay for mrna levels of steroid 5a-Reductase isozymes, Anal. Biochem. 307 (2002) 177 180. [8] J.M. Torres, E. Ortega, Quantitation of mrna levels of steroid 5a-Reductase isozymes: a novel method that combines quantitative RT-PCR and capillary electrophoresis, Int. J. Biochem. Cell Biol. (2003) in press. [9] F.W. George, D.W. Russel, J.D. Wilson, Feed-forward control of prostate growth: dihydrotestosterone induces expression of its own biosynthetic enzyme, steroid 5 alpha-reductase, Proc. Natl. Acad. Sci. USA 88 (1991) 8044 8047. [10] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction, Anal. Biochem. 162 (1987) 156 159. [11] S. Andersson, R.W. Bishop, D.W. Russell, Expression cloning and regulation of steroid 5 alpha-reductase, an enzyme essential for male sexual differentiation, J. Biol. Chem. 264 (1989) 16249 16255. [12] Y. Farkash, H. Soreq, J. Orly, Biosynthesis of catalytically active rat testosterone 5 alpha-reductase in microinjected Xenopus oocytes: evidence for tissue-specific differences in translatable mrna, Proc. Natl. Acad. Sci. USA 85 (1988) 5824 5828. [13] K. Normington, D.W. Russell, Tissue distribution and kinetic characteristics of rat steroid 5 alpha-reductase isozymes. Evidence for distinct physiological functions, J. Biol. Chem. 267 (1992) 19548 19554. [14] K.L. Kelleher, K.J. Leck, I.A. Hendry, K.I. Matthaei, A one-step quantitative reverse transcription polymerase chain reaction procedure, Brain Res. Brain Res. Protoc. 6 (2001) 100 107. [15] J. Orly, Z. Rei, N.M. Greenberg, J.S. Richards, Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids, Endocrinology 134 (1994) 2336 2346. [16] G. Gilliland, S. Perrin, K. Blanchard, H.F. Bunn, Analysis of cytokine mrna and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. USA 87 (1990) 2725 2729. [17] D.A. Rappolee, D. Mark, M.J. Banda, Z. Werb, Wound macrophages express TGF-alpha and other growth factors in vivo: analysis by mrna phenotyping, Science 241 (1988) 708 712. [18] J. Singer-Sam, M.O. Robinson, A.R. Bellve, M.I. Simon, A.D. Riggs, Measurement by quantitative PCR of changes in HPRT, PGK-1, PGK-2, APRT, MTase, and Zfy gene transcripts during mouse spermatogenesis, Nucleic Acids Res. 18 (1990) 1255 1259. [19] H. Meinhardt, Models of Biological Pattern Formation, Academic Press, New York, 1982. [20] A.H. Sinclair, P. Berta, M.S. Palmer, J.R. Hawkins, B.L. Griffiths, M.J. Smith, J.W. Foster, A.M. Frischauf, R. Lovell-Badge, P.N. Goodfellow, A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif, Nature 346 (1990) 240 244. [21] A. Jost, Hormonal factors in the sex differentiation of the mammalian foetus, Philos. Trans. R. Soc. Lond. B Biol. Sci. 259 (1970) 119 130. [22] J.D. Wilson, J.E. Griffin, D.W. Russell, Steroid 5 alpha-reductase 2 deficiency, Endocr. Rev. 14 (1993) 577 593.