Current Biology, Volume 22 Supplemental Information Circadian Rhythm of Temperature Preference and Its Neural Control in Drosophila Haruna Kaneko, Lauren M. Head, Jinli Ling, Xin Tang, Yilin Liu, Paul E. Hardin, Patrick Emery, and Fumika N. Hamada Supplemental Inventory 1. Supplemental Figures and Tables Figure S1, related to Figure 1 Figure S2, related to Figures 3 and 4 Figure S3, related to Figures 3 and 4 Table S1, related to Figures 1 and 2 2. Supplemental Experimental Procedures 3. Supplemental References
Figure S1. Distribution of Temperature Preference Behavior in w 1118, Canton-S (cs) and yw Flies, Related to Figure 1 (A and B) Comparison of the distribution of w 1118 in temperature preference behavior between ZT1-3 and ZT10-12 (A) and between ZT10-12 and ZT13-15 (B). ZT is Zeitgeber Time (12h light/dark cycle; ZT0 is lights-on, ZT12 is lights-off). The w 1118 flies preferred a warmer temperature at ZT10-12 than at ZT1-3 and a colder temperature at ZT13-15 than at ZT10-12. (C and D) Distribution of cs and yw in temperature preference behavior at ZT1-3 and ZT10-12. The cs and yw flies preferred a warmer temperature at ZT10-12 than at ZT1-3. Data are shown as mean, the error bars indicate ±s.e.m, and numbers represent number of assays. Unpaired t-test, are compared to flies at 26-28 C, ***P<0.0001 and *P<0.05. Data are shown as mean, error bars indicate s.e.m and n represents number of assays. (E and F) Comparison of preferred temperatures of w 1118, Canton-S (cs) and yw flies during the day. Numbers in the figures represent number of assays. Although the preferred temperatures of each fly line were different, the daytime temperature increases were ~1-1.5 C for all three lines.
Figure S2. Gal4/Gal80 Lines which Label Pacemaker Cells (A), Schematic of Pacemaker Cells in the Brain (B), and TPR of pdf 01 and pdfr han5304 Flies during the Day (C and D), Related to Figures 3 and 4 (C and D) The line graph shows preferred temperatures of wild type and mutants pdf 01 and (C), pdfr han5304 (D). The bar graph shows daytime TPR (ZT1-12) in LD condition for each genotype.
Figure S3. The DN2s Are Not Sufficient to Generate Either Morning and Evening Anticipation under LD (A-K) and Temperature (L-O) Cycles, Related to Figures 3 and 4 (A-K) Average activity of flies entrained to a standard LD cycle. Day activity is shown with white bars and night activities with grey bars. per 01 ; Clk9M-Gal4/+; UAS-per/+ show morning anticipation since they have clocks in slnvs. (L-O) Flies were first entrained to a light-dark cycles for 3 days and then transferred to temperature cycles (29 C/20 C) in constant darkness for 5 days. Activities were averaged over the last three days of temperature cycles for each genotype. White bars represented the thermophase, grey bars the cryophase. per 01 ; Clk9M-Gal4/+; UAS-per/+ show morning anticipation since they have clocks in slnvs.
Table S1. Statistics of Figures 1 and 2 ANOVA and Tukey-Kramer test compared to ZT1-3 and ZT 13-15, ***P<0.001, **P<0.01 or *P<0.05.
Supplemental Experimental Procedures Fly Lines Pdf-Gal4 and tim-gal4 62 were obtained from Bloomington Drosophila stock center. cry13- Gal4, per 01 and tim 01 were obtained from Dr. Paul Taghert. Clk9M-Gal4 were created by the first three Clk introns, a ~3kb fragment was amplified via PCR from genomic DNA using a forward primer than spanned the exon 1/intron 1 border (5 TATAACCGCGGACCCGAAAATAGACGAC 3 ) and a reverse primer that spanned the intron 3/exon 4 border (5 CCCTGGATCCTACAAATCTTGCTGGAACG 3 ) [1], and inserted into the Sac II and Bam HI sites of the pchs-gal4 vector [2]. The resulting plasmid (Clkint1-3-Gal4) was injected into w 1118 embryos (Duke University Model System Genomics Facility) to generate multiple transformant lines. The M9 Clkint1-3-Gal4 line (abbreviated Clk9M-Gal4) was used for further analysis. Temperature Preference Behavioral Assay Temperature preference assays were performed as described previously [3] but with some modifications. Each behavioral assay was performed for 30 min during different time zones (ZT or CT 1-3, 4-6, 7-9, 10-12, 13-15, 16-18, 19-21 and 22-24) in an environmental room maintained at 25 C/65-70%RH. Since phenotype variations were expected right before and after light was turned ON (ZT0) or OFF (ZT12), we did not examine the temperature preference behavior during these times (ZT or CT 0-1, 11.5-13 and 23.5-24). For each trial, 20-25 adult flies were used and were not reused in subsequent trials. The flies were raised under LD conditions and were transferred to DD or LL conditions for 2-4 days. The light intensity is 500-1000 lux. When we used these flies for the behavioral assay, the flies we used in LD conditions were 1-4 days old, 2 days old for DD2, 4 days old for LL4 and DD4, and 8 days old for LL8. In the LD conditions, temperature preference behavior was performed in the lightness during the daytime (ZT 1-3, 4-6, 7-9 and 10-12) and the darkness during the nighttime (ZT13-15, 16-18, 19-21 and 22-24). In the DD conditions, the temperature preference behavior was performed in the darkness and in the LL conditions, the temperature preference behavior was performed in the lightness. Pictures were taken with a flash after 30 min. After each experiment, the flies were discarded. Whole-Mount Immunohistochemistry Adult flies were entrained to a 12hr light- 12hr dark cycles for 3 days. At ZT21-22 on the third day, fly brains were dissected, immunostained and imaged essentially as described in Zhang et al., 2010. Primary antibodies used were: mouse anti-gfp (from Invitrogen 3E6, 1:200), rat anti-pdf (1:400) and rabbit anti-per (1:1500). Both anti-pdf and anti-per antibodies were generous gifts from Dr. M. Rosbash. Secondary antibodies were: antimouse-fitc (1:200), anti-rat-cy5 (1:200) and anti-rabbbit-cy3 (1:200) (all from Jackson ImmunoResearch Inc.). Mounted brains were scanned using a Zeiss LSM5 Pascal confocal microscope. Images are digitally projected Z stacks.
Data Analysis Measuring temperature along the behavioral apparatus: Temperature was measured at different locations along the gradient using six temperature probes connected to a Fluke 52 II thermometer. The temperature probes were positioned in the air space between the cover and aluminum plate. Using the locations of the probes as well as their corresponding recorded temperatures, the locations of temperatures to the whole number between ~17-33 o C were calculated. The distribution of temperature between the temperature probes was estimated to be linear. Calculating a mean preferred temperature for each behavioral trial: In each behavioral trial, 20-25 flies were used. After the 30 min temperature preference behavioral assay, the numbers of flies located between each one degree temperature interval were counted. Flies that were partially or completely on the walls of the apparatus cover were not counted. Data points were plotted as a percentage of flies within one degree temperature. A mean preferred temperature was calculated by summing the products of each interval s percentage of flies and temperature, as shown below: % of flies x 18.5 o C + % of flies x 19.5 o C + % of flies x 20.5 o C..+ % of flies x 31.5 o C + % of flies x 32.5 o C. Calculating averaged preferred temperature in each time zone: Temperature preference behavior was performed >5 times during each time zone (ZT 1-3, 4-6, 7-9, 10-12, 13-15, 16-18, 19-21 and 22-24). To calculate averaged preferred temperate in each time zone, the mean preferred temperature of each trial were then all averaged together. The s.e.m error bars are equal to the error between the trials. Calculating preferred TPR during daytime: After calculating the preferred temperature in each time zone, we subtracted preferred temperature in one time zone from preferred temperature in another time zone in order to obtain temperature changes between time zones. In order to calculate daytime TPR the preferred temperature at ZT10-12 was subtracted from the preferred temperature at ZT1-3. Statistical analysis: Statistical significance was determined by a one-way ANOVA using GraphPad InStat followed by the Tukey-Kramer test to compare with the controls. Author Contributions F.N.H and H.K designed research. F.N.H, H.K, L.M.H and X.T performed TPR behavioral experiments. J.L and P.E performed locomotor activity behavioral experiments and Clk9M- Gal4 staining. Y.L and P.E.H made Clk9M-Gal4 fly lines. F.N.H, H.K and L.M.H wrote the manuscript.
Supplemental References 1. Glossop, N.R., Houl, J.H., Zheng, H., Ng, F.S., Dudek, S.M., and Hardin, P.E. (2003). VRILLE feeds back to control circadian transcription of Clock in the Drosophila circadian oscillator. Neuron 37, 249-261. 2. Apitz, H. (2002). pchs-gal4, a vector for the generation of Drosophila Gal4 lines driven by identified enhancer elements.. Dros. Inf. Serv. 85, 118-120. 3. Hamada, F.N., Rosenzweig, M., Kang, K., Pulver, S.R., Ghezzi, A., Jegla, T.J., and Garrity, P.A. (2008). An internal thermal sensor controlling temperature preference in Drosophila. Nature 454, 217-220.