Molecular phylogenetic status of some marine Cymothoid isopods in southeast coast of India
|
|
- Shon Butler
- 5 years ago
- Views:
Transcription
1 Molecular phylogenetic status of some marine Cymothoid isopods in southeast coast of India Thangaraj M *., Saranya S., Divya S., Ramanadevi V. & Subburaj J. Centre of Advanced Study in Marine Biology, Annamalai University, Parangipettai , TamilNadu, India [ * E.mail: coralholder@yahoo.com] Received ; revised In this study, 16S rrna and COI genes of four Indian isopod species and nine other species (retrieved from NCBI) of the three parasitic habits were examined to present a different hypothesis on the evolutionary history of the family. Present study infers that there is no relationship among the habitat-specific species. Phylogenetic tree support the monophyly of the family and the specialized mouth parts bearing species (endoparasites) are not necessarily derived from the scale attaching ones (ectoparasites). The use of more molecular markers can greatly improve the taxonomic revisions of the Cymothoidae and the present work could be a valuable first step towards this task. [Keywords: Cymothoidae, ectoparasites, mitochondrial gene, phylogeny, evolution] Introduction Cymothoid isopods represent one of the most derived lineages of isopods 1,2,3, and currently include 42 genera with over 325 described species and most parasitizing teleost fish, particularly in warm temperate and tropical seas 4. In India, earlier study showed the morphology, diversity, life cycle of four isopod parasites and the secondary infection in the host fishes 5. Some species attach externally, under the scales or at the base of fins, while other more specialized forms inhabit the gill chamber or the buccal cavity, exhibiting very distinctive eco-morphological adaptations and peculiar life-history traits 4. Brusca 6, initially proposed that the externally attaching forms would represent a distinct lineage from the internal forms, whose specialized adaptations reflect a more derived status. A decade later, a thorough revision was made by Bruce 7 and identified three subfamilies, putatively corresponding to three different evolutionary lineages: Anilocrinae, Livonecinae and Cymothoinae. However, careful field observations within the Anilocrinae have shown that some degree of behavioural flexibility can be observed even within a genus 8. 1
2 In general, the distinctive phenotypic adaptations of cymothoids, strongly constrained by the type of parasitic strategy, may hinder the choice of reliable morphological characters suitable for phylogenetic reconstruction 9. Despite the power and effectiveness of molecular markers in phylogenetic analysis, their use is seldom strictly confined to the recovery of a pattern of phylogenetic relationships among a set of studied taxa 10. In recent years, a number of studies have successfully focused on the positioning of phenotypically measurable adaptive traits on the main branches of the phylogenetic tree of several groups of organisms. These results have proven momentous in the reconstruction of the evolutionary history of several high-profile taxa 11,12 and allowed for major reinterpretations of the adaptive transformations that led to the present-day ecological diversity 13,14. In this study, we have used 16S rrna and cytochrome oxidase I (COI) gene of four Indian isopod species and nine other species (retrieved from NCBI) of the three parasitic habits to present a preliminary hypothesis on the evolutionary history of the family. Materials and Methods The parasites were collected along with their host (Elops machnata) from Vellar estuary (Lat 11⁰ 29 N; Lon 79⁰ 46 E), Parangipettai, in southeast coast of India. samples were stored in 95% ethanol and sealed with parafilm and kept at room temperature for further analysis. Each collected species were morphologically identified based on the previous report 15. The total DNA was extracted from the stored parasites leg tissue by the standard protocol 16 with the addition of 5µl Proteinase K and 10% SDS in the digestion buffer. The DNA samples from individuals of each species was diluted to about 25 ng/µl with deionized distilled water and used for polymerase chain reaction. The 16S rrna gene was amplified using the primers, 16S-cymF 5 -AGCCCTGTTCAA TGGGATTA -3 ; 16S-cymR 5 -TCCCTGGGGTAGTTTCATCTT-3 4. The PCR condition was: initial denaturation at 94ºC for 2 min, followed by 35 cycles of 1 min at 95ºC, 30 S at 50ºC and 1 min at 72ºC with a final elongation of 10 min at 72ºC. The COI gene was amplified using the primers, Fish F1 5 -TCAACCAACCACAAAGACATTGGCAC-3 ; Fish R1 5 - TAGACTTCTGGGTGGCCAAAGAATCA The PCR condition was: initial denaturation at 94ºC for 2 min, followed by 35 cycles of 1 min at 95ºC, 30 S at 54ºC and 1 min at 72ºC with a 2
3 final elongation of 10 min at 72ºC. The PCR products were purified with a PCR purification kit and sequenced in a commercial sequencing facility (Ramachandra Innovis, Chennai). The gene partial sequences of COI and 16S rrna from four isopod species were unambiguously edited using BioEdit sequence alignment editor14 and aligned using CLUSTAL- W in BioEdit 18 and then checked manually. Another twelve 16S rrna gene and COI sequences of nine species were retrieved from the GenBank and the details are given in Table1. Analyses were conducted using the Kimura 2-parameter model 20. Identical sequences were assigned in the same haplotype identity and only a single example of each species used in the genetic distance (K2P) estimation and assuming that identical haplotypes shared the same evolutionary origin. Phylogenetic and molecular evolutionary analyses, haplotype and nucleotide diversity indices were calculated using MEGA (v. 3.0) 21. The model of sequence divergence used was of Tamura 22, that accounted for multiple substitutions per site which allowed different substitution rates between transitions and transversions. The neighbour-joining (NJ) trees for the two genes were constructed using MEGA (v. 3.0) and to verify the robustness of the internal nodes of these trees, bootstrap analysis was carried out using 1000 pseudoreplications. Result and Discussion Totally 32 sequences (16S rrna + COI) from nine isopod species were analysed for its genetic relatedness. Kimura 2 Parameter (K2P) genetic distance in nine isopod species is given in Table 2. Based on the 16S rrna sequence data, Ceratothoa collaris, Anilocra physodes, Nerocila bivittata and Ceratothoa italica were didn t show any K2P genetic distance. Whereas, the COI sequence showed the K2P genetic distance was from to among the four species. The overall K2P distance for 16S rrna in all the nine species was and for COI it was Based on 16S rrna sequence, the K2P genetic distance was high (1.214) between the gill attaching parasite, Pentidotea resecata and the skin parasite, Nerocila poruvae. When we compared the COI gene sequence among the parasites the K2P genetic distance was more (0.860) between the skin parasite, Nerocila orbignyi and the mouth dwelling parasite, Ceratothoa italic. Whereas, the genetic distance was very less (0.235), between the skin parasite, Joryma hilsae and the gill attaching parasite, Lironeca vulgaris. Tajima s statistics (D) = for 16S rrna sequence and (D) = for COI gene sequence it was not significantly (p<0.01) different among sequences (Table 3). 3
4 All the fifteen 16S rrna and sixteen COI gene sequences were subjected in the phylogenetic analysis. The neighbour joining tree (NJ) of K2P distance was created to provide a graphical representation of the patterning of divergence of nine isopod parasite species. As per 16S rdna based NJ tree, there are three distinct clades were recognized with high bootstrap value (Fig. 1). The first clad having 100% bootstrap value included both the mouth dwelling and skin parasites. The second clade having 92% bootstrap value included the gill attaching and skin parasites. The third clade having 99% bootstrap value includes only gill attaching parasites. Based on the COI gene data, there were no clear clades that get separated, the NJ tree having seven small clades with more than 50% bootstrap value (Fig. 2). These two mitochondrial genes partial sequences suggests monophyly of cymothoids, but no definitive conclusions can be drawn in this study and this may be due to limited species selection. A molecular phylogenetic framework in Cymothoid isopods was reported in an earlier study 4. Where, the tree topology showed the mouth dwelling parasites, Ceratothoa italica and Ceratothoa collaris are sister species to the skin parasite, Nerocila bivittata and Anilocra physodes but the genetic distance did not was not show any significant difference. In the present study, based on the 16S rrna sequence data, many of the gills attaching parasites were clustered in to one group. But in the case of COI gene sequence based NJ tree, there was no significant grouping topology observed. This may be due to the disparity of the evolutionary rate among the mitochondrial genes. Previous study 4 concluded that, due to the nature of habit, many morphological characters commonly used in isopod taxonomy (i.e. setation and external ridges etc) have been lost or greatly reduced and other important characters are highly variable or polymorphic. Earlier reports have identified that three major lineages belongs to the family Cymothoidae: Anilocrinae, Livonecinae and Cymothoinae 1,6. The separation of these lineages has until now been based on the fashion of attachment (skin, gill cavity and buccal cavity) 4. Bruce 7 also suggested that Cymothoid taxonomic arrangements still being based on the host and it may reflect convergence due to similar life-styles rather than true phylogenetic affinities. Our phylogenetic trees also strongly support Bruce s 7 suggestion. Same type of conclusion was given by a recent study 4, and they reported that a similar complex of parasitic strategies in Cymothoid isopods and indicate that gill and buccal parasitic habits evolved independently rather than by a direct phylogenetic link. The present study does not allow for a definitive and exhaustive 4
5 description of the evolution of the ecological diversity in this family. The use of more molecular markers can greatly improve taxonomic revisions of the Cymothoidae, and the present work to be a valuable first step towards this task. Acknowledgement Authors thank the Director and Dean, Faculty of Marine Sciences and the authorities of Annamalai University for their interest, encouragement and providing facilities during execution of this work. References 1 Brusca R C & Wilson G D F, A phylogenetic analysis of the Isopoda with some classificatory recommendations, Mem. Queensl. Mus., 31 (1991) Dreyer H & Wa gele J W, Parasites of crustaceans (Isopoda: Bopyridae) evolved from fish parasites: molecular and morphological evidence, Zoology, 103 (2001) Brandt A & Poore G C B, Higher classification of flabelliferan and related Isopoda based on a reappraisal of relationships, Invertebr. Syst., 17 (2003) Ketmaier A, Joyce D A, Horton T & Mariani S, A molecular phylogenetic framework for the evolution of parasitic strategies in cymothoid isopods (Crustacea), J. Zool. Syst. Evol. Res., 46(1) (2008) Ravichandran S, Rameshkumar G & Kumaravel K, Variation in the morphological features of Isopod fish parasites, W. J. Fish. Mar. Sci., 1(2) (2009) Brusca R C, A monograph on the Isopoda, Cymothoidae (Crustacea) of the Eastern Pacific, Zool. J. Linn. Soc., 73 (1981) Bruce N L, The genera Catoessa, Elthusa, Enispa, Ichthyoxenus, Idusa, Livoneca, and Norileca n. gen. (Isopoda: Cymothoidae), crustacean parasites of marine fishes, with descriptions of eastern Australian species, Rec. Aust. Mus., 42 (1990) Bruce N L, Australian species of Nerocila Leach, 1818, and Creniola n. gen. (Isopoda: Cymothoidae), crustacean parasites of marine fishes, Rec. Aust. Mus., 39 (1987) Horton T, Ceratothoa steindachneri (Isopoda: Cymothoidae) new to British waters with a key to north-east Atlantic and Mediterranean Ceratothoa, J. Mar. Biolog. Assoc. UK., 80 (2000) Avise J C, Molecular Markers, Natural History, and Evolution, 2nd edn. Sinauer, Sunderland Massachusetts, (2004)
6 11 Milinkovitch M C, Meyer A & Powell J R, Phylogeny of all major groups of cetaceans based on DNA sequences from three mitochondrial genes, Mol. Biol. Evol., 11(1994) Springer M S, Teeling E C, Madsen O, Stanhope M J & de Jong W W, Integrated fossil and molecular data reconstruct bat echolocation, Proc. Natl. Acad. Sci. USA., 98 (2001) Teeling E C, Madsen O, Van Den Bussche R A, de Jong W W, Stanhope M J & Springer M S, Microbat paraphyly and the convergent evolution of a key innovation in Old World rhinolophoid microbats, Proc. Natl. Acad. Sci. USA., 99 (2002) Danforth B N, Conway L & Li S, Phylogeny of eusocial Lasioglossum reveals multiple losses of eusociality within a primitively eusocial clade of bees (Hymenoptera: Halictidae), Syst. Biol., 52 (2003) Trilles J, Ravichandran S & Rameshkumar G, A checklist of the Cymothoidae (Crustacea, Isopoda) recorded from Indian fishes, Acta Parasitologica, 56 (2011) Sambrook J, Fritsch E F & Maniatis T, Molecular cloning: A laboratory manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. (1989) 17 Ward R D, Zemlac T C, Innes B H, Last P R & Hebert P D N, DNA barcoding Australia s fish species. Phil. Trans. Royal Soc. B., 360 (2005) Hall T A, BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT, Nuc Acids Symp. Ser., 41 (1999) Wetzer R, Mitochondrial genes and isopod phylogeny (Peracarida: Isopoda), J. Crustacean Biol., 22 (2002) Kimura M, A simple method of estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences, J. Mol. Evol., 16 (1980) Kumar S, Tamura K & Nei M, MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinfo., 5 (2004) Tamura K, Estimation of the number of nucleotide substitutions when there are strong transitiontransversion and G+C content biases, Mole. Biol.Evol., 9 (4) (1992)
7 Table 1- Cymothoid species details used in this study and sample size (n). GenBank Accession Species n habit 16S rdna COI Reference Nerocila longispina 1 Skin Submitted Submitted Present study Joryma hilsae 1 Skin Submitted Submitted Present study Nerocila poruvae 1 Skin Submitted Submitted Present study Nerocila orbignyi 1 Skin - Submitted Present study Ceratothoa collaris 1 Mouth EF EF Ketmaier et al. (2008) 4 Anilocra physodes 2 Skin EF EF Ketmaier et al. (2008) 4 Nerocila bivittata 1 Skin EF EF Ketmaier et al. (2008) 4 Ceratothoa italica 3 Mouth EF EF Ketmaier et al. (2008) 4 Olencira praegustator 1 Gill AF AF Wetzer (2002) 18 Lironeca vulgaris 1 Gill AF AF Wetzer (2002) 18 Pentidotea resecata 1 Gill AF AF Wetzer (2002) 18 Crenoicus buntiae 1 Gill AF AF Wetzer (2002) 18 Cirolana rugicauda 1 Gill AF AF Wetzer (2002) 18 Table 2- K2P distance of Cymothoid parasites based on 16S rrna (below diagonal) and COI gene sequence (above diagonal) Species C. c A. p N. b C. i O. p L. v P. r C. b C. r N. l J. h N. p N. o Ceratothoa collaris Anilocra physodes Nerocila bivittata Ceratothoa italica Olencira praegustator Lironeca vulgaris Pentidotea resecata Crenoicus buntiae Cirolana rugicauda **** **** **** **** **** **** **** **** ****
8 Nerocila longispina Joryma hilsae Nerocila poruvae **** **** **** Table 3. Tajima test statistics for the 16S rrna and COI gene sequence of Cymothoid parasites Gene m S p s Θ π D 16S rrna COI m = number of sequences, S = Number of segregating sites, p s = S/m, Θ = p s /a 1, π = nucleotide diversity, and D= Tajima statistic value Figur Leagend Fig. 1. Neigbour Joining (NJ) estimate of the phylogenetic relationships among Cymothoid taxa obtained based on mitochondrial 16S rrna sequences Fig. 2. Neigbour Joining (NJ) estimate of the phylogenetic relationships among Cymothoid taxa obtained based on mitochondrial COI gene sequences 8
MOLECULAR PHYLOGENETIC RELATIOSHIPS IN ROMANIAN CYPRINIDS BASED ON cox1 AND cox2 SEQUENCES
PROCEEDINGS OF THE BALKAN SCIENTIFIC CONFERENCE OF BIOLOGY IN PLOVDIV (BULGARIA) FROM 19 TH TILL 21 ST OF MAY 2005 (EDS B. GRUEV, M. NIKOLOVA AND A. DONEV), 2005 (P. 162 167) MOLECULAR PHYLOGENETIC RELATIOSHIPS
More informationGanapathy Rameshkumar, Mathan Ramesh & Samuthirapandian Ravichandran
New potential host for Ryukyua globosa (Crustacea, Isopoda, Cymothoidae) from Parangipettai, Southeast coast of India Ganapathy Rameshkumar, Mathan Ramesh & Samuthirapandian Ravichandran Journal of Parasitic
More informationGenome-scale approach proves that the lungfish-coelacanth sister group is the closest living
LETTERS Genome-scale approach proves that the lungfish-coelacanth sister group is the closest living relative of tetrapods with the BEST program Yunfeng Shan & Robin Gras, The origin of tetrapods has not
More informationMolecular insights into the phylogenetics of spiny lobsters of Gulf of Mannar marine biosphere reserve based on 28S rdna
Indian Journal of Biotechnology Vol 11, April 2012, pp 182-186 Molecular insights into the phylogenetics of spiny lobsters of Gulf of Mannar marine biosphere reserve based on 28S rdna P Suresh*, G Sasireka
More informationCichlids of East Africa A Model of Vertebrate Radiation. ww.waveformenergetics.com
Cichlids of East Africa A Model of Vertebrate Radiation ww.waveformenergetics.com www.wikipedia.com Lake Malawi 2-2020 million years old Fifth largest lake in the world by volume Bordered by Tanzania,
More informationBarcoding the Fishes of North America. Philip A. Hastings Scripps Institution of Oceanography University of California San Diego
Barcoding the Fishes of North America Philip A. Hastings Scripps Institution of Oceanography University of California San Diego With the possible exception of Europe and selected regional faunas such as
More informationLecture 2 Phylogenetics of Fishes. 1. Phylogenetic systematics. 2. General fish evolution. 3. Molecular systematics & Genetic approaches
Lecture 2 Phylogenetics of Fishes 1. Phylogenetic systematics 2. General fish evolution 3. Molecular systematics & Genetic approaches Charles Darwin & Alfred Russel Wallace All species are related through
More informationGenetic analysis of radio-tagged westslope cutthroat trout from St. Mary s River and Elk River. April 9, 2002
Genetic analysis of radio-tagged westslope cutthroat trout from St. Mary s River and Elk River April 9, 2002 Report prepared for: Angela Prince, M.Sc., R.P. Bio Westslope Fisheries 517 13 th Avenue South
More informationInternational Journal of Research in Zoology. Original Article
Available online at http://www.urpjournals.com International Journal of Research in Zoology Universal Research Publications. All rights reserved Original Article ISSN 2278 1358 Phylogeny and genetic divergence
More informationaV. Code(s) assigned:
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). Code(s) assigned: 2009.016aV (to be completed by ICTV
More informationSchaft Creek Project: Fisheries Baseline 2008 Addendum
Copper Fox Metals Inc. Schaft Creek Project: Fisheries Baseline 2008 Addendum Rescan Tahltan Environmental Consultants Sixth Floor - 1111 West Hastings Street Vancouver, BC Canada V6E 2J3 Tel: (604) 689-9460
More informationOccurrence of Parasitic Isopods Norileca indica on Some Carangid Fishes from the Upper Gulf of Thailand Jittikan Intamong 1 and Smarn Kaewviyudth 1
Occurrence of Parasitic Isopods Norileca indica on Some Carangid Fishes from the Upper Gulf of Thailand Jittikan Intamong 1 and Smarn Kaewviyudth 1 1 Department of Zoology, Faculty of Science, Kasetsart
More informationCharacterization of two microsatellite PCR multiplexes for high throughput. genotyping of the Caribbean spiny lobster, Panulirus argus
Characterization of two microsatellite PCR multiplexes for high throughput genotyping of the Caribbean spiny lobster, Panulirus argus Nathan K. Truelove 1, Richard F. Preziosi 1, Donald Behringer Jr 2,
More informationSystematics and Biodiversity of the Order Cypriniformes (Actinopterygii, Ostariophysi) A Tree of Life Initiative. NSF AToL Workshop 19 November 2004
Systematics and Biodiversity of the Order Cypriniformes (Actinopterygii, Ostariophysi) A Tree of Life Initiative NSF AToL Workshop 19 November 2004 Gloria Arratia Nevin Aspinwall Hank Bart Miles Coburn
More informationMolecular comparison of Clarias batrachus (Linnaeus, 1758) found in India with the species reported from Bangladesh
Journal of Biodiversity and Environmental Sciences (JBES) ISSN: 2220-6663 (Print) 2222-3045 (Online) Vol. 6, No. 5, p. 253-257, 2015 http://www.innspub.net RESEARCH PAPER OPEN ACCESS Molecular comparison
More informationValidation of Epinephelus coioides (Hamilton, 1822) occurrence along north-east coast of India
Indian Journal of Geo Marine Sciences Vol. 46 (02), February 2017, pp. 266-271 Validation of Epinephelus coioides (Hamilton, 1822) occurrence along north-east coast of India Shubhadeep Ghosh, Muktha M.,
More informationgeorgii (TELEOSTEI: ISTIOPHORIDAE):
BULLETIN OF MARINE SCIENCE, 79(3): 483 491, 2006 Validity, Identification, and Distribution of the Roundscale Spearfish, Tetrapturus georgii (TELEOSTEI: ISTIOPHORIDAE): Morphological and Molecular evidence
More informationwi Astuti, Hidayat Ashari, and Siti N. Prijono
Phylogenetic position of Psittacula parakeet bird from Enggano Island, Indonesia based on analyses of cytochrome b gene sequences. wi Astuti, Hidayat Ashari, and Siti N. Prijono Research Centre for Biology,
More informationRay-finned fishes (Actinopterygii)
Ray-finned fishes (Actinopterygii) Thomas J. Near a, * and Masaki Miya b a Department of Ecology and Evolutionary Biology & Peabody Museum of Natural History, Yale University, New Haven, CT 06520, USA;
More informationSupplementary file S1: Previous classification of Riodinidae
Supplementary file S: Previous classification of Riodinidae NEMEOBIINAE EUSELASIINAE MESOSEMIINI NEMEOBIINI ZEMERINI ABISARINI EUSELASIINI CORRACHIINI MESOSEMIINA NAPAEINA EURYBIINI RIODININAE HELICOPINI
More informationPhylogenetic analysis among Cyprinidae family using 16SrRNA
2014; 1(6): 66-71 ISSN: 2347-5129 IJFAS 2014; 1(6): 66-71 2013 IJFAS www.fisheriesjournal.com Received: 20-05-2014 Accepted: 02-06-2014 Utpala Sharma Varsha singhal Dayal P. Gupta Partha Sarathi Mohanty
More informationIndian Journal of Geo-Marine Science Vol.45 (7), July 2016, pp Received 19 February 2015; revised 17 June 2015
Indian Journal of Geo-Marine Science Vol.45 (7), July 2016, pp. 856-862 Maiden occurrence of the isopod, Norileca indica (H. Milne Edwards, 1840) in pelagic and demersal finfishes of Visakhapatnam waters
More informationEmployer Name: NOAA Fisheries, Northwest Fisheries Science Center
Internship Description Employer Name: NOAA Fisheries, Northwest Fisheries Science Center Employer Description: Manchester Research Station functions as a satellite facility to the NOAA Fisheries Northwest
More informationMitochondrial DNA analysis as a tool for family and species identification of fish larvae: Emphasis on Snappers.
Mitochondrial DNA analysis as a tool for family and species identification of fish larvae: Emphasis on Snappers. Áurea E. Rodríguez, Juan C. Martínez-Cruzado, Ernesto Otero, Jorge R. García-Sais and Jennie
More informationDiversity of Thermophilic Bacteria Isolated from Hot Springs
... 40(2) 524-533 (2555) KKU Sci. J. 40(2) 524-533 (2012) Diversity of Thermophilic Bacteria Isolated from Hot Springs ( 30, 3.65 x 10 5 1. x 10 3 CFU/ml (a, b, c, d, e f 16S rrna 1. kb Polymerase Chain
More informationBIODIVERSITY OF LAKE VICTORIA:
BIODIVERSITY OF LAKE VICTORIA:.. ITS CONSERVATION AND SUSTAINABLE USE [THE UGANDAN VERSION] Ogutu-Ohwayo, R. and Ndawula L. National Agricultural Research Organisation, Fisheries Resources Research Institute,
More informationStudies on Crustacean Parasites from Commercial Marine Fish Along the Andaman Coast in Comparison with Malabar Coast of Kerala of Indian EEZ
World Journal of Fish and Marine Sciences 8 (1): 47-53, 2016 ISSN 2078-4589 IDOSI Publications, 2016 DOI: 10.5829/idosi.wjfms.2016.8.1.10245 Studies on Crustacean Parasites from Commercial Marine Fish
More informationEctoparasites of Coral Reef Fishes and Their Value as Biological Indicators of Pollution
CAKALELE, VOL. 9 (1998): 25 29 The authors Ectoparasites of Coral Reef Fishes and Their Value as Biological Indicators of Pollution SHELLY M. PATTIPEILUHU UNIVERSITAS PATTIMURA MARGARET E. GILL UNIVERSITY
More informationSupplementary Material
10.1071/RD16455_AC CSIRO 2017 Supplementary Material: Reproduction, Fertility and Development, 2017, 29(12), 2376 2386. Supplementary Material The egg coat zona pellucida 3 glycoprotein evolution of its
More informationTaxonomic status of the black porgy, Acanthopagrus schlegelii (Perciformes: Sparidae) inferred from mitochondrial genes
African Journal of Biotechnology Vol. 11(25), pp. 6641-66446, 27 March, 2012 Available online at http://www.academicjournals.org/ajb DOI: 10.5897/AJB10.2521 ISSN 1684 5315 2012 Academic Journals Full Length
More informationHost parasite relationships: Mothocya plagulophora parasitizing Hemiramphus far in the Southeast coast of India
Host parasite relationships: Mothocya plagulophora parasitizing Hemiramphus far in the Southeast coast of India Ganapathy Rameshkumar, Mathan Ramesh, Samuthirapandian Ravichandran, Jean-Paul Trilles &
More informationMOLECULAR CHARACTERISATION AND PHYLOGENETICS OF MALAYSIAN GREEN AROWANA (Scleropages formosus) IN PENINSULAR MALAYSIA
First ASIAHORCs Joint Symposium 18-20 July 2009 Nagoya, Japan MOLECULAR CHARACTERISATION AND PHYLOGENETICS OF MALAYSIAN GREEN AROWANA (Scleropages formosus) IN PENINSULAR MALAYSIA M. Rizman-Idid 1, S.
More informationAnguilla marmorata (Giant Mottled Eel) Discovered in a New Location: Natural Range Expansion or Recent Human Introduction? 1
Anguilla marmorata (Giant Mottled Eel) Discovered in a New Location: Natural Range Expansion or Recent Human Introduction? 1 Alex Handler 2 and Shelley A. James 3 Abstract: Freshwater eels in the family
More informationBiogeographical Distribution and Phylogenetic Analysis of Simulium (Wallacellum) (Diptera: Simuliidae) Based on the Mitochondrial Sequences
South Pacific Studies Vol.35, No.2, 2015 Biogeographical Distribution and Phylogenetic Analysis of Simulium (Wallacellum) (Diptera: Simuliidae) Based on the Mitochondrial Sequences OTSUKA Yasushi 1 * and
More informationHybridization versus Randomly-Sorting Ancestral Alleles: Genetic Variation in Lake Malawi Cichlids
Hybridization versus Randomly-Sorting Ancestral Alleles: Genetic Variation in Lake Malawi Cichlids Meryl Mims Faculty Advisor: Professor Todd Streelman Undergraduate Honors Thesis, Spring 2007 Georgia
More informationRevision of Tasmanian viviparous velvet worms (Onychophora : Peripatopsidae) with descriptions of two new species
Invertebrate Systematics, 2018, 32, 909 932 doi:10.1071/is17096_ac CSIRO 2018 Supplementary material Revision of Tasmanian viviparous velvet worms (Onychophora : Peripatopsidae) with descriptions of two
More informationGenetic Relationship among the Korean Native and Alien Horses Estimated by Microsatellite Polymorphism
784 Genetic Relationship among the Korean Native and Alien Horses Estimated by Microsatellite Polymorphism G. J. Cho* College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Korea
More informationBRIEF COMMUNICATION Phylogenetic relationships within the genus Pimephales as inferred from ND4 and ND4L nucleotide sequences
Journal of Fish Biology (2002) 61, 293 297 doi:10.1006/jfbi.2002.2002, available online at http://www.idealibrary.com on BRIEF COMMUNICATION Phylogenetic relationships within the genus Pimephales as inferred
More informationEvolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the 28S ribosomal RNA gene
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 5449-5454, May 1996 Evolution Evolutionary relationships of the coelacanth, lungfishes, and tetrapods based on the ribosomal RNA gene (lobe-finned fishes/molecular
More informationPASTELARIA STUDIOS PUBLISHER
PASTELARIA STUDIOS PUBLISHER WWW.PASTELARIASTUDIOS.COM Email pastelariastudios@gmail.com Teresa Maria Queiroz Pastelaria Studios New Release March 2015 capa ISBN 978-989-8796-18-9 Book 40,00 Pvp 14.50
More informationGanapathy Rameshkumar, Mathan Ramesh, Samuthirapandian Ravichandran, Jean-Paul Trilles & Shunmugam Subbiah
New record of Norileca indica from the west coast of India Ganapathy Rameshkumar, Mathan Ramesh, Samuthirapandian Ravichandran, Jean-Paul Trilles & Shunmugam Subbiah Journal of Parasitic Diseases ISSN
More informationDaniel Schenck, Undergraduate Student, Dalhousie University
A Taxonomical Comparison of Riverine and Lacustrine Lamprologus and Shell Dwelling Neolamprologus Species, with Consideration of Morphological and Phylogenetic Classifications Daniel Schenck, Undergraduate
More informationNon commercial use only. Cytochrome oxidase-i. Pangasius hypophthalmus. sequence based studies of commercially available. in Italy PAPER.
Italian Journal of Animal Science 2015; volume 14:3928 PAPER Cytochrome oxidase-i sequence based studies of commercially available Pangasius hypophthalmus in Italy Federica Bellagamba, Dinesh Velayutham,
More informationNeglected Taxonomy of Rare Desert Fishes: Congruent Evidence for Two Species of Leatherside Chub
Syst. Biol. 53(6):841 855, 2004 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150490522557 Neglected Taxonomy of Rare Desert Fishes: Congruent
More informationEFFECT OF COLOR, SIZE, AND DENSITY
EFFECT OF COLOR, SIZE, AND DENSITY OF SARRACENIA PURPUREA ON PREY CAPTURE Megan M. Wallen ABSTRACT Our objective was to study physical characteristics of the purple pitcher plant (Sarracenia purpurea)
More informationSphyraena arabiansis a new species of barracuda (Family: Sphyraenidae) from the south-west coast of India
Indian J. Fish., 62(2): 1-6, 2015 1 Sphyraena arabiansis a new species of barracuda (Family: Sphyraenidae) from the south-west coast of India E. M. ABDUSSAMAD, T. B. RETHEESH, R. THANGARAJA, K. K. BINEESH
More informationTHE FRESHWATER CRUSTACEANS OF THE CENTRAL PLATEAU
95 ON THE FRESHWATER CRUSTACEANS OF THE CENTRAL PLATEAU by P.S. Lake and B. Knott Department of Zoology, University of Tasmania. Although the waters of the Central Plateau harbour a number of interesting
More informationSpecies Identification of small juvenile tunas caught in surface fisheries in the Phili... 1/13 ページ
Species Identification of small juvenile tunas caught in surface fisheries in the Phili... 1/13 ページ Originated by: Fisheries and Aquaculture Department Title: Status of Interactions of Pacific Tuna Fisheries
More informationEVIDENCE OF BLUE WHALE FEEDING IN THE PERTH CANYON, WESTERN AUSTRALIA
EVIDENCE OF BLUE WHALE FEEDING IN THE PERTH CANYON, WESTERN AUSTRALIA K. CURT.S. JENNER, Centre for Whale Research (Western Australia) Inc., PO Box 1622, Fremantle, WA 6959, Australia; STEVEN G. WILSON,
More informationThe correlation between saprobity and mitochondrial genes of indicator fish species based on molecular phylogeny
RESEARCH ARTICLE The correlation between saprobity and mitochondrial genes of indicator fish species based on molecular phylogeny Frolova Liudmila Leonidovna, Arthur M. Husainov, Antony E. Sverdrup Department
More informationSummary and Conclusion
Summary and Conclusion Members of the order Mysidacea are important component in marine and estuarine plankton inhabiting all regions of the oceans. There are many brackish water species and few species
More informationPhylogenetic relationships of twenty Gymnothorax species based on cytochrome b sequence data
Phylogenetic relationships of twenty Gymnothorax species based on cytochrome b sequence data M. Du 1, S.W. Yin 2 and B.Z. Niu 1 1 Key Lab for Quality, Efficient cultivation and Security Control of Crops
More informationSpecies concepts What are species?
What are species? 1 and definitions continue to be one of the most controversial topics in biology. A large number of alternative species concepts exist, each with its own strengths and limitations. Typological
More informationUse of DNA barcode in the identification of catfishes (Siluriformes: Ariidae) from Malaysia
B I O D I V E R S IT A S ISSN: 1412-033X Volume 18, Number 4, October 2017 E-ISSN: 208-4722 Pages: 138-1366 DOI: 10.1307/biodiv/d180411 Use of DNA barcode in the identification of catfishes (Siluriformes:
More informationMammals Grew 1,000 Times Larger After the Demise of the Dinosaurs
Mammals Grew 1,000 Times Larger After the Demise of the Dinosaurs The largest land mammals that ever lived, Indricotherium and Deinotherium, would have towered over the living African Elephant. Indricotherium
More informationSociety for Wildlife Forensic Science Develop Wildlife Forensic Science into a comprehensive, integrated and mature discipline.
Society for Wildlife Forensic Science Develop Wildlife Forensic Science into a comprehensive, integrated and mature discipline. Wildlife Genetics Proficiency Testing Program Test # 021716 Consensus Report
More informationRapid recent expansion of the round goby (Neogobius melanostomus) and the western tubenose goby (Proterorhinus semilunaris) in Flanders (Belgium)
Rapid recent expansion of the round goby (Neogobius melanostomus) and the western tubenose goby (Proterorhinus semilunaris) in Flanders (Belgium) Hugo Verreycken, Jan Ostermeyer, Merlijn Mombaerts, Tine
More informationApplication of DNA Barcoding Techniques For Speciation
Application of DNA Barcoding Techniques For Speciation Bruno J. Giri US Department of Agriculture Office of Public Health Science 1 Objectives Background of catfish speciation Background of DNA barcoding
More informationDNA approaches to marine wildlife fishery monitoring and law enforcement. Mahmood S. Shivji
DNA approaches to marine wildlife fishery monitoring and law enforcement Mahmood S. Shivji Presentation given at FIU Forensics Workshop - July 26, 2010 Major forensics questions for marine wildlife 1.
More informationDescriptions and ecological notes of free swimming forms of cymothoid isopods (Crustacea: Peracarida) collected in two coastal waters of Japan
CRUSTACEAN RESEARCH, NO. 43: 1 16, 2014 Descriptions and ecological notes of free swimming forms of cymothoid isopods (Crustacea: Peracarida) collected in two coastal waters of Japan Nobuhiro Saito, Takeo
More informationSongklanakarin J. Sci. Technol. 38 (4), , Jul. - Aug Original Article. Ngoc-Tran Thi Nguyen and Thuy-Yen Duong*
Songklanakarin J. Sci. Technol. 38 (4), 427-434, Jul. - Aug. 2016 http://www.sjst.psu.ac.th Original Article Morphological and genetic differences between cultured and wild populations of Channa striata
More informationCutthroat trout genetics: Exploring the heritage of Colorado s state fish
Cutthroat trout genetics: Exploring the heritage of Colorado s state fish Metcalf et al. 2007 Molecular Ecology Metcalf et al. 2007 From Metcalf et al. 2007 But what about this one? Metcalf et al. 2007
More informationINTRODUCTION TO PATTERN RECOGNITION
INTRODUCTION TO PATTERN RECOGNITION 3 Introduction Our ability to recognize a face, to understand spoken words, to read handwritten characters all these abilities belong to the complex processes of pattern
More informationFor IEC use only. Technical Committee TC3: Information structures, documentation and graphical symbols
For IEC use only 3/686/INF 2003-08 INTERNATIONAL ELECTROTECHNICAL COMMISSION Technical Committee TC3: Information structures, documentation and graphical symbols Labels to be used in database standards
More informationMatthew Alan Bertone
Matthew Alan Bertone HOME: 109 Dunnsbee Drive - Garner, NC 27529 - phone: 919.210.9857 OFFICE: North Carolina State University - Campus Box 7613 - Raleigh, NC 27695 phone: 919.515.3429 - fax: 919.515.7746
More information8 Studying Hominids In ac t i v i t y 5, Using Fossil Evidence to Investigate Whale Evolution, you
8 Studying Hominids In ac t i v i t y 5, Using Fossil Evidence to Investigate Whale Evolution, you were working with evidence for the evolution of the whale lineage. A lineage is a series of populations
More information16S rrna Gene Sequence Analysis of Snow Leopard, Gray Wolf, Horse and Bactrian Camel in Mongolia
Journal of Agricultural Science and Technology A 7 (2017) 350-356 doi: 10.17265/2161-6256/2017.05.007 D DAVID PUBLISHING 16S rrna Gene Sequence Analysis of Snow Leopard, Gray Wolf, Horse Munkhtuul Tsogtgerel
More informationVersion: 1.0 Last amendment: 16/01/2012. Contact Officer: Animal Welfare Officer
CDU AEC Policy on the Collection of Voucher Specimens : 1.0 Last amendment: 16/01/2012 Contact Officer: Animal Welfare Officer Approved By: CDU AEC Date: January 2012 Next Review: January 2014 INTRODUCTION
More informationREVISION OF THE WPTT PROGRAM OF WORK
REVISION OF THE WPTT PROGRAM OF WORK IOTC 2016 WPTT18 08 Rev 1 PREPARED BY: IOTC SECRETARIAT 1, 3 OCTOBER 2016 PURPOSE To ensure that the participants at the 18 th Working Party on Tropical Tunas (WPTT18)
More information1 ^ site s of native and exotic freshw ater fishes in the south-w est ol W estern Australia / M arina Hassan.
PDF processed with CutePDF evaluation edition www.cutepdf.com o '-'-c sr 1I000767S0 Peroustakaan Sultanah Nur Zahirah (UMT) Universiti Malaysia Terengganu 1100076780 1 ^ site s of native and exotic freshw
More informationAncient Species Flocks and Recent Speciation Events: What Can Rockfish Teach Us About Cichlids (and Vice Versa)?
J Mol Evol (1999) 49:814 818 Springer-Verlag New York Inc. 1999 Letters to the Editor Ancient Species Flocks and Recent Speciation Events: What Can Rockfish Teach Us About Cichlids (and Vice Versa)? Stian
More informationTHE subgenus Notropis is an ecologically diverse
Copeia, 2(3), pp. 656 667 Phylogenetic Relationships of Cyprinid Fishes in Subgenus Notropis Inferred from Nucleotide Sequences of the Mitochondrially Encoded Cytochrome b Gene JOSEPH P. BIELAWSKI AND
More informationsubmitted: fall 2009
Cat Project of the Month April 2010 The IUCN/SSC Cat Specialist Group's website (www.catsg.org) presents each month a different cat conservation project. Members of the Cat Specialist Group are encouraged
More informationTeleosts: Evolutionary Development, Diversity And Behavioral Ecology (Fish, Fishing And Fisheries) READ ONLINE
Teleosts: Evolutionary Development, Diversity And Behavioral Ecology (Fish, Fishing And Fisheries) READ ONLINE If searched for a ebook Teleosts: Evolutionary Development, Diversity and Behavioral Ecology
More informationSupplemental figure 1. Collection sites and numbers of strains sequenced.
Supplemental figure 1. Collection sites and numbers of strains sequenced. Supplemental figure 2. Neighbor joining 16S rrna gene phylogeny (636 bp). Minimum bootstrap values >50% generated using NJ and
More informationTotal Evidence: Molecules, Morphology, and the Phylogenetics of Cichlid Fishes
76 JOURNAL OF I.P. EXPERIMENTAL FARIAS ET AL. ZOOLOGY (MOL DEV EVOL) 288:76 92 (2000) Total Evidence: Molecules, Morphology, and the Phylogenetics of Cichlid Fishes IZENI P. FARIAS, 1,2 GUILLERMO ORTÍ,
More informationIou.. o MOLECULAR IEVOLUTION
J Mol Evol (1995) 41:180-188 Iou.. o MOLECULAR IEVOLUTION Springer-Vedag New York Inc. 1995 Mitochondrial DNA Sequences of Various Species of the Genus Equus with Special Reference to the Phylogenetic
More informationContinued Genetic Monitoring of the Kootenai Tribe of Idaho White Sturgeon Conservation Aquaculture Program
Continued Genetic Monitoring of the Kootenai Tribe of Idaho White Sturgeon Conservation Aquaculture Program Deliverable 1): Monitoring of Kootenai River white sturgeon genetic diversity Deliverable 2):
More informationPapers from the Conference on the Biology and Evolution of Crustacea
AUSTRALIAN MUSEUM MEMOIR 18 Papers from the Conference on the Biology and Evolution of Crustacea HELD AT THE AUSTRALIAN MUSEUM SYDNEY, 1980 Edited by JAMES K. LOWRY The Australian Museum, Sydney Published
More informationUsing edna to Understand Changes in Aquatic Biodiversity Above and Below a Barrier
University of Massachusetts Amherst ScholarWorks@UMass Amherst International Conference on Engineering and Ecohydrology for Fish Passage International Conference on Engineering and Ecohydrology for Fish
More informationJournal of Molecular Evolution
J Mol Evol (1992) 35:102-113 Journal of Molecular Evolution @ Springer-Verlag New York Inc. 1992 Molecules, Fossils, and the Origin of Tetrapods Axel Meyer and Sarah I. Dolven Department of Ecology and
More informationMALAWI CICHLIDS SARAH ROBBINS BSCI462 SPRING 2013
MALAWI CICHLIDS SARAH ROBBINS BSCI462 SPRING 2013 CICHLIDS Family of fish within the infraclass Teleostei Over 1600 species discovered, Up to 3000 species predicted Most commonly found in Africa and South
More informationPhylogenetic relationships of the lancelets of the genus Branchiostoma in China inferred from mitochondrial genome analysis
African Journal of Biotechnology Vol. 7 (21), pp. 3845-3852, 5 November, 2008 Available online at http://www.academicjournals.org/ajb ISSN 1684 5315 2008 Academic Journals Full Length Research Paper Phylogenetic
More informationDeep-Sea Research II
Deep-Sea Research II 57 (2010) 2110 2129 Contents lists available at ScienceDirect Deep-Sea Research II journal homepage: www.elsevier.com/locate/dsr2 Integrated molecular and morphological biogeography
More informationSCHOOLING BEHAVIOR OF HAEMULON SPP. IN BERMUDA REEFS AND SEAGRASS BEDS
SCHOOLING BEHAVIOR OF HAEMULON SPP. IN BERMUDA REEFS AND SEAGRASS BEDS Hillary, Department of Biology,, Worcester, MA 01610 (hisullivan@clarku.edu) Abstract Schooling behavior is common among many different
More informationSize and spatial distribution of the blue shark, Prionace glauca, caught by Taiwanese large-scale. longline fishery in the North Pacific Ocean
1 ISC/16/SHARKWG-1/21 Size and spatial distribution of the blue shark, Prionace glauca, caught by Taiwanese large-scale longline fishery in the North Pacific Ocean Kwang-Ming Liu 1,2, Kuang-Yu Su 1,2,
More informationBRIEF COMMUNICATION The exotic American eel in Taiwan: ecological implications
Journal of Fish Biology (2002) 60, 1608 1612 doi:10.6/jfbi.2002.2022, available online at http://www.idealibrary.com on BRIEF COMMUNICATION The exotic American eel in Taiwan: ecological implications Y.-S.
More informationSEA GRANT PROGRESS REPORT
SEA GRANT PROGRESS REPORT Project Title: The relationship between seasonal migrations of berried female lobster Homarus americanus, egg development and larval survival. Principal Investigator: Winsor H.
More informationLesson 27. Objectives: At the end of this lesson you should be able to:
Lesson 27 Lesson Outline: Evolution of Respiratory Mechanisms Cutaneous Exchange Evolution of Respiratory Mechanisms - Water Breathers o Origin of pharyngeal slits from corner of mouth o Origin of skeletal
More informationPhylogenetic relationship of the genus Oncorhynchus species inferred from nuclear and mitochondrial markers
Genes Genet. Syst. (1997) 72, p. 25 34 Phylogenetic relationship of the genus Oncorhynchus species inferred from nuclear and mitochondrial markers Takashi Kitano 1,2, Norimasa Matsuoka 1, *, and Naruya
More informationGenetic Diversity of Chinese Indigenous Pig Breeds in Shandong Province Using Microsatellite Markers*
28 Asian-Aust. J. Anim. Sci. Vol. 24, No. 1 : 28-36 January 2011 www.ajas.info Genetic Diversity of Chinese Indigenous Pig Breeds in Shandong Province Using Microsatellite Markers* J. Y. Wang 1,2, J. F.
More informationTHE DIVERSITY OF FISHES
Gene S. Helfman Bruce B. Collette Douglas E. Facey Brian W. Bowen Second Edition THE DIVERSITY OF FISHES Biology, Evolution, and WILEY-BLACKWELL A John Wiley & Sons, Ltd., Publication Brief contents Full
More informationMolecular Phylogenetics and Ecological Diversification of the Transisthmian Fish Genus Centropomus (Perciformes: Centropomidae)
Molecular Phylogenetics and Evolution Vol. 13, No. 1, October, pp. 193 207, 1999 Article ID mpev.1999.0624, available online at http://www.idealibrary.com on Molecular Phylogenetics and Ecological Diversification
More informationMorphological and Molecular Identification of species of Catfish Genus Cranoglanis from Lam River, Nghe an, Vietnam
ISSN No. (Print): 075-10 ISSN No. (Online): 4- Morphological and Molecular Identification of species of Catfish Genus Cranoglanis from am River, Nghe an, Vietnam Nguyen Dinh Vinh *, Tran Thi Thuy Ha **,
More informationThe extraordinary number of species of cichlid fishes (Teleostei:
Colloquium On the origin of Lake Malawi cichlid species: A population genetic analysis of divergence Yong-Jin Won*, Arjun Sivasundar, Yong Wang, and Jody Hey Department of Genetics, Rutgers, The State
More informationGENETIC DIAGNOSIS AND REPRODUCTIVE BIOLOGY OF INTRODUCED MYSTACOLEUCUS MARGINATUS IN THE TOBA LAKE, NORTH SUMATRA
Available online at: http://ejournal-balitbang.kkp.go.id/index.php/ifrj e-mail:ifrj.puslitbangkan@gmail.com INDONESIANFISHERIESRESEARCHJOURNAL Volume 24 Nomor 1 June 2018 p-issn: 0853-8980 e-issn: 2502-6569
More informationMolecular phylogeny of the Romanian cyprinids from the Danube River
Roumanian Biotechnological Letters Vol. 13, No. 5, 2008, pp. 3970 3975 Copyright 2008 Bucharest University Printed in Romania. All rights reserved Roumanian Society of Biological Sciences ORIGINAL PAPER
More informationCHAPTER III RESULTS. sampled from 22 streams, representing 4 major river drainages in New Jersey, and 1 trout
CHAPTER III RESULTS Genetic Diversity Genotypes at 13 microsatellite DNA loci were determined for 238 brook trout sampled from 22 streams, representing 4 major river drainages in New Jersey, and 1 trout
More informationFirst report of the Taiwan sardinella Sardinella hualiensis (Clupeiformes: Clupeidae) in the Philippines
Journal of Fish Biology (2011) 79, 2087 2094 doi:10.1111/j.1095-8649.2011.03133.x, available online at wileyonlinelibrary.com First report of the Taiwan sardinella Sardinella hualiensis (Clupeiformes:
More informationThe transition from life in water to life on land
Molecular Phylogenetic Information on the Identity of the Closest Living Relative(s) of Land Vertebrates Rafael Zardoya 1 and Axel Meyer 2 Department of Ecology and Evolution and Program in Genetics, State
More information