Biochemical and Biophysical Research Communications 308 (2003)
|
|
- Crystal Bryant
- 5 years ago
- Views:
Transcription
1 Biochemical and Biophysical Research Communications 308 (2003) BBRC Precise quantitation of 5a-reductase type 1 mrna by RT-PCR in rat liver and its positive regulation by testosterone and dihydrotestosterone Jesus M. Torres and Esperanza Ortega * Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Granada, Avda. de Madrid s/n., Granada, Spain Received 3 July 2003 Abstract The liver is a multifunctional organ responsible for steroid hormones catabolism. Thus, the enzymes responsible for steroid catabolism are located in the liver, including the steroid 5a-Reductase (5a-R) (EC ) which catalyzes the conversion of compounds with D 4;5 double bonds such as testosterone (T) into their respective reduced derivatives such as dihydrotestosterone (DHT), which are more hydrosoluble, therefore facilitating their excretion. We present precise measurements of mrna levels of steroid 5a-Reductase type 1 isozyme (5a-R1) in the liver of male rats with different androgen status, using a quantitative RT-PCR coupled to laser-induced fluorescence capillary electrophoresis (LIF-CE). By means of this technique, we demonstrate a high level of expression of the gene that encodes 5a-R1 isozyme in male rat liver, and both T and DHT exert a positive control on the genetic expression of liver 5a-R1 isozyme. Since DHT does not contain a D 4;5 double bond, our results raise the possibility that hepatic 5a-R type 1 not only participates in the catabolism of steroids with D 4;5 double bonds, but also in other physiological functions, perhaps in the masculinization of the external genitalia in males with 5a-R type 2 gene deficiency. Ó 2003 Elsevier Inc. All rights reserved. Keywords: Quantitative RT-PCR; 5a-Reductase type 1; Testosterone; Dihydrotestosterone; Liver The liver is a multifunctional organ responsible for some catabolic functions, including steroid hormone catabolism. The hepatic catabolism of steroids in rat and the enzymes implicated in these events, including the enzyme steroid 5a-Reductase (5a-R) (EC ), have been known for a long time [1,2]. In some target tissues, including the liver, testosterone (T) is converted to 5a-dihydrotestosterone (DHT) by the enzyme 5a-R [3]. It has recently been demonstrated that 5a-R occurs as two isozymes, 5a-Reductase type 1 (5a-R1) and 5a- Reductase type 2 (5a-R2), which have different biochemical properties and may, therefore, be expected to have different physiological roles. 5a-R2 is the predominant enzyme in the prostate gland and other androgen-dependent organs [3], whereas 5a-R1 is the predominant enzyme in extraprostatic tissues, such as skin and liver. * Corresponding author. Fax: address: esortega@ugr.es (E. Ortega). In peripheral tissues (e.g., liver), 5a-R type 1 and reductive 3a-hydroxysteroid dehydrogenase isoforms work consecutively to eliminate androgens and protect against excess hormone [4]. Hepatic 5a-reduction of T could not only be a mechanism to obtain more hydrosoluble 5a-reduced metabolites of this hormone, facilitating in this way their excretion, but could also allow the production of DHT, an androgen with a much higher affinity for the androgen receptor than T itself. DHT is now considered not only as a metabolite of T intracellularly produced in androgen-dependent organs, but also as a true hormone, with all the corresponding characteristics [3]. In fact, DHT produced in organs such as the skin and liver circulate in the blood and could exert their effects in different and distant organs. We recently demonstrated that the isozyme 5a-R1 is under the positive control of both androgens T and DHT in rat prostate [5]. We also found that the regulation of the 5a-Reductase isozymes by both T and DHT is X/$ - see front matter Ó 2003 Elsevier Inc. All rights reserved. doi: /s x(03)
2 470 J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) different in rat prostate than in brain [6]. Two questions are raised by these findings: whether hepatic 5a-Reductase is regulated by the androgens T and DHT; and how 5a-Reductase is regulated by T and DHT in the liver. If hepatic 5a-Reductase is under the positive control of DHT (with no D 4;5 double bond in its molecule), it is clear that hepatic 5a-Reductase not only exerts a catabolic role, transforming T into a more hydrosoluble metabolite DHT, but may also play other important physiological functions. The role of 5a-R type 1 could be decisive in the masculinization during puberty of the external genitalia in individuals with 5a-Reductase type 2 isozyme deficiency. Steroid 5a-Reductase deficiency is a rare autosomal recessive disorder caused by mutations in the SRD5A2 gene, resulting in diminished dihydrotestosterone (DHT) formation and, hence, in a severe virilization deficit of the external genitalia. In this paper we have applied a novel, rapid, accurate, and modestly labor-intensive RT-PCR method coupled to laser-induced fluorescence capillary electrophoresis (LIF-CE), developed in our laboratory [7,8], in order to: (a) precisely quantitate the mrna levels of 5a-R type 1 isozyme in the liver of the male rat, (b) determine the possible regulation of hepatic 5a-R by both T and DHT, and (c) establish whether 5a-Reductase plays an important physiological role besides its catabolic function. Materials and methods Animals. Adult male Wistar rats weighing g were housed in an air-conditioned room with fluorescent lights on from 7.00 to h, and were given standard laboratory pellet chow and water ad libitum. Experiments were made in strict accordance with the NIH guide for the Care and Use of Laboratory Animals. The experimental groups studied were: intact rats (I), intact rats plus T (I + T), intact rats plus DHT (I + DHT), castrated rats (C), castrated rats plus T (C + T), and castrated rats plus DHT (C + DHT). The castrated animals underwent bilateral orchidectomy under ether anesthesia. Groups I + T and C + T were subcutaneously (s.c.) injected with oil vehicle (20% ethanol in sesame oil) containing testosterone propionate (T p ; 1 mg/kg body weight/day) [9] on days 0, 3, 6, 9, and 12, and a final injection was given 3 h before decapitation on day 15. To enable comparison of the effects of T and DHT, groups I + DHT and C + DHT were s.c. injected with oil vehicle (20% ethanol in sesame oil) containing dihydrotestosterone propionate (D p ; 1 mg/kg body weight/ day) [9] on the same days (days 0, 3, 6, 9, 12, and 15). I and C groups were s.c. injected on the same days with oil vehicle alone. There were ten rats per group. The animals were decapitated, and the liver was removed and weighed. Liver samples were frozen in liquid nitrogen and stored at )80 C until analysis. Blood samples were collected in heparinized tubes. After coagulation, the blood was centrifuged at 2000 rpm for 10 min. The plasma was separated and stored at )20 C until the hormonal measurements were performed. Hormone assays. Plasma T concentrations were measured by RIA using a commercial DiaSorin (Vercelli, Italy) kit without modification. The intra- and inter-assay coefficients of variation were 7.6% and 12.0%, respectively, and the sensitivity was 0.05 g/ml. Plasma DHT concentrations were measured by direct ELISA (Diagnostic Biochem Canada, Ontario, Canada). The intra- and inter-assay coefficients of variation were 5.9% and 7.5%, respectively, and the sensitivity was 6.0 pg/ml. Oligonucleotides used for amplifications. Sequence of rat 5a-R type 1 isozyme was obtained from GenBank and the sequence of plasmid pegfp-c1 was obtained from the Clontech web page. These sequences were used to design the primer pairs. Primers for 5a-R type 1 isozyme were 20 bp of length, whereas primers used to synthesize the competitor molecule were 40 bp of length. All forward primers were end-labeled with 6-carboxy-fluorescein (6-FAM). Oligonucleotides were synthesized by PE-Applied Biosystems, UK. Primer sequences ( ) and PCR product sizes were as follows: Name Primer sequence ( ) Size (bp) R1-F GAGATATTCAGCTGAGACCC 185 R1-R TTAGTATGTGGGCAGCTTGG IS1-F GAGATATTCAGCTGAGACCCAC 300 GTAAACGCCCACAAGTTC IS1-R TTAGTATGTGGGCAGCTTGGT CTTGTAGTTGCCGTCGTCC Construction of the internal standard template. A synthetic internal standard (IS) DNA of 300-bp was synthesized from the sequence of plasmid pegfp-c1 (Clontech, Palo Alto, CA). A set of primers of 40 nucleotides was used to synthesize the competitive molecule, IS-1 (competitor DNA of 5a-R1). The first 20 nucleotides at 5 0 ends correspond to the forward and reverse primers that amplify 5a-R1 fragment, and 20 nucleotides at 3 0 ends correspond to the opposite strands of the plasmid sequence. The 300 bp-fragment IS-1 was obtained after two consecutive amplifications from pegfp-c1, with 5 0 and 3 0 ends modified to contain the same nucleotide sequences as SRD5A1 [7,8]. Reverse transcription reaction-polymerase chain reaction. Total RNA was extracted from 25 mg of rat liver tissues by acid guanidinium thiocyanate phenol chloroform [10]. The RNA was resuspended in diethyl pyrocarbonate (DEPC)-treated water and spectrophotometrically quantitated for analysis. First-strand cdna was synthesized according to Torres and Ortega [8]. The PCR profile was: denaturing, 94 C for 30 s; annealing, 55 C for 30 s; and extension, 72 C for 30 s. In each case the number of cycles was 35. PCR was carried out in a Perkin Elmer 2400 Thermal Cycler. Analysis of PCR products. A CE system with LIF detection was used to characterize RT-PCR products. After amplification, an aliquot of the sample (1 ll) was diluted 1/20 with 18.5 ll of formamide and 0.5 ll of GeneScan-500 TAMRA Size Standard (Applied Biosystem, Warrington, UK) and denatured at 95 C for 3 min. Capillary electrophoresis was carried out in a 47 cm-silica capillary containing POP- 4 polymer (Applied Biosystem, USA). The separation capillary was first filled with the polymer solution. The sample was then injected into the separation capillary for 5 s. The temperature of the separation capillary was 60 C and each sample ran during 24 min at 100 V/cm. We performed LIF-CE in an ABIPRISM 310 Genetic Analyzer (Applied Biosystem, USA). The ratio of fluorescence of 5a-R1/IS-1 was plotted against the amount of competitive DNA IS-1 and the concentration of target DNA in the sample was calculated according to Torres et al. [7,8]. The concentration of problem cdna was corrected by the correction factor K. The correction factor K depends on the RT-PCR characteristics and is the product of three components that represent the correction due to: the difference in size between problem and standard; the correction due to the addition of the internal standard in DNA form, and the efficiency of the retrotranscription [7,8]. Statistical analysis. Statistical analysis of the results was performed using the Student s t test.
3 Results and discussion Serum hormonal levels J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) Castrated animals had significantly lower T levels with respect to intact animals (Fig. 1). As may be expected, there was a significant increase in T levels after T treatment in both intact and castrated rats. After DHT treatment, there was a significant decrease in T levels in intact rats in comparison with their pre-treatment levels. The DHT levels in castrated animals were lower than those in intact animals. After T treatment, there was a significant increase in DHT levels in both intact and castrated animals with a higher effect in the castrated rats. After DHT treatment, there was an increase in DHT levels in both intact and castrated animals in comparison with their respective pre-treatment levels. Quantitation of 5a-R1 mrna levels in liver tissues The amount of mrna was expressed as number of mrna copies per lg of total RNA. After cdna was generated from total RNA by RT reaction, it was coamplified in the presence of decreasing amounts of the competitive DNA ( molecules). We co-amplified 5a-R1 cdna and the competitive standard DNA IS-1 using the same pair of primers. With decreasing amounts of the competitive DNA, the relative intensity of amplified product of target DNA increased. The mean amount of 5a-R1 mrna in the liver of the different experimental groups is displayed in Fig. 2. The 5a-R1 mrna levels in castrated animals were significantly lower than in intact animals. After T treatment, there was a significant increase in 5a-R1 mrna levels in both intact and castrated rats in comparison with their Fig. 1. Effects of testosterone (T) and dihydrotestosterone (DHT) on plasma T and DHT levels of intact (I) and castrated (C) animals; *p < 0:05 or less vs. I animals; #p < 0:05 or less vs. C animals. Fig. 2. Effects of testosterone (T) and dihydrotestosterone (DHT) on hepatic steroid 5a-Reductase 1 (5a-R1) mrna levels of intact (I) and castrated (C) animals; *p < 0:05 or less vs. I animals; #p < 0:05 or less vs. C animals. respective pre-treatment levels. After DHT treatment, there was a significant increase in 5a-R1 mrna levels in both intact and castrated animals in comparison with their respective pre-treatment levels. Our results demonstrate, to our knowledge for the first time, a high level of expression of the gene that encodes the 5a-R type 1 enzyme in the male rat liver. These data are consistent with findings by other authors who demonstrated high 5a-Reductase activity in the rat liver [1,2,11 13]. Our study represents a further advance in this field, contributing a precise quantitation of the gene expression of 5a-R type 1 in liver. This was achieved by the use of an RT-PCR method coupled to LIF-CE developed by our group in order to quantitate the mrna expression of the 5a-R type 1 isozyme in the liver of male rat. This method combines the strengths of competitive PCR with the sensitivity of LIF-CE. Our strategy was to obtain an exogenous internal standard rapidly and simply after two consecutive PCR amplifications, and then to subject both standard and unknown to PCR amplification using the same set of primers [7]. In our view, the development of the RT-PCR procedure has provided a technique that is more specific and sensitive than traditional methods of RNA analysis, such as Northern or dot blot analysis and RNA protection assay, and which has therefore become the method of choice for studying gene expression [14 18]. We were able to establish that in the intact animal, 5a-R type 1 expression in the liver is two-fold higher than its expression in the prostate [5]. This finding may be of physiologic interest, because the liver requires a large amount of 5a-R type 1 to catalyze the reduction of D 4;5 double bonds in a variety of substrates such as T. Moreover, 5a-R type 1 is thought to play a catabolic role in steroid hormone metabolism. In the prostate,
4 472 J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) however, 5a-R type 1 is expressed in epithelial cells and may be responsible for synthesizing DHT, which acts in an autocrine manner to stimulate the cells differentiation and in a paracrine fashion to stabilize or stimulate the division of the adjacent androgen-dependent luminal epithelium [3]. The results of our experiments demonstrated that 5a- R1 isozyme is regulated positively by androgens in the liver of male rat, because the mrna levels of 5a-R1 isozyme were significantly decreased after castration (Fig. 2), when circulating levels of both T and DHT are low (Fig. 1). Conversely, 5a-R type 1 expression increased in both intact and castrated animals after T and DHT treatment. The effects of T on the 5a-R type 1 gene could be expected, as it seemed logical that an increase in the concentration of substrates with D 4;5 double bond such as T would increase 5a-R type 1 gene expression, thereby enhancing the hepatic metabolism of T, as known for many years [1,2]. With respect to DHT, our data revealed that in the liver, as in the prostate gland, DHT positively regulates the genetic expression of 5a- R1 enzyme, demonstrating at transcriptional level the feed-forward control exerted by DHT on its own biosynthesis through the increased expression of 5a-R1 gene. It has been proposed that feed-forward regulation plays a key role in various developmental systems, especially in situations in which the local concentration of a molecule such as a morphogen must be dramatically increased to bring about a defined pattern of expression [19]. In the prostate, the DHT produced by 5a-R type 1 in epithelial cells may act by a feed-forward mechanism on 5a-R type 2 expression in the stroma of the prostate to induce the development of the gland [3]. The induction of the 5a-R type 1 gene in liver by DHT appears to demonstrate that the catabolism of steroid derivates with D 4;5 double bond is not the only mission of 5a-R type 1. The development of the male phenotype in mammals can be divided into three time stages, beginning with the establishment of chromosomal sex at the time of fertilization. Thereafter, gonadal sex is determined by the expression of a key regulatory gene on the Y chromosome (the testis-determining gene or SRY) [20]. Expression of this gene transforms a bipotential gonad into a fetal testis capable of synthesizing T and other hormones required for the third phase of sexual development, the establishment of male phenotypic sex. In this last stage, T acts in concert with the product of the androgen receptor gene to initiate the formation of internal male reproductive structures. In the embryonic urogenital tract, T is converted to DHT, which in turn binds to the androgen receptor and drives the differentiation of the external genitalia and the prostate gland. The outlines of this complex developmental process have been deduced from animal experimentation [21] and the study of naturally occurring mutations in key genes that alter the male phenotype. The failure to synthesize DHT leads to alterations in the development of the external genitalia and prostate, but does not affect other steps in the developmental pathway [22]. Some genotypically masculine individuals of a family in the Dominican Republic were reported to present mutations in the 5a-Reductase type 2 gene. They were born with normal internal masculine organs (masculinized by T) but non-masculinized external organs (masculinized by DHT). At puberty, their external genitalia masculinized and they became phenotypically normal men. The induction of the 5a-Reductase type 1 gene in the liver by DHT may explain, at least in part, this important biological phenomenon. In fact, the increase in testicular T secretion produced at puberty by these individuals could induce 5a-R type 1 in the liver and perhaps in the skin. All this produces an increase in the amount of DHT that further induces the expression of 5a-R type 1 gene (feed-forward mechanism). The greatly increased amount of circulating DHT that results could be capable of producing the masculinization of the external genitalia. Thus, DHT acts as a true hormone and the liver as a true endocrine gland. In summary, we have demonstrated, using our technique of RT-PCR coupled to LIF-CE: (1) high levels of expression of the gene that encodes 5a-R type 1 enzyme in male rat liver; (2) that T exerts a positive control on the genetic expression of liver 5a-R1 isozyme; and (3) that DHT exerts a positive control on the genetic expression of liver 5a-R1 isozyme. Our results raise the possibility that hepatic 5a-R type 1 not only participates in the catabolism of steroids with D 4;5 double bond, but also in other physiological functions, possibly including the masculinization of the external genitalia in males with 5a-R type 2 gene deficiency. Acknowledgments We thank R. Davies for revising the English text and the San Cecilio University Hospital of Granada for allowing us use of the ABIPRISM 310 Genetic Analyzer. This work was funded in part by DGICYT PM , FIS PI , and Andalusian Regional Government (Endocrinology & Metabolism Group). References [1] J.A. Gustafsson, A. Stenberg, Irreversible androgenic programming at birth of microsomal and soluble rat liver enzymes active on androstene-3,17-dione and 5-alpha-androstane-3alpha,17betadiol, J. Biol. Chem. 249 (1974) [2] J.A. Gustafsson, A. Stenberg, Neonatal programming of androgen responsiveness of liver of adult rats, J. Biol. Chem. 249 (1974)
5 J.M. Torres, E. Ortega / Biochemical and Biophysical Research Communications 308 (2003) [3] D.W. Rusell, J.D. Wilson, Steroid 5a-Reductase: two genes/two enzymes, Annu. Rev. Biochem. 63 (1994) [4] Y. Jin, T.M. Penning, Steroid 5a-reductases and 3a-hydroxysteroid dehydrogenases: key enzymes in androgen metabolism, Best Pract. Res. Clin. Endocrinol. Metab. 15 (2001) [5] J.M. Torres, E. Ruiz, E. Ortega, Development of a quantitative RT-PCR method to study 5-alpha-Reductase mrna isozymes in rat prostate in different androgen status, Prostate 56 (2003) [6] J.M. Torres, E. Ortega, Differential regulation of steroid 5a- Reductase isozymes expression by androgens in the adult rat brain, FASEB J (2003) in press. [7] J.M. Torres, J.A. Gomez-Capilla, E. Ortega, Quantitative reversetranscriptase polymerase chain reaction assay for mrna levels of steroid 5a-Reductase isozymes, Anal. Biochem. 307 (2002) [8] J.M. Torres, E. Ortega, Quantitation of mrna levels of steroid 5a-Reductase isozymes: a novel method that combines quantitative RT-PCR and capillary electrophoresis, Int. J. Biochem. Cell Biol. (2003) in press. [9] F.W. George, D.W. Russel, J.D. Wilson, Feed-forward control of prostate growth: dihydrotestosterone induces expression of its own biosynthetic enzyme, steroid 5 alpha-reductase, Proc. Natl. Acad. Sci. USA 88 (1991) [10] P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction, Anal. Biochem. 162 (1987) [11] S. Andersson, R.W. Bishop, D.W. Russell, Expression cloning and regulation of steroid 5 alpha-reductase, an enzyme essential for male sexual differentiation, J. Biol. Chem. 264 (1989) [12] Y. Farkash, H. Soreq, J. Orly, Biosynthesis of catalytically active rat testosterone 5 alpha-reductase in microinjected Xenopus oocytes: evidence for tissue-specific differences in translatable mrna, Proc. Natl. Acad. Sci. USA 85 (1988) [13] K. Normington, D.W. Russell, Tissue distribution and kinetic characteristics of rat steroid 5 alpha-reductase isozymes. Evidence for distinct physiological functions, J. Biol. Chem. 267 (1992) [14] K.L. Kelleher, K.J. Leck, I.A. Hendry, K.I. Matthaei, A one-step quantitative reverse transcription polymerase chain reaction procedure, Brain Res. Brain Res. Protoc. 6 (2001) [15] J. Orly, Z. Rei, N.M. Greenberg, J.S. Richards, Tyrosine kinase inhibitor AG18 arrests follicle-stimulating hormone-induced granulosa cell differentiation: use of reverse transcriptase-polymerase chain reaction assay for multiple messenger ribonucleic acids, Endocrinology 134 (1994) [16] G. Gilliland, S. Perrin, K. Blanchard, H.F. Bunn, Analysis of cytokine mrna and DNA: detection and quantitation by competitive polymerase chain reaction, Proc. Natl. Acad. Sci. USA 87 (1990) [17] D.A. Rappolee, D. Mark, M.J. Banda, Z. Werb, Wound macrophages express TGF-alpha and other growth factors in vivo: analysis by mrna phenotyping, Science 241 (1988) [18] J. Singer-Sam, M.O. Robinson, A.R. Bellve, M.I. Simon, A.D. Riggs, Measurement by quantitative PCR of changes in HPRT, PGK-1, PGK-2, APRT, MTase, and Zfy gene transcripts during mouse spermatogenesis, Nucleic Acids Res. 18 (1990) [19] H. Meinhardt, Models of Biological Pattern Formation, Academic Press, New York, [20] A.H. Sinclair, P. Berta, M.S. Palmer, J.R. Hawkins, B.L. Griffiths, M.J. Smith, J.W. Foster, A.M. Frischauf, R. Lovell-Badge, P.N. Goodfellow, A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif, Nature 346 (1990) [21] A. Jost, Hormonal factors in the sex differentiation of the mammalian foetus, Philos. Trans. R. Soc. Lond. B Biol. Sci. 259 (1970) [22] J.D. Wilson, J.E. Griffin, D.W. Russell, Steroid 5 alpha-reductase 2 deficiency, Endocr. Rev. 14 (1993)
Reproductive DHT Analyte Information
Reproductive DHT Analyte Information - 1 - DHT Introduction Dihydrotestosterone (DHT) together with other important steroid hormones such as testosterone, androstenedione (ASD) and dehydroepiandrosterone
More informationSkin metabolism of steroid hormones as endogenous compounds?
Skin metabolism of steroid hormones as endogenous compounds? Van Luu-The Department of Molecular Medicine Laval University Québec, Canada This work has been supported by L Oréal Research Steroid hormones
More informationAmpFlSTR Identifiler PCR Amplification Kit
Application Note Human Identification AmpFlSTR Identifiler PCR Amplification Kit In Applied Biosystems continual efforts to improve the quality of our products, we have made some modifications to the manufacturing
More informationEFFECTS OF REVIVOGEN SCALP THERAPY ON TESTOSTERONE METABOLISM IN RECONSTRUCTED HUMAN EPIDERMIS
IN VITRO BIOLOGICAL TESTING BIOalternatives The state-of-the-art laboratory Proposal n : AD070315C-2 Study n : AD070315B EFFECTS OF REVIVOGEN SCALP THERAPY ON TESTOSTERONE METABOLISM IN RECONSTRUCTED HUMAN
More informationEFFECTS OF CLEAROGEN ACNE LOTION ON TESTOSTERONE METABOLISM IN RECONSTRUCTED HUMAN EPIDERMIS
IN VITRO BIOLOGICAL TESTING BIOalternatives The state-of-the-art laboratory Proposal n : AD070315C-2 Study n : AD070315A EFFECTS OF CLEAROGEN ACNE LOTION ON TESTOSTERONE METABOLISM IN RECONSTRUCTED HUMAN
More informationPre-Lab. 1. What do people mean when they say teenagers have raging hormones?
Name: Period: Date: You ve got MALE! Hormonal Control of Male Reproductive Processes This simulation explores how sex determination works. You will learn about the impact of testosterone concentration
More informationMale pattern baldness is the most common type of balding among males. It affects roughly, 50% of men by the age of 50,
Dihydrotestosterone (DHT) Male pattern baldness is the most common type of balding among males. It affects roughly, 30% of men by the age of 30, 50% of men by the age of 50, 57% of men by the age of 60.
More informationTESTOFEN. Anabolic & Androgenic Activity GENCOR PACIFIC, INC. Fenugreek Extract standardized for FENUSIDE TM. Copyright 2005 by Gencor Pacific, Inc.
GENCOR PACIFIC, INC. 920E. Orangethorpe Avenue, Suite B, Anaheim, CA. 92801 Ph: 714.870.8723 714.870.8724 efax: 732.875.0306 drjit@gencorpacific.com manu@gencorpacific.com www.gencorpacific.com TESTOFEN
More informationDevelopment of a Clinical Research Method for the Measurement of Testosterone. Dihydrotestosterone
Development of a Clinical Research Method for the Measurement of Testosterone and Dihydrotestosterone Martijn van Faassen, Maarten van den Noort and Ido Kima University Medical Center, Groningen, Netherlands
More informationClinical impact of type I and type II 5 alpha-reductase inhibition in prostatic disease: review and update 아주대학교김선일
Clinical impact of type I and type II 5 alpha-reductase inhibition in prostatic disease: review and update 아주대학교김선일 Development of 5ARI Discovery of 5AR type I and type II Pharmacodynamic and pharmacokinetic
More informationCastration resistant prostate cancer-what is it? and what do we do about it? Urology Postgraduate Course February 13, 2009
Castration resistant prostate cancer-what is it? and what do we do about it? Urology Postgraduate Course February 13, 2009 Charles J Ryan, MD Associate Professor of Clinical Medicine Helen Diller Family
More informationBiol 321 Genetics S 02 Exam #1
Biol 321 Genetics S 02 Exam #1 Name: 1. (8 pts) The main concept in the central dogma of molecular biology is that DNA does not code for protein directly but rather acts through an intermediary molecule
More informationIcd-10 low levels of testosterone
Icd-10 low levels of testosterone The Borg System is 100 % Icd-10 low levels of testosterone 1-10-2017 if your hormone levels are too high or too low, you may have a hormone disorder. Hormone diseases
More informationANNEX 3 TO THE DRAFT REPORT OF THE OECD VALIDATION OF THE RAT HERSHBERGER BIOASSAY: PHASE 2
ANNEX 3 TO THE DRAFT REPORT OF THE OECD VALIDATION OF THE RAT HERSHBERGER BIOASSAY: PHASE 2 Hershberger Assay Interlaboratory Study: Statistical analysis of phase 2 data from 16 laboratories in the multi-chemical
More informationSue Marty, Ph.D., D.A.B.T. The Dow Chemical Company TERA Endocrine Workshop April 23, 2013
Sue Marty, Ph.D., D.A.B.T. The Dow Chemical Company TERA Endocrine Workshop April 23, 2013 Agenda Value of WoE/MoA determinations in EDSP Information used to examine potential endocrine activity and/or
More informationAndrogenes and Antiandrogenes
Androgenes and Antiandrogenes Androgens The androgens are a group of steroids that have anabolic and/or masculinizing effects in both males and females. Testosterone [tess-toss-terone], the most important
More informationMSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Granulocyte Colony Stimulating Factor (hg-csf) Ultrasensitive Assay
MSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Granulocyte Colony Stimulating Factor (hg-csf) Ultrasensitive Assay Summary This assay measures Human Granulocyte Colony Stimulating Factor (G-CSF) in a 96-well
More informationSIMPLE, EFFICIENT AND SIMULTANEOUS DETERMINATION OF ANABOLIC STEROIDS IN HUMAN URINE
SIMPLE, EFFICIENT AND SIMULTANEOUS DETERMINATION OF ANABOLIC STEROIDS IN HUMAN URINE Pages with reference to book, From 216 To 218 S.J. Khurshid, M. Riaz, S. Ahmed ( Nuclear Chemistry Division, Pakistan
More informationM0BCore Safety Profile. Pharmaceutical form(s)/strength: 5 mg SE/H/PSUR/0002/006 Date of FAR:
M0BCore Safety Profile Active substance: Finasteride Pharmaceutical form(s)/strength: 5 mg P-RMS: SE/H/PSUR/0002/006 Date of FAR: 16.05.2014 4.3 Contraindications Finasteride is not indicated for use in
More informationKNG1 (Human) ELISA Kit
KNG1 (Human) ELISA Kit Catalog Number KA1040 96 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General
More informationFunctional differentiation of goat mammary epithelium. A microarray preliminary approach
Functional differentiation of goat mammary epithelium. A microarray preliminary approach F. Faucon 1,2, E. Zalachas 1, S. Robin 3 and P. Martin 1 1 Unité Génomique et Physiologie de la Lactation, PICT-GEL,
More informationbiosensis Mouse Brain-derived neurotrophic factor (BDNF) ELISA Kit Protocol
biosensis Mouse Brain-derived neurotrophic factor (BDNF) ELISA Kit Protocol Catalog No: BEK-2003-2P For quantitative detection of mouse BDNF in cell culture supernatants, cell lysates, serum, and citrate,
More informationCatabolism in Skeletal Muscle The Phosphagen System
Catabolism in Skeletal Muscle The Phosphagen System Overview of ATP Regeneration Anaerobic vs Aerobic Metabolism Creatine Kinase Reaction Adenylate Kinase Reaction Purine Nucleotide Cycle Creatine Phosphate
More informationNow it is. easy to switch. CHS TM Steroid Profiling kit and software. Brochure not for distribution in the USA and Canada
Now it is easy to switch to Clinical MSMS CHS TM Steroid Profiling kit and software Brochure not for distribution in the USA and Canada 2 Meeting your needs for steroid assays PerkinElmer s new CHS MSMS
More informationF7 (Human) Chromogenic Activity Assay Kit
F7 (Human) Chromogenic Activity Assay Kit Catalog Number KA0971 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the
More informationNational Institute for Public Health and the Environment Annual CRL workshop 22 October Update on natural Hormone studies
2008 Annual CRL workshop 22 October 2008 Update on natural Hormone studies Natural hormone studies: update Possible approaches - C12/C13 ratio: can result in proof of abuse - Determination of intact esters
More informationbiosensis Rat Fibronectin ELISA Kit Protocol
biosensis Rat Fibronectin ELISA Kit Protocol Catalog No: BEK-2017-2P For quantitative detection of rat Fibronectin in cell culture supernatants, serum, and citrate, heparin, or EDTA plasma samples only
More informationSTUDY OF THE EFFECT OF AN EXTRACT OF Serenoa repens on the production of the 5-α reductasa enzyme
STUDY OF THE EFFECT OF AN EXTRACT OF Serenoa repens on the production of the 5-α reductasa enzyme 1) ROLE OF 5-α-ALFA-REDUCTASA 5-α reductasas (5-α-R) are a family of enzymes involved in steroid metabolism.
More informationbiosensis Mouse Interleukin-1 beta (IL-1β) ELISA Kit Protocol
biosensis Mouse Interleukin-1 beta (IL-1β) ELISA Kit Protocol Catalog Number: BEK-2151-1P For quantitative detection of mouse IL-1β in cell culture supernatant, cell lysates, and serum and hepain or EDTA
More informationCharacterization of two microsatellite PCR multiplexes for high throughput. genotyping of the Caribbean spiny lobster, Panulirus argus
Characterization of two microsatellite PCR multiplexes for high throughput genotyping of the Caribbean spiny lobster, Panulirus argus Nathan K. Truelove 1, Richard F. Preziosi 1, Donald Behringer Jr 2,
More informationProviron. Proviron Functions & Traits: (Mesterolone)
Proviron (Mesterolone) Proviron represents one of the oldest anabolic androgenic steroids on the market. A product of the giant pharmaceutical company Schering, it would first appear in 1934. Officially
More informationFemale testosterone level chart
Female testosterone level chart The Borg System is 100 % Female testosterone level chart Mar 23, 2015. Male, Female. Age: T Level (ng/dl):, Age: T Level (ng/dl):. 0-5 mo. 75-400, 0-5 mo. 20-80. 6 mos.-9
More informationNatural Hair Transplant Medical Center, Inc Dove Street, Suite #250, Newport Beach, CA Phone
Natural Hair Transplant Medical Center, Inc. 1000 Dove Street, Suite #250, Newport Beach, CA 92660 Phone-949-622-6969 Finasteride (PROPECIA ) Acknowledgement Finasteride is an oral medication, manufactured
More informationBiochemical Applications of Computational Chemistry
Biochemical Applications of Computational Chemistry 1 Chemistry Today: A Different View Old Way New Way Correlate Structural Design Interpret Desired Properties Synthesize Build Measure Simulate Compounds
More informationbiosensis Rat Interleukin-1 beta, IL-1β ELISA Kit Protocol
biosensis Rat Interleukin-1 beta, IL-1β ELISA Kit Protocol For the quantitative detection of rat IL-1β in cell culture supernatants, serum, heparin or EDTA treated plasma samples, and cell homogenates
More informationbiosensis Human Lipocalin-2/NGAL ELISA Kit Protocol
biosensis Human Lipocalin-2/NGAL ELISA Kit Protocol Catalog No: BEK-2141-2P For quantitative detection of human Lipocalin-2 in cell culture supernatants, serum, and heparin treated plasma, saliva, and
More informationAlice Baynes, Gemma Montagut Pino, Anne E Lockyer, Hanna Belschner, Edwin Routledge, Susan Jobling. Biology at Brunel 2 nd May 2018
Unexpected Endpoints: Pharmaceutical 5αreductase inhibitors, designed to treat prostate cancer in men, disrupt gastropod morphogenesis during embryo development. Alice Baynes, Gemma Montagut Pino, Anne
More informationbiosensis Rat Glial cell line-derived neurotrophic factor/gdnf total /ATF ELISA Kit Protocol
biosensis Rat Glial cell line-derived neurotrophic factor/gdnf total /ATF ELISA Kit Protocol Catalog No: BEK-2020-1P For quantitative detection of rat GDNF in cell culture supernatants, cell lysates, tissue
More informationAdvanced Animal Science TEKS/LINKS Student Objectives One Credit
First Six Weeks Career/Safety/Work Habits AAS 1(A) The student will identify career development and entrepreneurship opportunities in the field of animal systems. AAS 1(B) The student will apply competencies
More informationWADA Technical Document TD2014EAAS. Endogenous Anabolic Androgenic Steroids Measurement and Reporting
Endogenous Anabolic Androgenic Steroids Measurement and Reporting 1.0 Introduction The purpose of this Technical is to harmonize the approaches to the measurement and reporting of endogenous anabolic androgenic
More informationbiosensis Human IGF-II, Insulin-like growth factor II, Somatomedin-A ELISA Kit Protocol
biosensis Human IGF-II, Insulin-like growth factor II, Somatomedin-A ELISA Kit Protocol Catalog No: BEK-2029-1P For quantitative detection of human IGF-II in cell culture supernatants, cell lysates, tissue
More informationab Testosterone ELISA Kit
Version 10 Last updated 29 January 2018 ab108666 Testosterone ELISA Kit A competitive immunoenzymatic assay for the quantitative measurement of Testosterone in serum, plasma and urine. This product is
More informationSebum production is a key factor in the development of
Oxidative Activity of the Type 2 Isozyme of 17β-Hydroxysteroid Dehydrogenase (17β-HSD) Predominates in Human Sebaceous Glands Diane Thiboutot, Patricia Martin, Lazaros Volikos, and Kathyrn Gilliland Division
More informationbiosensis Human TNFα/Cachectin/TNFSF2 ELISA Kit Protocol
biosensis Human TNFα/Cachectin/TNFSF2 ELISA Kit Protocol Catalog No: BEK-2100-1P For quantitative detection of human TNFα in cell culture supernatants, serum, and heparin, EDTA or citrate treated plasma
More informationbiosensis Mouse Vascular endothelial growth factor A/VEGF-A/VEGF-164/VEGF-1/VEGF- 120/VEGF-2 ELISA Kit Protocol
biosensis Mouse Vascular endothelial growth factor A/VEGF-A/VEGF-164/VEGF-1/VEGF- 120/VEGF-2 ELISA Kit Protocol Catalog No: BEK-2110-1P For quantitative detection of mouse VEGF-A (VEGF164&VEGF120) in mouse
More informationRat myeloperoxidase-antineutrophil cytoplasmic antibody(mpo-anca) ELISA Kit
Rat myeloperoxidase-antineutrophil cytoplasmic antibody(mpo-anca) ELISA Kit Catalog Number. CSB-E08675r For the quantitative determination of rat myeloperoxidase-antineutrophil cytoplasmic antibody(mpo-anca)
More informationWorld Journal of Pharmaceutical and Life Sciences WJPLS
wjpls, 2016, Vol. 2, Issue 6, 173-178. Research Article ISSN 2454-2229 Gadekar. WJPLS www.wjpls.org SJIF Impact Factor: 3.347 ROLE OF ACID PHOSPHATASE IN THE REPRODUCTIVE CYCLE OF FEMALE LABEO ROHITA (HAM)
More informationX/97/$03.00/0 Vol. 82, No. 8 Journal of Clinical Endocrinology and Metabolism Copyright 1997 by The Endocrine Society
0021-972X/97/$03.00/0 Vol. 82, No. 8 Journal of Clinical Endocrinology and Metabolism Printed in U.S.A. Copyright 1997 by The Endocrine Society Physiological Changes in Dehydroepiandrosterone Are Not Reflected
More informationSAM510: SAM Methyltransferase Assay A Non Radioactive Colorimetric Continuous Enzyme Assay
462PR 01 A Geno Technology, Inc. (USA) brand name G-Biosciences, St Louis, MO. USA 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com SAM510: SAM Methyltransferase Assay A Non Radioactive Colorimetric
More informationMALE PATTERN BALDNESS
MALE PATTERN BALDNESS Male-pattern hair loss (MPHL), also known as androgenic alopecia and male pattern baldness, is hair loss that occurs due to an underlying susceptibility of hair follicles to shrinkage
More informationColour Genetics. Page 1 of 6. TinyBear Pomeranians CKC Registered Copyright All rights reserved.
Colour Genetics Dogs have probably been domesticated for at least 15 000 years. The first dogs likely had an appearance much like the wolf or coyote. However, over the time they have been domesticated,
More informationCurriculum vitae Kristen E. Frenzel, Ph.D.
Curriculum vitae Kristen E. Frenzel, Ph.D. Neuroscience and Behavioral Biology Program 1462 Clifton Rd. NE W: 404-727-1317 Suite 304E C: 678-362-9318 Atlanta, GA 30322 kfrenze@emory.edu Education and Academic
More informationCONFÉRENCE À SUCCÈS EN SCIENCES DE LA VIE : ENDOCEUTICS
CONFÉRENCE À SUCCÈS EN SCIENCES DE LA VIE : ENDOCEUTICS 13 Septembre 2018 Quebec, Canada 1 ENDOCEUTICS No. 1 Innovative pharmaceutical company in menopausal women s health in the world 2 Facilities Head
More informationPerspective on the regulatory role of UGT2B28 as a conjugating enzyme in the progression of prostate cancer
Perspective Perspective on the regulatory role of UGT2B28 as a conjugating enzyme in the progression of prostate cancer Therina du Toit, Amanda C. Swart Department of Biochemistry, Stellenbosch University,
More informationTESTOFEN HUMAN CLINICAL TRIAL GENCOR PACIFIC, INC. Copyright 2006 by Gencor Pacific, Inc.
GENCOR PACIFIC, INC. 920 E. Orangethorpe Avenue, Suite B, Anaheim, CA 92801 Ph: 714.870.8723 714.870.8724 efax: 732.875.0306 drjit@gencorpacific.com gita@gencorpacific.com www.gencorpacific.com TESTOFEN
More informationbiosensis Human Soluble Tumor Necrosis Factor receptor type II (stnfrii) ELISA Kit Protocol
biosensis Human Soluble Tumor Necrosis Factor receptor type II (stnfrii) ELISA Kit Protocol Catalog No: BEK-2103-2P For quantitative detection of human soluble TNFRII (stnfrii) in human cell culture supernatants,
More information26-G Keewaydin Drive, Salem, NH P: (800) F: (603)
Dihydrotestosterone ELISA For the quantitative determination of DHT in serum. For Research Use Only. Not for Use in Diagnostic Procedures. Catalog Number: 11-DHTHU-E01 Size: 96 wells Version: 4.1 August
More informationFactor X Human Chromogenic Activity Assay Kit
ab108833 Factor X Human Chromogenic Activity Assay Kit Instructions for Use For the quantitative measurement of Human Factor X activity in cell culture supernatants, serum, urine and plasma This product
More informationbiosensis Mouse CXCL10/IP-10 ELISA Kit Protocol
biosensis Mouse CXCL10/IP-10 ELISA Kit Protocol Catalogue No: BEK-2124-2P TABLE OF CONTENTS I Materials provided...2 II Equipment required but not supplied...2 III Technical hints....2 IV Storage of kit
More informationHuman Factor X Chromogenic Activity Kit
AssaySense Human Factor X Chromogenic Activity Kit Assaypro LLC 3400 Harry S Truman Blvd St. Charles, MO 63301 T (636) 447-9175 F (636) 395-7419 www.assaypro.com For any questions regarding troubleshooting
More informationMALE HORMONE THERAPY OPTIONS
MALE HORMONE THERAPY OPTIONS The following tables have been compiled by Women s International Pharmacy staff pharmacists to represent some of the more frequently prescribed regimens for men. The Women
More informationTestosterone ELISA Kit
Testosterone ELISA Kit Catalog Number KA3396 96 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General
More informationbiosensis Rat IGF-1/Somatomedin/Insulin-like growth factor ELISA Kit Protocol
biosensis Rat IGF-1/Somatomedin/Insulin-like growth factor ELISA Kit Protocol Catalog No: BEK-2150-1P For quantitative detection of rat IGF-1 in cell culture supernatants, cell and tissue homogenates,
More informationFINCAR Tablets (Finasteride)
Published on: 10 Jul 2014 FINCAR Tablets (Finasteride) Composition FINCAR Tablets Each film-coated tablet contains: Finasteride USP - 5 mg Dosage Form Tablet Pharmacology Pharmacodynamics Mechanism of
More informationSecrets of Abang Sado : Effects of testosterone therapy. Azraai Nasruddin
+ Secrets of Abang Sado : Effects of testosterone therapy Azraai Nasruddin + Testosterone Testosterone : Steroid hormone - Made primarily by the testicles in males - Small amounts produced by the adrenal
More informationContinued Genetic Monitoring of the Kootenai Tribe of Idaho White Sturgeon Conservation Aquaculture Program
Continued Genetic Monitoring of the Kootenai Tribe of Idaho White Sturgeon Conservation Aquaculture Program Deliverable 1): Monitoring of Kootenai River white sturgeon genetic diversity Deliverable 2):
More informationPros and Cons of Hormone Testing in Different Body Fluids with Different Routes of Hormone Delivery
Pros and Cons of Hormone Testing in Different Body Fluids with Different Routes of Hormone Delivery David T Zava, PhD ZRT laboratory A Guide to Steroid Hormone Testing in Different Body Fluids Following
More informationPRODUCT INFORMATION TESTOVIRON DEPOT. (testosterone enanthate)
PRODUCT INFORMATION TESTOVIRON DEPOT (testosterone enanthate) NAME OF THE MEDICINE Testosterone enanthate is designated chemically as 17 beta-heptanoyloxy-4-androstene-3- one. The empirical formula of
More informationAntiduretic Hormone, Growth. Hormone & Anabolic Steroids
Goudarz Sadeghi, DVM, PhD, DSc Associate Professor of Pharmacology University of Tehran Faculty of Veterinary Medicine Veterinary Pharmacology Endocrine System Antiduretic Hormone, Growth Hormone & Anabolic
More informationThe Science of. NUTRICULA Longevity Journal
32 December, 2011 The Science of 33 NUTRICULA Longevity Journal As men age, there is often a decline in libido and sexual function. This decline frequently interferes in intimacy within romantic relationships,
More information*Dr. Mushreq Aziz Tnesh AL-Lamy, **Dr. Asaad Adnan Aziz Al-Safi. *, ** Physical Education College /Al-Qadisiyah University ABSTRACT
EFFECT OF THE ABUSE OF STEROIDAL ANDRO- GENIC HORMONES AND THEIR RELATIVE CONTRI- BUTION TO THE LEVEL OF HORMONES (TESTOS- TERONE, FSH, LH) AND THE PROPORTION OF IN- FERTILITY IN BODYBUILDERS *Dr. Mushreq
More informationGenetic analysis of radio-tagged westslope cutthroat trout from St. Mary s River and Elk River. April 9, 2002
Genetic analysis of radio-tagged westslope cutthroat trout from St. Mary s River and Elk River April 9, 2002 Report prepared for: Angela Prince, M.Sc., R.P. Bio Westslope Fisheries 517 13 th Avenue South
More informationAnabolic Androgenic Steroids
Anabolic Androgenic Steroids 1 / 6 2 / 6 3 / 6 Anabolic Androgenic Steroids What are anabolic steroids? Anabolic steroids are synthetic, or human-made, variations of the male sex hormone testosterone.
More informationMonitoring Hormone Therapy Mark Newman, M.S. President of Precision Analytical Inc.
Mr Mark Newman Monitoring Hormone Therapy Mark Newman, M.S. President of Precision Analytical Inc. 2 Avoiding Pitfalls in (B)HRT Monitoring and Picking the Right Lab Test Objectives: Outline how expected
More informationTRT and LUTS. Mick Jagger, 70 years. PRISM IV Sept 2014
TRT and LUTS Mick Jagger, 70 years PRISM IV Sept 2014 Combination of LUTS and LOH In ageing male : -LUTS increases -LOH increases So: the combination is a common clinical scenario TRT and LUTS Startingpoint
More informationUnitedHealthcare Pharmacy Clinical Pharmacy Programs
UnitedHealthcare Pharmacy Clinical Pharmacy Programs Program Number 2017 P 2018-9 Program Prior Authorization/Medical Necessity Topical Androgens Medication Axiron*, Androderm, Androgel*, Fortesta*, Natesto*,
More informationQuestion 1: Define vital capacity. What is its significance? Vital capacity is the maximum volume of air that can be exhaled after a maximum inspiration. It is about 3.5 4.5 litres in the human body. It
More informationThe ICL Insider. Lab Testing: Testosterone. In This Issue. The Debate
The ICL Insider February 2017 Volume 2, Issue 2 Lab Testing: Testosterone In This Issue Testosterone shashtilak@iclabs.ca Next Issue: Expected Release April 2017 The Debate Aging is accompanied by various
More informationIMPC phenotyping SOPs in JMC
IMPC phenotyping SOPs in JMC Indirect Calorimetry IMPC_CAL_002 Purpose Indirect calorimetry provides detailed information on the energy metabolism of mutant mice. Energy expenditure is evaluated through
More informationFigure 2. RESULTS DATA ANALYSIS
ANDROGEN PARAMETERS IN HIRSUTE AND NORMAL FEMALE PATIENTS: IS THERE A ROLE FOR THE FREE ANDROGEN INDEX (FAI)? Castracane VD 1, Childress E 1, Tawwater B 1, Vankrieken L 2, El Shami AS 2 ( 1 Department
More informationPHYSICIANS CIRCULAR FINASTERIDE PROSCAR. Tablet 5-Alpha Reductase Inhibitor
PHYSICIANS CIRCULAR FINASTERIDE PROSCAR Tablet 5-Alpha Reductase Inhibitor FINASTERIDE (PROSCAR) a synthetic 4-azasteroid compound, is a specific inhibitor of Type II 5α-reductase, an intracellular enzyme
More informationab IgG1 Human ELISA Kit
ab100548 IgG1 Human ELISA Kit Instructions for Use For the quantitative measurement of Human IgG1 in serum and plasma This product is for research use only and is not intended for diagnostic use. Version
More information2. State the volume of air remaining in the lungs after a normal breathing.
CLASS XI BIOLOGY Breathing And Exchange of Gases 1. Define vital capacity. What is its significance? Answer: Vital Capacity (VC): The maximum volume of air a person can breathe in after a forced expiration.
More informationMALE HORMONE THERAPY OPTIONS
MALE HORMONE THERAPY OPTIONS The following tables have been compiled by Women s staff pharmacists to represent some of the more frequently prescribed regimens for men. The Women s logo is placed throughout
More informationDiversity of Thermophilic Bacteria Isolated from Hot Springs
... 40(2) 524-533 (2555) KKU Sci. J. 40(2) 524-533 (2012) Diversity of Thermophilic Bacteria Isolated from Hot Springs ( 30, 3.65 x 10 5 1. x 10 3 CFU/ml (a, b, c, d, e f 16S rrna 1. kb Polymerase Chain
More informationModule 8. X, Y, and Athletes STUDENT HANDOUT. Module 8
Module 8 Module 8 Genetics for Kids: Module 8 Part I: Introduction Competitive sports are very aggressive and only the best athletes attain fame and fortune. In an effort to succeed, some athletes may
More informationHuman ABCD1 ELISA KIT
Human ABCD1 ELISA KIT Cat. No.:DEIA8716 Pkg.Size:96T Intended use The Human ABCD1 ELISA KIT is for the quantitative detection of human ABCD1 in serum and plasma. General Description ABCD1, also known as
More informationExperiment 18 Properties of Gases
Experiment 18 Properties of Gases E18-1 E18-2 The Task In this experiment you will investigate some of the properties of gases, i.e. how gases flow, their phase changes and chemical reactivity. Skills
More informationHUMAN IL6 KITS PROTOCOL
HUMAN IL6 KITS PROTOCOL Part # 62HIL06PEG & 62HIL06PEH Test size: 500 tests (62HIL06PEG), 10,000 tests (62HIL06PEH) - assay volume: 20 µl Revision: 04 (Jan. 2018) Store at: -60 C or below This product
More informationAndrostenedione and testosterone concentrations in plasma and milk of the cow throughout pregnancy
Androstenedione and testosterone concentrations in plasma and milk of the cow throughout pregnancy Rosella Gaiani, F. Chiesa, M. Mattioli, G. Nannetti and Giovanna Galeati Istituto di Fisiologia Veterinaria
More informationMI Androgen Deficiency Hypogonadism
MI Androgen Deficiency Hypogonadism WADA TUE Expert Group John A Lombardo, MD October 2014, Columbus, Ohio USA Hypothalamic-Pituitary-Gonadal Axis / 2 Hypogonadism/Androgen Deficiency Clinical syndrome:
More informationTestosterone Topical/Buccal/Nasal
BENEFIT APPLICATION Testosterone Topical/Buccal/Nasal DRUG POLICY Benefit determinations are based on the applicable contract language in effect at the time the services were rendered. Exclusions, limitations
More informationab Androstenedione ELISA Kit
ab108672 Androstenedione ELISA Kit Instructions for Use A competitive immunoenzymatic assay for the quantitative measurement of Androstenedione in serum and plasma (citrate). This product is for research
More informationSummary. Introduction. Dow Stough, MD
Original Contribution Blackwell Publishing ORIGINAL Inc CONTRIBUTION Dutasteride improves male pattern hair loss in a randomized study in identical twins Dow Stough, MD The Dermatology Clinic, Hot Springs,
More information1001 West Broadway, Vancouver, BC V6H 4B1. Topical Finasteride
1001 West Broadway, Vancouver, BC V6H 4B1 Topical Finasteride 1 Topical finasteride is a solution containing the drug finasteride typically sold under the brand names Propecia and Proscar. The Finasteride
More informationReproductive. Androgens Analytes Information
Reproductive Androgens Analytes Information - 1 - Androgens Introduction Androgens are a group of C 19 steroids. They are responsible for masculinization of the genital tract as well as the development
More informationplethysmographic methods that when the subject was pinched on the upper
24 J. Physiol. (I95I) II2, 24-2I 6I2.I5.6II.976 THE DECREASE IN HAND BLOOD FLOW FOLLOWING INFLATION OF AN ARTERIAL OCCLUSION CUFF ON THE OPPOSITE ARM BY IAN C. RODDIE From the Department of Physiology,
More informationRelationship between Aerobic Training and Testosterone Levels in Male Athletes
Relationship between Aerobic Training and Testosterone Levels in Male Athletes Siu Yuen Ng Biology 493 13 th December, 2010 Abstract Salivary testosterone levels of 11 athletes and 15 non athletes were
More informationThis is an English translation of the original Chinese instruction leaflet generated by Google Translate. No amendments were made.
Approved Date: December 26, 2006 Revision Date: September 12, 2012 Modify Date: December 1, 2013 Finasteride tablets instructions Please read the instructions carefully and use under the guidance of a
More information(b) Androgenic effects
ANABOLC AND ANDROGENC EFFECTS OF METHANDROSTENOLONE ("") DURNG SYSTEMATC PHYSCAL ACTVTY N RATS Professor V. ROGOZKN Research nstitute of Physical Culture, Dynamo Avenue 2, 197047 LENNGRAD, USSR Despite
More information