ORIGINAL RESEARCH Physiologicl Reports ISSN 251-817X The serine protese, dipeptidyl peptidse IV s myokine: dietry protein nd exercise mimetics s stimulus for trnscription nd relese Leslie E. Neidert, C. Brooks Moley, Wesley C. Kephrt, Michel D. Roerts & Heidi A. Kluess School of Kinesiology, Auurn University, 31 Wire Rod, Auurn, Alm, 36849 Keywords DPP-IV, exercise, whey protein. Correspondence Heidi A. Kluess, School of Kinesiology, Auurn University, 31 Wire Rod, Auurn, AL, 36849. Tel: 334-844-1844 Fx: 334-844-1467 E-mil: hk6@uurn.edu Funding Informtion All rodent nd cell culture dt were funded y lortory strt-up funds provided y MDR. The funding for serum nd plsm DPP-IV ssys were provided y lortory funds provided y HAK. Received: 27 April 216; Accepted: 18 My 216 doi: 1.14814/phy2.12827 Physiol Rep, 4 (12), 216, e12827, doi: 1.14814/phy2.12827 Astrct Dipeptidyl-peptidse IV (DPP-IV) is n enzyme with numerous roles within the ody, mostly relted to regulting energy metolism. DPP-IV is lso myokine, ut the stimulus for its relese is poorly understood. We investigted the trnscription nd relese of DPP-IV from skeletl muscle in threeprt study using C 2 C 12 myotue cultures, n cute rt exercise nd postexercise feeding model, nd humn feeding or humn exercise models. When myotues were presented with leucine only, hydrolyzed whey protein, or chemicls tht cuse exercise-relted signling to occur in cell culture, ll cused n increse in the mrna expression of DPP-IV (1.63 to 18.56 fold chnge, P <.5), ut only whey protein cused significnt increse in DPP-IV ctivity in the cell culture medi. When rts were fed whey protein concentrte immeditely following stimulted muscle contrctions, DPP-IV mrna in oth the exercised nd nonexercised gstrocnemius muscles significntly incresed 2.5- to 3.7-fold (P <.5) 3 6 h following the exercise/feeding out; of note exercise lone or postexercise leucine-only feeding hd no significnt effect. In humns, plsm nd serum DPP-IV ctivities were not ltered y the ingestion of whey protein up to 1 h post consumption, fter 1 min out of vigorous running, or during the completion of three repeted lower ody resistnce exercise outs. Our cell culture nd rodent dt suggest tht whey protein increses DPP-IV mrna expression nd secretion from muscle cells. However, our humn dt suggest tht DPP-IV is not elevted in the loodstrem following cute whey protein ingestion or exercise. Introduction Dipeptidyl peptidse-iv (DPP-IV) is serine protese tht is present in the gut, kidneys, endothelil lyer of lood vessels nd s solule protein in the lood. Pleiotropic functions of DPP-IV include modultion of the function of glucgon like peptide-1 (GLP-1), neuropeptide Y, nd peptide YY; ll of which ply n importnt role in insulin relese nd stiety (Bdmn nd Flier 25; Btterhm et l. 26; Loh et l. 215). DPP-IV is lso expressed on the surfce of T-cells s the ntigen CD26+, which ctivtes CD4+ cells to relese tumor necrosis fctor- (TNF-) nd interleukin-6 (IL-6) to induce T-cell prolifertion nd initite n immune response (Cordero et l. 29; Iked et l. 213). Recent work suggests tht DPP-IV my lso e relesed s myokine from humn myotues (Rschke et l. 213), ut the pthwy for relese of DPP-IV nd the function of DPP-IV once relesed from the muscle remin unknown. It is reported tht whey protein my e potent DPP- IV inhiitor. Evidence for this ction of whey protein comes from studies using whey protein or its products in n ssy with recominnt DPP-IV (Tulipno et l. 211; Silveir et l. 213) nd studies with humns or nimls ingesting whey protein nd mesuring n increse in GLP-1 or insulin levels (Frid et l. 25; Slehi et l. 212). However, it remins unknown if the inhiitory effect of whey protein on DPP-IV ctivity modultes ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. This is n open ccess rticle under the terms of the Cretive Commons Attriution License, which permits use, distriution nd reproduction in ny medium, provided the originl work is properly cited. Pge 1
DPP-IV Trnscription nd Relese L. E. Neidert et l. other spects of DPP-IV production (i.e., trnscription, secretion, etc.). Moreover, it remins unknown if mino cids themselves ffect spects of DPP-IV production or if this effect is confined to intct whey protein. Therefore, the purpose of this study ws twofold: (1) to identify if leucine, whey protein nd/or exercise ffected vrious spects of DPP-IV production in skeletl muscle, nd (2) to determine if whey protein hs n inhiitory effect on DPP-IV secretion from skeletl muscle. Our experimentl pproch employed C 2 C 12 myotue cultures, n cute rt exercise nd postexercise feeding model, nd humn feeding or humn exercise models. We hypothesized tht spects of DPP-IV production s well s relese y the muscle would e potentited y muscle contrctions. Also, given the forementioned dt regrding the ility of whey protein to stimulte increses in circulting insulin nd GLP-1, we hypothesized tht whey protein would inhiit DPP-IV mrna expression nd DPP-IV relese from muscle. Mterils nd Methods Ethicl pprovl All niml nd humn experiments were pproved y the Auurn University Institutionl Animl Cre nd Use Committee nd the Institutionl Review Bord, respectively, prior to the eginning of ny dt collection. Prt 1: Modultion of DPP-IV in cell culture using exercise-relted signling pthwys, leucine nd whey protein Cell culture nd tretments C 2 C 12 myolsts were grown on 6 mm pltes (Griener Bio-One GmH, Mychstr, Frickenhusen, GER) in growth medium [GM; Dulecco s Modified Egle Medium (DMEM), 1% (vol/vol) fetl ovine serum, 1% penicillin/ streptomycin,.1% gentmycin] t seeding density of 3.5 9 1 5 t 37 C in 5% CO 2 tmosphere. Forty-eight hours fter myolst growth reched 8 9% confluency, differentition ws induced y replcing the GM with differentition medium [DM; DMEM, 2% (vol/vol) horse serum, 1% penicillin/streptomycin,.1% gentmycin]. For 7 dys following differentition induction, DM ws replced every 24 h to llow for myotue growth. Following the 7 dys of differentition, cells were treted on single occsion for 6 h with: (1) DMEM only (CTL, n = 6), (2) 1 mmol/l (1.3 lg/ml) L-leucine (LEU, n = 6) (EMD Chemicls, Inc.), (3) 1 mmol/l (13 lg/ml) whey protein hydrolyste (WP, n = 6) (MusclePhrm, Corp., Denver, CO), (4) 5 mmol/l (1. lg/ml) Cffeine (CAFF, n = 6) (Ameresco, Pelhm, AL), (5) 1 mmol/l (.12 ll/ ml) H 2 O 2 (n = 6) (Ameresco), nd 6) 2 mmol/l (.5 lg/ ml) 5-Aminoimidzole-4-croxmide rionucleotide (AICAR, n = 6) (Ameresco). DMEM served s the vehicle for ech respective tretment. The LEU concentrtion ws sed on study showing tht respective concentrtion mplified Akt phosphoryltion (p) in C 2 C 12 myotues (DeLong et l. 211). The WP concentrtion ws sed upon the mino cid profile of WP, for which LEU constitutes ~12 14% of the mino cid content (Hulmi et l. 21). In ddition to the effects of LEU nd WP, we were lso interested in exmining if exercise-like signls promoted chnges in DPP-IV mrna levels or DPP-IV ctivity in the culture medi. Previous studies hve reported tht, during resistnce exercise of skeletl muscle, increses in intrmusculr clcium (Beton et l. 22), rective oxygen species (Reid nd Durhm 22), nd AMPK (Dreyer et l. 26) ctivtion occur. The CAFF dosge ws sed on study showing 5 mmol/l concentrtion ws le to increse intrcellulr clcium levels in L6 myotues (Brres et l. 212). The AICAR dosge ws sed on previous study tht reported n increse in the ctivtion of AMPK in C 2 C 12 myotues t the 2 mmol/l concentrtion (Egw et l. 214). The H 2 O 2 dosge ws supported y study tht showed incresed trophy-relted mechnisms t this dosge (McClung et l. 29). A post hoc set of cell culture experiments were performed investigting the role of metlloproteses in the process of shedding DPP-IV from the cell memrne of skeletl muscle cells. This mechnism ws previously proposed s the mechnism y which DPP-IV is relesed from vrious cell types (Lmers et l. 211; R ohrorn et l. 214). To this purpose we used inhiition of metlloproteses (MMP) 2 nd 9 in comintion with whey protein or leucine, sed on evidence of these MMPs eing involved in the shedding of DPP-IV from muscle cells (R ohrorn et l. 214). Following the sme procedures s ove, nine pltes of C 2 C 12 cells were treted for 6 h with: (1) 12 nmol/l MMP2 inhiitor (MMP2i; dissolved in DMSO ccording to mnufcturer s instructions; EMD Biosciences, Sn Diego, CA), (2) MMP2i + WP, (3) MMP2i + LEU, (4) 5 nmol/l MMP9 inhiitor (MMP9i; dissolved in DMSO ccording to mnufcturer s instructions; EMD Biosciences, Sn Diego, CA), (5) MMP9i + WP, (6) MMP9i + LEU, (7) Complete protese inhiitor (CPI; dissolved in DMEM ccording to mnufcturer s instructions; Roche Dignostics Corportion, Indinpolis, IN) (8) CPI + WP, nd (9) CPI + LEU. DPP-IV mrna The production of mrna ws mesured y rel-time PCR of the myotues. Briefly, myotues were lysed using 5 ll Pge 2 ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.
L. E. Neidert et l. DPP-IV Trnscription nd Relese of Riozol (Ameresco) per the mnufcturer s recommendtions. Totl RNA concentrtions were nlyzed using Nnodrop Lite spectrophotometer (Thermo Scientific, Wltmn, MA), nd 2 lg ofcdnawssynthesizedusing commercil qscript TM cdna SuperMix (Qunt Biosciences, Githersurg, MD) s recommended y the mnufcturer. Rel-time PCR ws performed using gene-specific primers nd SYBR green chemistry. The primer sequences were s follows: DPP-IV forwrd (5?3 ): CAGCTCATCCTC TAGTGCGG, DPP-IV reverse (5?3 ): TCTTGCCACA GATGCAGGAG, Gus (housekeeping gene) forwrd (5? 3 ): TCAGCTCTGTGACCGATACG, Gus reverse (5?3 ): GCCACAGACCACATCACAAC, Rer1 (housekeeping gene) forwrd (5?3 ): GCCTTGGGAATTTACCACCT, Rer1 reverse (5?3 ): CTTCGAATGAAGGGACGAAA, Rpl-7l1 (housekeeping gene) forwrd (5?3 ): ACGGTGGAGCCT TATGTGAC, Rpl-7l1 reverse (5?3 ): TCCGTCAGAGG GACTGTCTT. Fold-chnge vlues from the respective control tretment were performed using the Livk method (i.e., 2 DDCT ssuming 1% primer inding efficiency), where 2 DCT = [housekeeping gene (HKG) criticl threshold (CT) gene of interest CT] nd 2 DDCT (or fold-chnge) = [2 DCT vlue/2 DCT verge of respective control tretment]. Bet-glucuronidse (Gus) ws used s HKG for ll nutrient signl comprisons given tht it remined stle cross ll tretments (CTL PCR Criticl threshold men stndrd error: 25.63.9; LEU: 25.86.9; WP: 25.21.9; ANOVA P >.1). The geometric men of retention in endoplsmic reticulum receptor 1 (Rer1) nd riosoml protein 7 like 1 (rpl-71l) ws used s the HKG vlues for ll exercise-like tretment comprisons given tht it remined stle cross ll tretments (CTL PCR Criticl threshold men stndrd error: 32.88.29; CAFF: 33.14.8; H 2 O 2 : 32.55.15; AICAR: 33.22.16; ANOVA P >.7). DPP-IV ctivity Smples of the culture medi were tken 6 h fter the tretments. The DPP-IV ctivity in the medi ws determined using fluorometric ssy developed y Schrpe et l. (Schrpe et l. 1988), s used previously y our lortory (Evnson et l. 211) for homogentes nd y other lortories for cell culture medi (Dourdo et l. 27). A modifiction to the protocol included the use of cell culture medi in plce of Kre s Ringer Wrm uffer for the Smple Blnk. DPP-IV ctivity ws determined y the following eqution: Activity (U/L) ¼½ðSÞV A 1 C st ÞŠ=½ðT S v Þ ðfþš where S is the smple fluorescence minus the smple lnk fluorescence, V A is the totl volume of the well, C st is the stndrd concentrtion, T is the time of incution, S v is the smple volume, nd F is the stndrd fluorescence minus the stndrd lnk fluorescence. Mtheeussen et l. (212) determined the detection limit of the ssy to e.1 U/L nd the etween-run vrition coefficient rnge to e 1.32 3.32%. Additionlly, the specificity for DPP-IV ws supported when 98% of ctivity ws inhiited y ddition of DPP-IV selective inhiitor to smples. Prt 2: Modultion of DPP-IV in niml model with muscle stimultion, mino cid feeding nd whey protein feeding Animl supplementtion nd exercise protocol Mle Wistr rts (~25 g; Hrln Lortories, Indinpolis, IN) were cclimted 5 dys prior to experimenttion in the cmpus niml housing fcility. Animl qurters were kept t mient room temperture on constnt 12 h light: 12 h drk cycle. Wter nd stndrd rodent chow (24% protein, 58% crohydrte, 18% ft; Tekld Glol #218 Diet, Hrln Lortories) were provided to nimls d liitum. Beginning the dy prior to the cute exercise nd feeding experiment, nimls underwent n 18 h overnight fst following removl of food from the home cges. The morning of experimenttion, nimls were removed from their qurters etween 7 nd 8, trnsported to the School of Kinesiology uilding, nd cclimted for pproximtely 3 4 h. After cclimtion, rts were nesthetized using isoflurne nd then resistnce trined vi electricl stimultion producing dynmic plntrflexion movements. This muscle stimultion procedure is descried elsewhere (Moley et l. 216). Briefly, nimls were fstened to n pprtus tht llowed the two hindlims to move freely. Two sucutneous electrodes connected to Grss S48 Stimultor (Grss Medicl Instruments, Quincy, MS) were plced prllel to the gstrocnemius in ech rt s right leg. Four sets of eight stimultions (7 mv, 1 Hz, 2s trin durtion,.2 TPS trin rt, nd.2 ms durtion) were delivered, with 2 min of recovery etween sets. Immeditely following the finl trining set, rts were dministered either 5 mg of whey protein (MusclePhrm, Denver, CO; which is proprietry lend prominently comprised of WP concentrte; n = 1 rts), 54 mg of LEU (EMD Chemicls, Inc., Sn Diego, CA; n = 8 rts), or 1 ml of wter (CTL; n = 1 rts). The species conversion clcultions of Regn-Shw et l. (28) ws used to determine whey protein dosge, where the humn ody mss for n verge mle ws ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. Pge 3
DPP-IV Trnscription nd Relese L. E. Neidert et l. ssumed to e 8 kg. This resulted in rts receiving pproximtely n 18.8 g humn equivlent dose of WP. The LEU dose ws sed on the sme concept s mentioned in Prt 1. The resulting dosge tht LEU-treted rts received ws pproximtely 2.8 g humn equivlent dose. Ech supplement ws suspended in 1 ml of wter nd dministered vi gvge feeding. Animls were kept under light isoflurne nesthesi postexercise for pproximtely 3 s while gvge feeding occurred. Following the exercise nd feeding protocol, rts were llowed to recover 3 6 h prior to eing euthnized under CO 2 gs in 2 L induction chmer (VetEquip, Inc., Plesnton, CA). Due to limited resources, wter-fed CTL rts were only killed t 3 h post exercise nd not 6 h post exercise. Moreover, lood ws not extrcted from these rts nd, thus, serum DPP-IV nlyses were not performed. Of note, the humn relevncy of this rodent feeding model hs een vlidted elsewhere s Rsmussen nd collegues hve shown the MPS response of humns nd rts is similr following protein feedings (Butteiger et l. 213; Reidy et l. 213). Additionlly, we hve previously demonstrted tht this exercise model increses muscle protein synthesis (Moley et l. 216). Tissue preprtion methods Following euthnsi, pproximtely 5 mg of gstrocnemius muscle ws extrcted from the EX leg nd the non- EX leg nd plced in 5 ll of ice-cold cell lysis uffer [2 mmol/l Tris-HCl (ph 7.5), 15 mmol/l NCl, 1 mmol/l N-EDTA, 1 mmol/l EGTA, 1% Triton, 2 mmol/l sodium Pyrophosphte, 25 mmol/l Sodium Fluoride, 1 mmol/l -glycerophosphte, 1 mmol/l N 3 O4, 1 lg/ml leupeptin]. Smples were homogenized vi micropestle mnipultion, nd insolule proteins from RIPA homogentes were removed y centrifugtion t 5g for 5 min, nd superntnts were ssyed for totl protein content using BCA Protein Assy Kit (Thermos Scientific, Wlthm, MA) prior to DPP-IV ctivity nlysis. Another 5 mg of gstrocnemius muscle ws extrcted from the EX leg nd the non-ex leg nd plced in 5 ll of Riozol (Ameresco). Smples were then homogenized vi micropestle mnipultion nd RNA isoltion ws performed per mnufcturer s recommendtions. Following RNA isoltion, totl RNA concentrtions were nlyzed using Nnodrop Lite spectrophotometer (Thermo Scientific) nd 2 lg of gstrocnemius RNA ws reverse trnscried into cdna for rel-time PCR (RT- PCR) nlyses using commercil qscript TM cdna Super- Mix (Qunt Biosciences, Githersurg, MD). RT-PCR ws performed using gene-specific primers nd SYBRgreen-sed methods in RT-PCR therml cycler (3 min DNA polymerse ctivtion t 95 C followed y 4 cycles of 95 C t 15 s nd 6 C t 15 s) (Bio-Rd Lortories, Hercules, CA). Primers were designed using primer designer softwre (Primer3Plus, Cmridge, MA), nd melt curve nlyses demonstrted tht one PCR product ws mplified per rection. The primer sequences were s follows: DPP-IV forwrd (5?3 ): CACTCCACTGT TCCCCTCAC, DPP-IV reverse (5?3 ): CTTGCAGTGG AAGAGCAGGA, rps16 (housekeeping gene) forwrd (5?3 ): TCGCTGCGAATCCAAGAAGT, rps16 reverse (5?3 ): CCCTGATCCTTGAGACTGGC. Pst primer efficiency curves generted from our lortory using this method of primer design nd PCR protocol hve yielded primer efficiencies within 9 11% (McGinnis et l. 215; Moley et l. 215). Fold-chnge vlues from the CTL non-ex condition were performed using the Livk method (i.e., 2 DDCT ssuming 1% primer inding efficiency), where 2 DCT = [housekeeping gene (HKG) CT gene of interest CT] nd 2 DDCT (or foldchnge) = [2 DCT vlue/2 DCT verge of CTL non-ex condition]. Of note, for nlyses in vivo, riosoml protein S16 (Rps16) ws used s HKG given tht it remined stle cross ll tretments nd EX conditions (Ctl-NX PCR criticl threshold (Ct) men stndrd error: 2.55.11; Ctl-EX: 2.43.11; 3 h Leu NX: 2.31.12; 3 h Leu-EX: 2.42.12; 6 h Leu-NX: 2.62.11; 6 h Leu-EX: 2.41.8; 3 h WP-NX: 2.48.1; 3 h WP-EX: 2.18.5; 6 h WP-NX: 2.75.17; 6 h WP-EX: 2.32.15; ANOVA P >.1). DPP-IV ctivity The DPP-IV ctivity of muscle homogente ws determined using the sme DPP-IV ssy s descried in Prt 1, excluding the modifiction of the use of cell culture medi. This ssy hs een used previously in other studies to mesure the DPP-IV ctivity of homogentes (Zhng et l. 21; Evnson et l. 211). Prt 3: Modultion of DPP-IV in humns with whey protein feeding or different types of exercise All prticipnts were recruited from Auurn University to prticipte in ech of the following studies. Ech study consisted of different set of individuls prticipting in the study. A written informed consent, helth questionnire, nd PAR-Q (if pplicle) were otined prior to ny dt collection. Whey protein Nineteen college ged mles nd femles (ge rnge = 19-35; mles n = 8, femles n = 11) cme into Pge 4 ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.
L. E. Neidert et l. DPP-IV Trnscription nd Relese the lortory fter n overnight fst nd consumed stndrd commercilly ville whey protein shke (pcket of 31 g of protein; MusclePhrm, Denver, CO). Cpillry smples were collected immeditely prior to consumption of the shke, 3 min post consumption, nd 6 min post consumption. Pilot dt from the Kluess lortory demonstrted tht smples tken vi cpillry drw hve comprle results to smples tken vi venipuncture (verge coefficient of vrition ws <1%; dt not shown). Smples were centrifuged, nd the plsm ws drwn off nd frozen t 8 C until nlyzed for DPP-IV ctivity s descried in Prt 1. Tredmill exercise Thirteen college ged mles nd femles (ge rnge = 19 35; mles n = 7, femles n = 6) completed 1-min out of vigorous running. Prticipnts reported to the lortory fter n overnight fst nd rn t self-selected speed >5.5 mph for 1 min. Cpillry smples were otined immeditely prior to exercise nd 1 min post exercise. Plsm ws otined y centrifuging the smples to seprte the lood, then immeditely freezing the drwn off plsm t 8 C until DPP-IV ctivity nlysis s descried in Prt 1. Repeted resistnce exercise outs Fifteen college ged mles (ge = 22 2 yers, ge rnge = 19-35, ody mss = 87.9 11.1 kg, BMI = 28.1 3) completed muscle dmge resistnce exercise protocol. A pretest visit occurred 1 week efore the strt of the muscle dmge protocol. Bseline lood mesures were collected vi venipuncture in ddition to the determintion of the prticipnt s one repetition mximum (1-RM). Approximtely 1 week following seline testing, prticipnts engged in resistnce exercise out tht consisted of 1 sets of five free-weighted ck squts t 85% of the prticipnt s 1-RM for three consecutive dys. If prticipnt could not complete the set of five, his weight ws reduced until he could successfully complete the protocol. Prticipnts completed this protocol over three-consecutive dy period; the purpose of this protocol ws to induce sustntil muscle dmge which ws monitored through dily visul nlog soreness scoring prior to nd 48 h following the third lifting out. Blood ws drwn prior to the 3-dy lifting protocol, nd susequent lood drws were otined: (1) 24 h following out 1, (2) 24 h following out 2, nd (3) 48 h following out 3. All lood ws collected from forerm veins using stndrd phleotomy techniques nd collected into 6 ml serum seprtor tues. Serum ws isolted y centrifuging lood tues t 35g for 5 min t room temperture, nd ws liquoted in 1.7 ml tues nd stored t 8 C until tch DPP-IV ctivity nlyses s descried in Prt 1. Sttisticl nlysis Results of mrna expression re presented s fold chnge from the control condition (CTL, MMP2i, MMP9i, or CPI). Results of DPP-IV ctivity for cell culture medi, serum, nd plsm re presented s DPP-IV ctivity per liter of smple, wheres the DPP-IV ctivity in muscle homogente is presented s DPP-IV ctivity per milligrm of protein. All results re reported s men s- tndrd devitions. In order to determine significnt differences in the DPP-IV ctivity of the medi nd the DPP-IV gene expression of the cells for the different tretments of Prt 1, one-wy ANOVA ws used for oth mesures. For Prt 2, 3 9 3 9 2 ANOVA ws used to determine the sttisticlly significnt chnges of DPP-IV mrna expression nd ctivity of the nonexercised nd exercised legs with the different supplements t the different time points. In Prt 3, repeted mesures ANOVA ws used to determine significnt differences in the ctivity of DPP-IV mong the different time points of the whey protein nd muscle dmge protocols, nd Student s t-test ws performed to determine the differences in DPP-IV ctivity etween the two time points of the vigorous running out. Alph ws set t P <.5 to determine sttisticl significnce of the results. If significnt results of n ANOVA were found, post hoc nlysis ws performed. All nlyses were performed using GrphPd Prism 5 (GrphPd Softwre, Inc., L Joll, CA) nd IBM SPSS Sttistics 22 (IBM Corportion, Armonk, NY). Results Prt 1: Modultion of DPP-IV in cell culture using exercise-relted signling pthwys, leucine nd whey protein Compred to CTL-treted myotues, cffeine nd H 2 O 2 tretments incresed DPP-IV mrna expression y 2.5- nd 2.6-fold, ut these increses were not significnt. However, AICAR significntly incresed DPP-IV mrna expression 4.75-fold (P =.52) (Fig. 1A). Remrkly, DPP-IV mrna expression ws significntly incresed 18.6-fold (P =.151) in myotues treted with whey protein when compred to CTL-treted myotues, wheres leucine only incresed DPP-IV mrna expression 1.6-fold, which ws not significnt (Fig. 1B). When the relese of DPP-IV into the cell culture medi ws ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. Pge 5
DPP-IV Trnscription nd Relese L. E. Neidert et l. A mrna expression with "exercise signls" tretments B mrna expression with nutrient tretments Fold chnge from CTL 1 8 6 4 2 CTL CAFF H 2 O 2 AICAR Fold chnge from CTL 5 4 3 2 1 CTL LEU WP C DPP-IV ctivity (U/L) DPP-IV ctivity with "exercise signls" tretments.6.4.2 DPP-IV ctivity (U/L) D.8.6.4.2 DPP-IV ctivity with nutrient tretments. CTL CAFF H 2 O 2 AICAR. CTL LEU WP Figure 1. DPP-IV mrna expression nd ctivity in cell culture with exercise signls nd nutrient tretments. (A) The mrna expression of DPP-IV ws significntly elevted from tht of the control cell culture tretment (CTL) when treted with AICAR (P <.5), ut not with Cffeine (CAFF) or hydrogen peroxide (H2O2). (B) The mrna expression of DPP-IV ws significntly elevted from tht of the CTL cell culture tretment only when treted with Whey Protein (WP; P <.5), ut not Leucine (LEU). (C) DPP-IV ctivity of the cell culture medi of the exercise signl treted cells (H 2 O 2, CAFF, AICAR) ws not significntly different from tht of the CTL condition. (D) DPP-IV ctivity of the cell culture medi ws significntly incresed when the cells were treted with WP (P <.5), ut not LEU. Conditions shring the sme letter re not significntly different, nd those with different letters re significntly different (P <.5). exmined, the ctivity ws significntly incresed only with the whey protein tretment (P <.1) (Fig. 1C nd D). The results of the post hoc cell culture sets showed significnt decrese in DPP-IV gene expression when cells were treted with MMP2i + WP (P =.15), ut not MMP2i + LEU (Fig. 2A). Similr results were found in the DPP-IV ctivity of the cell culture medi. The DPP- IV ctivity mesured in the medi of WP + MMP2i cells ws significntly lower thn the ctivity in oth MMP2i lone (P <.1) nd LEU + MMP2i cell medi (P =.6; Fig. 2B). Additionlly, when cells were treted with LEU + MMP9i, mrna ws significntly incresed 2.72-fold (P =.351), ut decresed with WP + MMP9i, though this decrese ws not significnt (Fig. 2C). Similr to MMP2i, only WP + MMP9i cells hd significntly less DPP-IV ctivity in the cell culture medi compred to MMP9i lone (P <.1) nd LEU + MMP9i (P <.1; Fig. 2D). In the presence of CPI, neither LEU nor WP cused significnt chnge in DPP-IV gene expression; however, the mrna levels with WP were significntly lower thn those with LEU (P =.31; Fig. 2E). In the cell culture medi, DPP-IV ctivity in oth WP + CPI nd LEU + CPI cells were significntly less thn cells treted with CPI lone (P <.1 nd P =.3), with WP + CPI lso eing significntly less thn LEU + CPI (P =.24; Fig. 2F). Prt 2: Modultion of DPP-IV mrna nd enzyme ctivity in rts following cute exercise with or without leucine nd whey protein feedings The effects of the cute exercise with or without whey protein nd leucine feeding following exercise re presented in Figure 3. Only whey protein supplementtion significntly incresed DPP-IV gene expression, with no effect of either time or exercise. In the nonexercised gstrocnemius muscles, whey protein lone incresed DPP- IV mrna expression 2.5-fold y 3 h post feeding (P =.1) nd DPP-IV mrna remined elevted 6 h following feeding (P =.1). Remrkly, in the exercised gstrocnemius muscles, whey protein feeding incresed DPP-IV mrna 3.7-fold 3 h following exercise/feeding Pge 6 ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.
L. E. Neidert et l. DPP-IV Trnscription nd Relese Fold chnge from MMP2i A 5 4 3 2 1 mrna expression with MMP2i MMP2i LEU+MMP2i WP+MMP2i B DPP-IV ctivity (U/L) DPP-IV ctivity with MMP2i.8.6.4.2. MMP2i LEU+MMP2i WP+MMP2i Fold chnge from MMP9i C 6 4 2 mrna expression with MMP9i MMP9i LEU+MMP9i WP+MMP9i D DPP-IV ctivity with MMP9i.8.6 DPP-IV ctivity (U/L).4.2. MMP9i LEU+MMP9i WP+MMP9i E 5 Fold chnge from CPI 4 3 2 1 mrna expression with CPI F.8 DPP-IV ctivity (U/L).6.4.2 DPP-IV ctivity with CPI c CPI LEU+CPI WP+CPI. CPI LEU+CPI WP+CPI Figure 2. DPP-IV mrna expression nd ctivity of cell culture with metlloprotese inhiitors. (A) The mrna expression of DPP-IV ws significntly decresed y the ppliction of the MMP2 inhiitor (MMP2i) in cell culture only when treted in comintion with Whey protein (WP + MMP2i; P <.5). (B) DPP-IV ctivity of the cell culture medi ws significntly decresed when the cells were treted with WP + MMP2i (P <.5), ut not Leucine (LEU) + MMP2i. Also, the WP + MMP2i treted cell culture medi hd significntly lower DPP-IV ctivity thn LEU + MMP2i (P <.5) (C) The mrna expression of DPP-IV ws significntly incresed from tht of the MMP9 inhiitor tretment (MMP9i) only when treted in comintion with LEU (LEU + MMP9i; P <.5). But the DPP-IV mrna expression ws significntly lower in the WP + MMP9i cells thn tht of the LEU + MMP9i cells (P <.5). (D) DPP-IV ctivity of the cell culture medi ws significntly decresed when the cells were treted with WP + MMP9i (P <.5), ut not LEU + MMP9i. Also, the WP + MMP9i treted cell culture medi hd significntly lower DPP-IV ctivity thn LEU + MMP9i (P <.5) (E) The mrna expression of DPP-IV ws not significntly chnged from tht of the Complete Protese Inhiitor tretment (CPI) when treted in comintion with Whey protein (WP + CPI) or Leucine nd Complete Protese Inhiitor (LEU + CPI). But the DPP-IV mrna expression of WP + CPI ws significntly lower thn tht of LEU + CPI (P <.5). (F) DPP- IV ctivity ws significntly decresed from tht of the Complete Protese Inhiitor control tretment (CPI) when treted with either Whey protein in comintion with Complete Protese inhiitor (WP + CPI) or Leucine nd Complete Protese Inhiitor (LEU + CPI). Also the DPP-IV ctivity of WP + CPI ws significntly lower thn tht of LEU + CPI (P <.5). Conditions shring the sme letter re not significntly different, nd those with different letters re significntly different (P <.5). (P =.1), nd this remined 2.7-fold elevted over the CTL condition 6 h following exercise/feeding (P =.1). There ws no significnt effect of time on the enzyme ctivity of DPP-IV. However, there ws significnt interction of supplement nd exercise (P =.3). Whey protein supplementtion significntly decresed the DPP- IV ctivity of the exercised gstrocnemius (3 h =.58.14 U/mg nd 6 h =.5.11 U/mg), ut not the nonexercised muscle when compred with exercised CTL (.97.2 U/mg; P =.5) nd LEU condition (3 h = 1.18.78 U/mg nd 6h= 1.37.56 U/mg; P =.1). ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. Pge 7
DPP-IV Trnscription nd Relese L. E. Neidert et l. Prt 3: Modultion of serum DPP-IV ctivity in humns with whey protein feeding or different types of exercise When prticipnts were fed the whey protein shke, there were no significnt differences in the plsm DPP-IV ctivity vlues immeditely prior to consumption (26.31 6.86 U/L) versus 3 min (25.49 5.7 U/L) or Fold chnge from CTL Activity/protein (U/mg) A 8 6 4 2 B 3 2 1 CTL-NX CTL-NX DPP-IV mrna expression with feeding nd exercise in rts CTL-EX LEU-NX LEU-EX WP-NX WP-EX LEU-NX LEU-EX 3 h 6 h WP-NX DPP-IV ctivity with feeding nd exercise in rts c c CTL-EX LEU-NX LEU-EX c WP-NX c WP-EX c LEU-NX LEU-EX WP-NX 3 h 6 h c Figure 3. DPP-IV mrna expression nd ctivity with feeding nd exercise in rts. (A) Only rts fed Whey Protein (NX-WP nd EX-WP) hd significntly incresed DPP-IV mrna expression compred to the rts fed wter (CTL) nd leucine (LEU). Time nd exercise did not hve significnt effect on the mrna expression of DPP-IV in ny of the feeding tretments. *Denotes sttisticlly different from the control unfed, nonexercised rts (NX-CTL). (B) DPP-IV ctivity ws significntly decresed in the exercised gstrocnemius of rts fed Whey Protein (EX-WP) compred to rts fed wter (Wter) or leucine (LEU). Conditions shring the sme letter re not significntly different, nd those with different letters re significntly different (P <.5). WP-EX c WP-EX 6 min (26.13 8.56 U/L) post consumption (Fig. 4A). After out of vigorous running, prticipnts presented no significnt chnge in plsm DPP-IV vlues 1 min fter the cesstion of exercise (Pre: 27.74 6.75 U/L nd Post: 27.4 4.87 U/L) (Fig. 4B). A Plsm DPP-IV ctivity with whey protein Plsm DPP-IV ctivity (U/L) B Plsm DPP-IV ctivity (U/L) C Serum DPP-IV ctivity (U/L) 5 4 3 2 1 4 3 2 1 8 6 4 2 Pre Pre 3 post 6 post Plsm DPP-IV ctivity with endurnce exercise Post Serum DPP-IV ctivity with resistnce exercise Bseline 24 h post B1 24 h post B2 48 h post B3 Figure 4. Plsm nd serum DPP-IV ctivity with feeding nd exercise in humns. (A) The plsm DPP-IV ctivity ws not significntly different 3 nd 6 min fter ingestion of Whey Protein. (B) The plsm DPP-IV ctivity ws not significntly different fter vigorous out of running. (C) Serum DPP-IV ctivity ws not significntly different following three outs of resistnce exercise. Pge 8 ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.
L. E. Neidert et l. DPP-IV Trnscription nd Relese Prticipnts completing the 3-dy consecutive resistnce trining protocol showed no significnt difference in serum DPP-IV ctivity from seline (49.14 11.32 U/L) to 24 h post out 1 (47.28 7.72 U/L), 24 h post out 2 (46.89 9.72 U/L), or 48 h post out 3 (46.62 9.72 U/ L) (Fig. 4C). There ws decrese in totl lifting volume from the first dy (247 41 kg) to the second dy (238 521, P =.1), ut there ws decrese from the first to third dy (2285 477, P <.5) (dt not shown). Moreover, the visul nlog soreness scle ( = not sore t ll, 1 = extremely sore) incresed from prior to the first dy of lifting (score = 3 6) to 48 h fter the third exercise out (score = 21 12, P <.1) (dt not shown). Discussion The purpose of this study ws to identify whether nutrient nd/or exercise signls ffected DPP-IV production nd/or secretion y cultured skeletl muscle cells in vitro nd nimls nd humns in vivo models. In the cell culture experiments, exercise-like modultors (i.e., cffeine, AICAR, nd H 2 O 2 ) ll modestly incresed DPP-IV mrna expression, ut filed to cuse relese of DPP-IV into the culture medi. However, whey protein resulted in oth roust increse in DPP-IV mrna nd DPP-IV ctivity in the culture medi which ws in contrst to our proposed hypothesis sed on previous literture. This finding ws supported in our rt experiments which demonstrted tht the lrgest increse in DPP-IV mrna nd decrese in intrcellulr DPP-IV ctivity occurred in nimls fed whey protein. We contend, however, tht the effects of whey protein nd exercise on DPP-IV production nd secretion is likely locl effect ecuse when humns were provided with whey protein or cutely exercised, there ws no chnge in plsm DPP-IV ctivity. Overll, these dt suggest tht DPP-IV trnscription my occur through mny exercise-relted pthwys, ut only whey protein nd muscle contrction cuse DPP-IV to e relesed from the muscle. In ddition, DPP-IV relese from the muscle does not pper to cuse significnt chnge in the plsm solule pool of DPP-IV ctivity. Prt 1: Modultion of DPP-IV in cell culture using exercise-relted signling pthwys, mino cids nd whey protein Myotues were treted with the exercise-like mimetics, cffeine (to increse cytosolic C 2+ ), AICAR (for AMPK ctivtion), nd H 2 O 2 (for redox signling). When exercise-like signls were evoked, we nticipted tht DPP-IV mrna expression nd relese would e incresed sed on recent reserch (Rschke et l. 213). This ws supported when ll of the exercise-like mimetics cused n increse in the mrna expression of DPP-IV, with AICAR hving the gretest effect. However, when DPP-IV ctivity ws mesured in the medi, the exercise-like mimetics did not significntly chnge the relese of DPP-IV compred to the control condition. As intrcellulr DPP-IV ctivity ws not mesured, it remins unknown if this increse in DPP-IV mrna ws trnslted into protein within the muscle cell. To dte, there re no known intrcellulr pthwys in which DPP-IV is directly involved, s DPP-IV hs een primrily identified s n extrcellulrgent (Kiry et l. 21). It is possile tht there ws n increse in memrne-ound DPP-IV following the exercise signls, ut our experiments did not provide mechnism or enough time to cuse DPP-IV to e relesed into the medi. When hydrolyzed whey protein or the single mino cid, leucine, ws pplied to the myotues, n increse ws found in DPP-IV mrna expression in the cells, with whey protein providing more roust effect. Since leucine is component of whey protein tht increses mtor ctivtion, these dt suggest tht leucine nd/or mtor ctivtion do not ply n importnt role in stimulting trnscription of DPP-IV. When DPP-IV ctivity ws mesured in the medi, leucine did not significntly chnge the relese of DPP-IV, wheres whey protein resulted in significnt increse in DPP-IV ctivity in the culture medi. The findings of this study were further supported y cell culture dt showing tht inhiition of metlloproteses 2 nd 9 in the presence of whey protein cused decrese in the mrna expression nd medi ctivity of DPP-IV. MMP 2 nd 9, which re involved in the shedding of memrne-ound DPP-IV (R ohrorn et l. 214), hve een reported s component of whey protein (Rulo et l. 22; Luetzky et l. 21) providing mechnism for the increse in the DPP-IV found in the medi fter myotues were exposed to whey protein. These findings were surprising considering tht previous studies demonstrted tht whey protein inhiits DPP-IV. There re severl possile explntions for this contrst in findings. One possiility my e tht ingested whey protein hs different effect in the gut thn it does in the muscle. In studies investigting whey protein s n inhiitor of DPP-IV using in vitro methodology, inhiition ws only mesured up to 45 min post tretment (Tulipno et l. 211; Silveir et l. 213). In this study, whey protein ctivted pthwy specific to muscle tht produces more DPP-IV mrna up to 6 h fter the initil tretment. In ddition, other studies mesured inhiition in solution contining only recominnt DPP-IV (Tulipno et l. 211; Silveir et l. 213), wheres this study exmined DPP-IV production in metoliclly ctive muscle cells. The ioctive component in whey protein tht is eliciting increses in DPP-IV mrna expression nd ctivity ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. Pge 9
DPP-IV Trnscription nd Relese L. E. Neidert et l. remins elusive. However, others hve studied the effects of whey protein ioctives on vrious fcets of physiology. For instnce, Gudel et l. reported tht treting pncretic cells in culture with hydrolyzed whey protein elicited roust increse in insulin secretion (Gudel et l. 213). Others hve reported tht hydrolyzed whey protein ingestion reduces circulting GLP-1 in humns (Aziz et l. 25), n effect tht my e medited y ioctive peptides from hydrolyzed whey protein. Finlly, recent review rticle notes tht milk-derived whey contins ioctive peptides which hve een shown to elicit opioid gonistic effects s well s ngiotensinogen-converting enzyme inhiition (Rikos nd Dssios 213). Thus, hydrolyzed whey protein my possess ioctive peptides tht could ct to modulte DPP-IV expression nd ctivity; this needs to e reserched in further detil. Another interesting finding resulted when the cultured cells were exposed to leucine nd MMP9i; DPP-IV mrna incresed, ut there ws no chnge in DPP-IV relese into the medi. The reson for this increse in mrna remins unknown. The originl rtionle for including leucine in the study ws to test the hypothesis tht mino cid trnsport ws the primry signl for DPP-IV relese. However, this supposition ws disproved when leucine filed to cuse relese of DPP-IV in cell culture. Nevertheless, we posit tht metlloproteses in whey protein my cuse DPP-IV shedding from myotues s metlloproteses hve een reported in the pst to elicit this effect. More reserch is needed to uncover the mechnism for DPP-IV mrna increses in the presence of LEU + MMP9i. Prt 2: Modultion of DPP-IV in niml model with muscle stimultion, mino cid feeding, nd whey protein feeding In order to test if the effect oserved in cell culture occurred in vivo, we chose to employ rt model in which their right gstrocnemius ws cutely exercised with or without leucine or whey protein feedings following exercise. In greement with our cell culture dt, postexercise whey protein feeding resulted in significnt increse in DPP-IV mrna t oth 3 nd 6 h post exercise, while muscle stimultion lone did not cuse significnt increse in DPP-IV mrna. However, when muscle stimultion ws comined with susequent whey feeding, there ppered to e slight dditive effect, resulting in lrger increse in DPP-IV mrna t the 3 h post exercise time point compred to the whey protein fed only muscle, though they were not sttisticlly different. By 6 h post exercise, the DPP-IV mrna levels of the exercise plus whey protein muscles were similr to tht of the whey protein feeding only muscles. Curiously, when the DPP-IV ctivity of the muscle ws mesured, whey protein supplementtion resulted in prdoxicl decrese in DPP-IV ctivity, wheres leucine cused nonsignificnt increse in DPP-IV ctivity. Bsed on our cell culture findings tht show whey protein results in the relese of DPP-IV from the cell memrne, our cell culture nd rt dt collectively suggest tht whey protein my cuse n ccelerted relese of DPP-IV from the muscle which, in turn, depletes the intrcellulr pool nd initites roust increse in DPP-IV gene expression. However, this conclusion is limited y the lck of evidence of DPP-IV relese from the rt skeletl muscle. Leucine, on the other hnd, possily increses the intrcellulr ctivity of DPP-IV, ut likely does not deplete intrmusculr pools enough to trigger the trnscription of DPP-IV mrna. To our knowledge, no studies hve used niml models to investigte the effect of dietry proteins, mino cids, nd/or exercise on skeletl muscle DPP-IV production. The only reserch pertining to the effect of whey nd leucine were demonstrted in ssys nd gstrointestinl studies in vitro (Tulipno et l. 211; Lcroix nd Li-Chn 212; Silveir et l. 213). Prt 3: Modultion of DPP-IV in humns with whey protein feeding or different types of exercise Studies in humns were lso performed to see if DPP-IV secretion from skeletl muscle could impct the solule DPP-IV ctivity pool in the lood. We found tht neither the consumption of whey protein nor completion of vigorous exercise ltered whole ody plsm DPP-IV ctivity. It is well understood tht DPP-IV ctivity in the lood comes from multiple sources including the T-cells, the gut, dipocytes, nd muscle (Lmeir et l. 23; Cordero et l. 29; Rschke et l. 213), ut the reltive contriution of ech is difficult to determine. In our repeted out resistnce exercise protocol, which resulted in oth incresed muscle soreness nd muscle dmge mrkers (Mumford et l. 215), there ws no chnge in serum solule DPP-IV ctivity over the durtion of the trining intervention nd up to 48 h following the lst trining out. Moreover, single out of endurnce exercise did not lter the plsm levels of DPP-IV. This suggests tht if humn muscle cells relese DPP-IV, it is likely locl phenomenon tht cnnot e detected through venous lood smpling. It is possile tht the resistnce nd the tredmill exercise outs cused n increse in CD26+ cells, ut the ssy is only sensitive to solule DPP-IV (Yu et l. 211). Additionlly, limittion of the tredmill study ws tht plsm DPP-IV ws only mesured 1 min post exercise, nd there my e further time point tht should e exmined with Pge 1 ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.
L. E. Neidert et l. DPP-IV Trnscription nd Relese endurnce exercise. Therefore, further studies should investigte the response of inflmmtory CD26+ T cells to exercise. The gstrointestinl (GI) system is lso source of DPP-IV, with the highest concentrtion in the ody occurring long the intestinl wll (Lmeir et l. 23). Moreover, the GI system plys mjor role in regulting the mount of ctive GLP-1 in the plsm, especilly fter the consumption of mel (D Alessio 211; De Silv nd Bloom 212). Previous work suggests tht whey protein cts s DPP-IV inhiitor (Tulipno et l. 211; Lcroix nd Li-Chn 212), implying tht with its ingestion, the mount of DPP-IV ctivity in the plsm would decrese. This ws not found in this study, s there ws no significnt chnge in DPP-IV ctivity t 3 or 6 min following whey protein ingestion. It is possile tht whey protein cts s DPP-IV inhiitor in the gut postprndium, ut this inhiition is not lrge enough to cuse chnge in solule plsm DPP-IV ctivity, t lest with the mount of protein consumed for this study. DPP-IV hs een reported to e myokine in other cell culture studies (Rschke et l. 213). However, it remins unknown if DPP-IV relesed y the muscle cn trvel to the lood nd contriute to the solule DPP-IV pool in the lood. Our dt suggest tht if DPP-IV is relesed y humn skeletl muscle in response to whey protein ingestion, it does not contriute to the solule pool of DPP-IV in the lood. In this regrd, whey protein-induced increses in DPP-IV originting from the muscle could remin in the interstitil spce nd elicit locl prcrine effects, ut this effect is not lrge enough to cuse whole ody chnge in circulting levels. In conclusion, we report tht: (1) exercise-like mimetics in vitro modestly increse DPP-IV mrna, ut this does not trnslte to secretion nd, (2) whey protein roustly increses DPP-IV mrna lthough this does trnslte to secretion, (3) whey protein increses DPP-IV mrna postexercise in vivo in rodents, regrdless of time nd exercise, (4) whey protein feeding lone does not ffect DPP-IV ctivity in the plsm in humns in vivo, (5) cute endurnce exercise does not ffect plsm DPP- IV ctivity up to 1 min post exercise in humns in vivo, nd (6) three repeted outs of resistnce trining does not ffect serum DPP-IV ctivity in humns in vivo up to 48 h following the lst out. Collectively, our cell culture nd rt dt suggest DPP-IV is eing produced y skeletl muscle, nd our in vitro dt suggest tht the DPP-IV myokine is eing relesed y skeletl muscle into the interstitil spce. However, DPP-IV function outside of the muscle is inconclusive sed on the lck of locl mesures of DPP-IV in oth the rt nd humn studies. However, the humn dt suggest tht if DPP-IV is relesed y the skeletl muscle, it is not upregulted in circultion nd likely exhiits utocrine or prcrine effects. Further reserch should investigte the locl effects of DPP-IV from the muscle with different stimuli. Also, specific pthwys should e studied with techniques to mesure locl DPP-IV. These findings could expnd the role of DPP-IV from whole ody energy metolism (vi incretin hormones, neuropeptide Y, nd PYY) to modultion of muscle function. Some possile res in which DPP-IV could e involved re the modultion of lood flow vi vsoctive NPY (Evnson et l. 211) nd stellite cell prolifertion through interctions with SDF-1 (Kuci et l. 24) nd IL-6 (Hoffmnn et l. 1993; Serrno et l. 28; Toth et l. 211). Acknowledgments The uthors grciously thnk Jordn Moon (MusclePhrm) for providing the whey protein for the cell culture nd rt studies. The uthors lso Dr. Keith Lohse for his ssistnce in the sttisticl nlysis. Conflict of Interest None declred. References Aziz, A., G. H. Anderson, A. Gicc, nd F. Cho. 25. Hyperglycemi fter protein ingestion concurrent with injection of GLP-1 receptor gonist in rts: possile role for dietry peptides. Am. J. Physiol. 289:R688 R694. Bdmn, M. K., nd J. S. Flier. 25. The gut nd energy lnce: viscerl llies in the oesity wrs. Science 37:199 1914. Brres, R., J. Yn, B. Egn, J. T. Treek, M. Rsmussen, T. Fritz, et l. 212. Acute exercise remodels promoter methyltion in humn skeletl muscle. Cell Met. 15:45 411. Btterhm, R. L., H. Heffron, S. Kpoor, J. E. Chivers, K. Chndrn, H. Herzog, et l. 26. Criticl role for peptide YY in protein-medited stition nd ody-weight regultion. Cell Met. 4:223 233. Beton, L. J., M. A. Trnopolsky, nd S. M. Phillips. 22. Contrction-induced muscle dmge in humns following clcium chnnel locker dministrtion. J. Physiol. 544:849 859. Butteiger, D., M. Cope, P. Liu, R. Mukherje, E. Volpi, B. Rsmussen, et l. 213. A soy, whey nd cseinte lend extends postprndil skeletl muscle protein synthesis in rts. Clin. Nutr. 32:585 591. Cordero, O. J., F. J. Slgdo, nd M. Nogueir. 29. On the origin of serum CD26 nd its ltered concentrtion in cncer ptients. Cncer Immunol. Immunother. 58:1723 1747. ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society. Pge 11
DPP-IV Trnscription nd Relese L. E. Neidert et l. D Alessio, D. A. 211. Wht if gut hormones ren t relly hormones: DPP-4 inhiition nd locl ction of GLP-1 in the gstrointestinl trct. Endocrinology 152:2925. De Silv, A., nd S. R. Bloom. 212. Gut hormones nd ppetite control: focus on PYY nd GLP-1 s therpeutic trgets in oesity. Gut. Liv. 6:1 2. DeLong, A. D., R. Prtt, nd T. J. McLoughlin. 211. FoxO1- medited disruption of the Akt/mTOR signling pthwy in skeletl myotues. FASEB J. 25:l63. Dourdo, M., A. B. Srmento, S. V. Pereir, V. Alves, T. Silv, A. M. Pinto, et l. 27. CD26/DPPIV expression nd 8- zgunine response in T-cute lympholstic leukemi cell lines in culture. Pthophysiology 14:3 1. Dreyer, H. C., S. Fujit, J. G. Cdens, D. L. Chinkes, E. Volpi, nd B. B. Rsmussen. 26. Resistnce exercise increses AMPK ctivity nd reduces 4E-BP1 phosphoryltion nd protein synthesis in humn skeletl muscle. J. Physiol. 576:613 624. Egw, T., Y. Ohno, A. Goto, A. Ikut, M. Suzuki, T. Ohir, et l. 214. AICAR-induced ctivtion of AMPK negtively regultes myotue hypertrophy through the HSP72- medited pthwy in C2C12 skeletl muscle cells. Am. J. Physiol. Endocrinol. Metol. 36:E344 E354. Evnson, K. W., A. J. Stone, A. L. Hmmond, nd H. A. Kluess. 211. Neuropeptide Y overflow nd metolism in skeletl muscle rterioles. J. Physiol. 589:339 3318. Frid, A. H., M. Nilsson, J. J. Holst, nd I. M. Bj orck. 25. Effect of whey on lood glucose nd insulin responses to composite rekfst nd lunch mels in type 2 dietic sujects. Am. J. Clin. Nutr. 82:69 75. Gudel, C., A. B. Nongonierm, S. Mher, S. Flynn, M. Kruse, B. A. Murry, et l. 213. A whey protein hydrolyste promotes insulinotropic ctivity in clonl pncretic -cell line nd enhnces glycemic function in o/ o mice. J. Nutr. 143:119 1114. Hoffmnn, T., J. Fust, K. Neuert, nd S. Ansorge. 1993. Dipeptidyl peptidse IV (CD 26) nd minopeptidse N (CD 13) ctlyzed hydrolysis of cytokines nd peptides with N-terminl cytokine sequences. FEBS Lett. 336:61 64. Hulmi, J. J., C. M. Lockwood, nd J. R. Stout. 21. Review effect of protein/essentil mino cids nd resistnce trining on skeletl muscle hypertrophy: cse for whey protein. Nutr. Met. 7:51. Iked, T., E. Kumgi, S. Iwt, nd A. Ymkw. 213. Solule CD26/dipeptidyl peptidse IV enhnces the trnscription of IL-6 nd TNF- in THP-1 cells nd monocytes. PLoS ONE 8:e6652. Kiry, M., D. Yu, S. O Connor, nd M. Gorrell. 21. Inhiitor selectivity in the clinicl ppliction of dipeptidyl peptidse-4 inhiition. Clin. Sci. 118:31 41. Kuci, M., K. Jnkowski, R. Rec, M. Wysoczynski, L. Bndur, D. J. Allendorf, et l. 24. CXCR4 SDF-1 signlling, locomotion, chemotxis nd dhesion. J. Mol. Histol. 35:233 245. Lcroix, I. M., nd E. C. Li-Chn. 212. Dipeptidyl peptidse- IV inhiitory ctivity of diry protein hydrolystes. Int. Diry J. 25:97 12. Lmeir, A.-M., C. Durinx, S. Schrpe, nd I. De Meester. 23. Dipeptidyl-peptidse IV from ench to edside: n updte on structurl properties, functions, nd clinicl spects of the enzyme DPP IV. Crit. Rev. Clin. L. Sci. 4:29 294. Lmers, D., S. Fmull, N. Wronkowitz, S. Hrtwig, S. Lehr, D. M. Ouwens, et l. 211. Dipeptidyl peptidse 4 is novel dipokine potentilly linking oesity to the metolic syndrome. Dietes 6:1917 1925. Loh, K., H. Herzog, nd Y.-C. Shi. 215. Regultion of energy homeostsis y the NPY system. Trends Endocrinol. Met. 26:125 135. Luetzky, R., D. Mndel, F. B. Mimouni, L. Hermn, R. Reich, nd S. Reif. 21. MMP-2 nd MMP-9 nd their tissue inhiitor in preterm humn milk. J. Peditr. Gstroenterol. Nutr. 51:21 212. Mtheeussen, V., A.-M. Lmeir, W. Jungrithmyr, N. Gomez, K. Mc Entee, P. Vn der Veken, et l. 212. Method comprison of dipeptidyl peptidse IV ctivity ssys nd their ppliction in iologicl smples contining reversile inhiitors. Clin. Chim. Act 413:456 462. McClung, J. M., D. Vn Gmmeren, M. A. Whidden, D. J. Flk, A. N. Kvzis, M. B. Hudson, et l. 29. Apocynin ttenutes diphrgm oxidtive stress nd protese ctivtion during prolonged mechnicl ventiltion. Crit. Cre Med. 37:1373. McGinnis, G. R., C. Bllmnn, B. Peters, G. Nnykkr, M. Roerts, R. Amin, et l. 215. Interleukin-6 medites exercise preconditioning ginst myocrdil ischemi reperfusion injury. Am. J. Physiol. Hert Circ. Physiol. 38: H1423 H1433. Moley, C. B., C. D. Fox, B. S. Ferguson, C. A. Pscoe, J. C. Hely, J. S. McAdm, et l. 215. Effects of protein type nd composition on postprndil mrkers of skeletl muscle nolism, dipose tissue lipolysis, nd hypothlmic gene expression. J. Int. Soc. Sports Nutr. 12:14. Moley, C. B., C. D. Fox, R. M. Thompson, J. C. Hely, V. Sntucci, W. C. Kephrt, et l. 216. Comprtive effects of whey protein versus l-leucine on skeletl muscle protein synthesis nd mrkers of riosome iogenesis following resistnce exercise. Amino Acids 48:733 75. Mumford, P., W. C. Kephrt, A. E. McCloskey, A. M. Hollnd, J. J. Shke, C. B. Moley, et l. 215. Effects of su-chronic rnched chin mino cid supplementtion on mrkers of muscle dmge nd performnce vriles following 1 week of rigorous weight trining. J. Int. Soc. Sports Nutr. 12:P29. Rikos, V., nd T. Dssios. 213. Helth-promoting properties of ioctive peptides derived from milk proteins in infnt food: review. Diry Sci. Technol. 94:91 11. Pge 12 ª 216 The Authors. Physiologicl Reports pulished y Wiley Periodicls, Inc. on ehlf of the Americn Physiologicl Society nd The Physiologicl Society.