Supplemental figure 1. Collection sites and numbers of strains sequenced.
|
|
- Whitney Bruce
- 6 years ago
- Views:
Transcription
1 Supplemental figure 1. Collection sites and numbers of strains sequenced.
2 Supplemental figure 2. Neighbor joining 16S rrna gene phylogeny (636 bp). Minimum bootstrap values >50% generated using NJ and ML methods are shown. Species names are followed by 16S sequence type, country of origin, and the strain identifier. = 100% bootstrap support > 80% bootstrap support > 50% bootstrap support S. pacifica A, CNS-801 S. pacifica A, CNT-148 S. pacifica D, CNT-084 S. pacifica, CNT-037 S. pacifica F, CNT-029 S. pacifica C, CNS-863 S. pacifica C, CNT-045 S. pacifica C, CNT-094 S. pacifica C, CNT-138 S. pacifica B, CNT-150 S. pacifica B, CNS-237 S. tropica, CNB-392 S. tropica, CNB-440 S. tropica, CNB-476 S. tropica, CNB-536 S. tropica, CNH-898 S. tropica, CNS-193 S. tropica, CNS-197 S. tropica, CNS-416 S. tropica, CNT-254 S. tropica, CNT-253 S. tropica, CNT-257 S. tropica, CNT-280 S. arenicola B, CNP-152 S. arenicola B, CNH-964 S. arenicola, CNT-088 S. arenicola, CNT-137 S. arenicola, CNT-086 S. arenicola, CNS-992 S. arenicola, CNS-991 S. arenicola, CNB-458 S. arenicola, CNB-527 S. arenicola, CNH-643 S. arenicola, CNS-205 S. arenicola, CNS-673 S. arenicola, CNS-744 S. arenicola, CNS-759 S. arenicola, CNS-803 S. arenicola, CNS-820 S. arenicola, CNS-823 Polymorphospora sp. YIM (NR_044592) Actinaurispora siamensis CM2-8 (AB454379) Verrucosispora maris (NC_ ) Micromonospora aurantiaca ATCC (PRJNA42501) Micromonospora sp. L5 (PRJNA45895) Streptomyces griseus strain 45H (EF571002) 0.01
3 Supplemental figure 3. Neighbor joining atpd gene phylogeny (732 bp). Minimum bootstrap values >50% generated using NJ and ML methods are shown. = 100% bootstrap support > 80% bootstrap support > 50% bootstrap support S. tropica, CNS-193 S. tropica, CNT-257 S. tropica, CNS-416 S. tropica, CNB-392 S. tropica, CNT-280 S. tropica, CNT-253 S. tropica, CNB-440 S. tropica, CNS-197 S. tropica, CNT-254 S. tropica, CNB-536 S. tropica, CNH-898 S. tropica, CNB-476 S. pacifica B, CNS-237 S. pacifica B, CNT-150 S. pacifica A, CNS-801 S. pacifica A, CNT-148 S. pacifica D, CNT-084 S. pacifica, CNT-037 S. pacifica C, CNT-094 S. pacifica F, CNT-029 S. pacifica E, CNT-138 S. pacifica C, CNT-045 S. pacifica C, CNS-863 S. arenicola, CNB-527 S. arenicola, CNB-458 S. arenicola B, CNP-152 S. arenicola B, CNH-964 S. arenicola, CNS-992 S. arenicola, CNH-643 S. arenicola, CNS-803 S. arenicola, CNS-991 S. arenicola, CNS-673 S. arenicola, CNS-205 S. arenicola, CNS-744 S. arenicola, CNS-820 S. arenicola, CNS-823 S. arenicola, CNT-086 S. arenicola, CNS-759 S. arenicola, CNT-088 S. arenicola, CNT-137 Micromonospora sp. L5 (PRJNA45895) Micromonospora aurantiaca ATCC (PRJNA42501) Nakamurella multipartita DSM (NC_013235) Geodermatophilus obscurus DSM (NC_013757) Streptomyces flavogriseus ATCC (NC_016114) 0.02
4 Supplemental figure 4. Neighbor joining gyrb gene phylogeny (696 bp). Minimum bootstrap values >50% generated using NJ and ML methods are shown. = 100% bootstrap support > 80% bootstrap support > 50% bootstrap support S. pacifica A, CNS-801 S. pacifica A, CNT-148 S. pacifica, CNT-037 S. pacifica D, CNT-084 S. pacifica E, CNT-138 S. pacifica F, CNT-029 S. pacifica C, CNT-045 S. pacifica C, CNT-094 S. pacifica C, CNS-863 S. pacifica B, CNT-150 S. pacifica B, CNS-237 S. tropica, CNT-253 S. tropica, CNT-254 S. tropica, CNT-280 S. tropica, CNS-197 S. tropica, CNB-392 S. tropica, CNS-416 S. tropica, CNB-476 S. tropica, CNS-193 S. tropica, CNT-257 S. tropica, CNH-898 S. tropica, CNB-440 S. tropica, CNB-536 S. arenicola, CNB-527 S. arenicola, CNB-458 S. arenicola, CNT-088 S. arenicola, CNS-803 S. arenicola, CNS-759 S. arenicola, CNS-823 S. arenicola, CNS-673 S. arenicola, CNT-086 S. arenicola, CNH-643 S. arenicola, CNT-137 S. arenicola, CNS-205 S. arenicola, CNS-820 S. arenicola, CNS-992 S. arenicola, CNS-991 S. arenicola, CNS-744 S. arenicola B, CNP152 S. arenicola B, CNH964 Verrucosispora sediminis MS426 (HQ199220) Micromonospora halophytica IFO14112 (AB014157) Micromonospora sp. L5 (PRJNA45895) Micromonospora aurantiaca IFO16125 (AB014160) Micromonospora aurantiaca ATCC27029 (PRJNA42501) Micromonospora carbonacea (BAA89725) Micromonospora olivasterospora IFO14304 (AB014159) Micromonospora echinospora IFO16070 (AB014153) Micromonospora echinospora IFO13150 (AB014160) Dactylosporangium matsuzakiense ATCC (AB014104) 0.02
5 Supplemental figure 5. Neighbor joining reca gene phylogeny (708 bp). Minimum bootstrap values >50% generated using NJ and ML methods are shown. = 100% bootstrap support > 80% bootstrap support > 50% bootstrap support S. pacifica D, CNT-084 S. pacifica, CNT-037 S. pacifica B, CNT-150 S. pacifica B, CNS-237 S. pacifica A, CNT-148 S. pacifica A, CNS-801 S. pacifica, CNT-094 S. pacifica, CNT-138 S. pacifica, CNT-029 S. pacifica, CNT-045 S. pacifica, CNS-863 S. tropica, CNT-280 S. tropica, CNB-536 S. tropica, CNT-254 S. tropica, CNB-440 S. tropica, CNS-197 S. tropica, CNH-898 S. tropica, CNB-476 S. tropica, CNT-257 S. tropica, CNS-193 S. tropica, CNS-416 S. tropica, CNT-253 S. tropica, CNB-392 S. arenicola, CNB-527 S. arenicola, CNB-458 S. arenicola, CNT-137 S. arenicola, CNS-673 S. arenicola, CNS-820 S. arenicola, CNS-759 S. arenicola, CNT-086 S. arenicola, CNT-088 S. arenicola B, CNH-964 S. arenicola B, CNP-152 S. arenicola, CNS-991 S. arenicola, CNH-643 S. arenicola, CNS-823 S. arenicola, CNS-992 S. arenicola, CNS-744 S. arenicola, CNS-205 S. arenicola, CNS-803 Micromonospora. L5 (PRJNA45895) Micromonospora aurantiaca ATCC (PRJNA42501) Actinosynnema mirum DSM (NC_013093) Streptomyces argillaceus ATCC (DQ234054) 0.02
6 Supplemental figure 6. Neighbor joining trpb gene phylogeny (558 bp). Minimum bootstrap values >50% generated using NJ and ML methods are shown. = 100% bootstrap support > 80% bootstrap support > 50% bootstrap support S. pacifica, CNT-037 S. pacifica D, CNT-084 S. pacifica A, CNS-801 S. pacifica A, CNT-148 S. pacifica B, CNS-237 S. pacifica B, CNT-150 S. pacifica C, CNT-094 S. pacifica E, CNT-138 S. pacifica F, CNT-029 S. pacifica C, CNT-045 S. pacifica C, CNS-863 S. tropica, CNH-898 S. tropica, CNT-253 S. tropica, CNS-416 S. tropica, CNB-476 S. tropica, CNT-257 S. tropica, CNT-254 S. tropica, CNT-280 S. tropica, CNS-197 S. tropica, CNB-392 S. tropica, CNS-193 S. tropica, CNB-440 S. tropica, CNB-536 S. arenicola, CNB-527 S. arenicola, CNB-458 S. arenicola B, CNP-152 S. arenicola B, CNH-964 S. arenicola, CNH-643 S. arenicola, CNT-137 S. arenicola, CNS-673 S. arenicola, CNS-759 S. arenicola, CNS-992 S. arenicola, CNT-086 S. arenicola, CNS-820 S. arenicola, CNT-088 S. arenicola, CNS-991 S. arenicola, CNS-744 S. arenicola, CNS-205 S. arenicola, CNS-823 S. arenicola, CNS-803 Micromonospora sp. L5 (PRJNA45895) Micromonospora aurantiaca ATCC (PRJNA42501) Kribbella flavida DSM17836 (CP001736) Clavibacter michiganensis subsp. sepedonicus NCPPB 382 (NC_009480) Amycolatopsis mediterranei U32 (NC_104318) 0.02
7 Supplemental figure 7. Neighbor joining rpob 3 gene phylogeny. Minimum bootstrap values >50% generated using NJ and ML methods are shown. = 100% bootstrap support > 80% bootstrap support > 50% bootstrap support S. pacifica, CNT-037 S. pacifica D, CNT-084 S. pacifica A, CNT-148 S. pacifica A, CNS-801 S. pacifica B, CNT-150 S. pacifica B, CNS-237 S. pacifica C, CNT-094 S. pacifica E, CNT-138 S. pacifica F, CNT-029 S. pacifica C, CNT-045 S. pacifica C, CNS-863 S. tropica CNH-898 S. tropica CNS-193 S. tropica CNB-476 S. tropica CNB-392 S. tropica CNT-280 S. tropica CNT-257 S. tropica CNS-416 S. tropica CNT-254 S. tropica CNB-440 S. tropica CNT-253 S. tropica CNS-197 S. tropica CNB-536 S. arenicola CNB-527 S. arenicola CNB-458 S. arenicola CNT-088 S. arenicola CNS-820 S. arenicola CNT-137 S. arenicola CNS-744 S. arenicola CNT-086 S. arenicola CNS-205 S. arenicola CNS-823 S. arenicola CNS-759 S. arenicola CNS-673 S. arenicola CNS-991 S. arenicola CNS-992 S. arenicola CNS-803 S. arenicola CNH-643 S. arenicola B, CNP-152 S. arenicola B, CNH-964 Micromonospora aurantiaca ATCC Micromonospora sp. L5 0.01
8 Supplemental Table 1. PCR primers and conditions. All reactions included 2 µl genomic DNA template ( ng), 4 µl 10X PCR buffer, 4 µl of MgCl 2 (25 mm), 0.5 µl of each primer (25 mm), 1.6 µl dntp mix (10 mm), 5U Taq DNA polymerase, 2.4 µl DMSO, and 23.6 µl sterile MilliQ water. The initial denaturation was at 94 C for 10 min followed by 35 cycles of 94 C for 1min, annealing temperatures listed below followed by a 1 min elongation step at 72 C and a final extension step at 72 C for 7 min. Gene Primer name Primer sequence (5'-3') Annealing temp ( C) *modified from (3) Amplicon size (bp) 1. McVeigh HP, Munro J, Embley TM Molecular evidence for the presence of novel actinomycete lineages in a temperate forest soil. Journal of Industrial Microbiology 17: Freel KC, Edlund A, Jensen PR Microdiversity and evidence for high dispersal rates in the marine actinomycete Salinispora pacifica. Environmental Microbiology 14: Guo YP, Zheng W, Rong XY, Huang Y A multilocus phylogeny of the Streptomyces griseus 16S rrna gene clade: use of multilocus sequence analysis for streptomycete systematics. International Journal of Systematic and Evolutionary Microbiology 58: Reference 16S FC27 CCGCGGCTGCTGGCACGTA (1) rrna RC1492 GTGCGGGCCCCCGTCAATT atpd atpd_af GTGGGYGACACGGTCAAGGGSCACGTGTTCAACGCG this study* atpd_ar GTTGAACTGCTCYGCYGCYTAGGTGTTCTGCGACAGGAA trpb trpb_af GCGGGAGGACCTCAACCACACYGGGGCGCACAAGGTGCG this study* trpb_ar TCTCGATCGCGGGGATGATSCCCTCGGTBCGYCAGAGCAY gyrb 7G_gyrB_F GTICGYAWVCGICCSGGHATGTAC this study 7G_gyrB_R CCGTCVACRTCRGCRTCSGCCATS gyrb_tpf CGACGAGGGCGACGATGGCAAGAT this study gyrb_tpr GGATRCCGGTGCCGAGCG reca reca_af TTGCTCTCGCTCAGATCGACAAACAGTTC (2) reca_ar GCCACGTCCGGGTTCTCCCGAAGGAACTCGCG rpob (2) rpob_pf GAGCGCATGACCACCCAGGACGTCGAGGC (3) rpob_pr CCTCGTAGTTGTGACCCTCCCACGGCATGA rpob (3) rpob (N) rpob_f2226 rpob_r3122 rpob_nf GAACGTCAGCGAGGAGATGCT AGCACTCCATCTCACCGAAG CTGGCTGGTCGGCAACGAGG this study this study rpob_nr CTCCATCCGGGACAGGCCGA rifk rif_f1247 GCGGCAGGGTGAGTGTTC (1) rif_r1247 CACCGTGCTGTCCGAAGG
9 Supplemental Table 2. Sequence lengths and accession numbers. Species (ST) Strain Number Collection Location rpob 1 (540 bp) rpob 2 (780 bp) rpob 3 (720 bp) trpb (558 bp) reca (708 bp) atpd (732 bp) gyrb (696 bp) 16S rrna (636 bp) S. tropica CNB-392 BA JQ JQ JX JN JN JN JQ JN S. tropica CNB-440 BA JQ JQ JX JN JN JN DQ AY S. tropica CNB-476 BA JQ JQ JX JN JN JN JQ JN S. tropica CNB-536 BA JQ JQ JX JN JN JN DQ AY S. tropica CNH-898 BA JQ JQ JX JN JN JN DQ AY S. tropica CNS-193 BA JQ JQ JX JN JN JN JQ JN S. tropica CNS-197 BA JQ JQ JX JN JN JN JQ JN S. tropica CNS-416 BA JQ JQ JX JN JN JN JQ JN S. tropica CNT-253 BA JQ JQ JX JN JN JN JQ JN S. tropica CNT-254 BA JQ JQ JX JN JN JN JQ JN S. tropica CNS-257 BA JQ JQ JX JN JN JN JQ JN S. tropica CNS-280 BA JQ JQ JX JN JN JN JQ JN S. arenicola CNB-458 BA JQ JQ JX JN JN JN JQ JN S. arenicola CNB-527 BA JQ JQ JX JN JN JN JQ JN S. arenicola CNH-643 BA JQ JQ JX JN JN JN DQ AY S. arenicola CNS-205 PL JQ JQ JX JN JN JN JQ CP S. arenicola CNS-673 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNS-744 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNS-759 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNS-803 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNS-820 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNS-823 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNS-991 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNS-992 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNT-086 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNT-088 FJ JQ JQ JX JN JN JN JQ JN S. arenicola CNT-137 FJ JQ JQ JX JN JN JN JQ JN S. arenicola (B) CNH-941 SC JQ JQ JX JN JN JN JX JX S. arenicola (A) CNH-996 SC JQ JQ JX JN JN JN JQ JN S. arenicola (B) CNH-964 SC JQ JQ JX JN JN JN DQ AY S. arenicola (B) CNP152 SC JQ JQ JX JN JN JN DQ JN S. pacifica (A) CNS-055 PL JQ JQ JX JN JN JN DQ DQ S. pacifica CNS-143 PL JQ JQ JX JN JN JN DQ JN S. pacifica (B) CNS-237 PL JQ JQ JX JN JN JN JN HQ S. pacifica CNS-801 FJ JQ JQ JX JN JN JN JQ JN S. pacifica (C) CNS-861 FJ JQ JQ JX JN JN JN JQ JN S. pacifica (C) CNS-863 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica (F) CNT-029 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica CNT-037 FJ JQ JQ JX JN JN JN JQ JN S. pacifica (C) CNT-045 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica (D) CNT-084 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica CNT-087 FJ JQ JQ JX JN JN JN JQ JN S. pacifica (C) CNT-094 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica CNT-131 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica (D) CNT-133 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica (E) CNT-138 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica (A) CNT-148 FJ JQ JQ JX JN JN JN JQ HQ S. pacifica (B) CNT-150 FJ JQ JQ JX JN JN JN JQ HQ642900
10 Supplemental Table 3. Coordinates for all loci as observed in the S. arenicola and S. tropica genome sequences. 16S atpd trpb gyrb reca rpob S. arenicola CNS-205 (CP000850) S. tropica CNB-440 (NC_009380) Start coordinate End coordinate Locus tag Start coordinate End coordinate (1) (2) (3) (1) (2) (3) (1) Sare_R0005 (2) Sare_R0030 (3) Sare_R0045 (1) (2) (3) (1) (2) (3) Locus tag (1) Strop_R0005 (2) Strop_R0031 (3) Strop_R Sare_4012 Sare_3396 Sare_0007 Sare_1389 Sare_ Strop_3630 Strop_0678 Strop_0004 Strop_1425 Strop_3933
Diversity of Thermophilic Bacteria Isolated from Hot Springs
... 40(2) 524-533 (2555) KKU Sci. J. 40(2) 524-533 (2012) Diversity of Thermophilic Bacteria Isolated from Hot Springs ( 30, 3.65 x 10 5 1. x 10 3 CFU/ml (a, b, c, d, e f 16S rrna 1. kb Polymerase Chain
More informationGenetic analysis of radio-tagged westslope cutthroat trout from St. Mary s River and Elk River. April 9, 2002
Genetic analysis of radio-tagged westslope cutthroat trout from St. Mary s River and Elk River April 9, 2002 Report prepared for: Angela Prince, M.Sc., R.P. Bio Westslope Fisheries 517 13 th Avenue South
More informationCharacterization of two microsatellite PCR multiplexes for high throughput. genotyping of the Caribbean spiny lobster, Panulirus argus
Characterization of two microsatellite PCR multiplexes for high throughput genotyping of the Caribbean spiny lobster, Panulirus argus Nathan K. Truelove 1, Richard F. Preziosi 1, Donald Behringer Jr 2,
More informationAppendix A: List of specimen details of 27 freshwater fish species used in this study. SLM-HWE(PH)
Appendix: Appendix A: List of specimen details of 27 freshwater fish species used in this study. 1 Barbonymus schwanenfeldii SLM-BS(PH)-01 Department of Fisheries, Lubuk Paku 3.5101406 102.7738548 SLM-BS(PH)-02
More informationMOLECULAR PHYLOGENETIC RELATIOSHIPS IN ROMANIAN CYPRINIDS BASED ON cox1 AND cox2 SEQUENCES
PROCEEDINGS OF THE BALKAN SCIENTIFIC CONFERENCE OF BIOLOGY IN PLOVDIV (BULGARIA) FROM 19 TH TILL 21 ST OF MAY 2005 (EDS B. GRUEV, M. NIKOLOVA AND A. DONEV), 2005 (P. 162 167) MOLECULAR PHYLOGENETIC RELATIOSHIPS
More informationgeorgii (TELEOSTEI: ISTIOPHORIDAE):
BULLETIN OF MARINE SCIENCE, 79(3): 483 491, 2006 Validity, Identification, and Distribution of the Roundscale Spearfish, Tetrapturus georgii (TELEOSTEI: ISTIOPHORIDAE): Morphological and Molecular evidence
More informationSupplementary Materials: Bioactive Polycyclic Quinones from Marine Streptomyces sp. 182SMLY
S1 of S26 Supplementary Materials: Bioactive Polycyclic Quinones from Marine Streptomyces sp. 182SMLY Ying Liang, Xin Xie, Lu Chen, Shilun Yan, Xuewei Ye, Komal Anjum, Haocai Huang, Xiao Yuan Lian and
More informationPhylogenetic analysis among Cyprinidae family using 16SrRNA
2014; 1(6): 66-71 ISSN: 2347-5129 IJFAS 2014; 1(6): 66-71 2013 IJFAS www.fisheriesjournal.com Received: 20-05-2014 Accepted: 02-06-2014 Utpala Sharma Varsha singhal Dayal P. Gupta Partha Sarathi Mohanty
More informationRabbit MSTN gene polymorphisms and genetic effect analysis
Rabbit MSTN gene polymorphisms and genetic effect analysis X.B. Qiao 1, K.Y. Xu 2, B. Li 1, X. Luan 1, T. Xia 1 and X.Z. Fan 1 1 College of Animal Science and Technology, Shandong Agricultural University,
More informationInternational Journal of Research in Zoology. Original Article
Available online at http://www.urpjournals.com International Journal of Research in Zoology Universal Research Publications. All rights reserved Original Article ISSN 2278 1358 Phylogeny and genetic divergence
More informationAN ISSUE OF GENETIC INTEGRITY AND DIVERSITY: ASSESSING THE CONSERVATION VALUE OF A PRIVATE AMERICAN BISON HERD
AN ISSUE OF GENETIC INTEGRITY AND DIVERSITY: ASSESSING THE CONSERVATION VALUE OF A PRIVATE AMERICAN BISON HERD A Senior Scholars Thesis by ASHLEY SUZANNE MARSHALL Submitted to the Office of Undergraduate
More informationThe correlation between saprobity and mitochondrial genes of indicator fish species based on molecular phylogeny
RESEARCH ARTICLE The correlation between saprobity and mitochondrial genes of indicator fish species based on molecular phylogeny Frolova Liudmila Leonidovna, Arthur M. Husainov, Antony E. Sverdrup Department
More informationHybridization versus Randomly-Sorting Ancestral Alleles: Genetic Variation in Lake Malawi Cichlids
Hybridization versus Randomly-Sorting Ancestral Alleles: Genetic Variation in Lake Malawi Cichlids Meryl Mims Faculty Advisor: Professor Todd Streelman Undergraduate Honors Thesis, Spring 2007 Georgia
More informationGulf and Caribbean Research
Gulf and Caribbean Research Volume 20 Issue 1 January 2008 Documentation of a Gulf Sturgeon Spawning Site on the Yellow River, Alabama, USA Brian R. Kreiser University of Southern Mississippi, Brian.Kreiser@usm.edu
More information16S rrna Gene Sequence Analysis of Snow Leopard, Gray Wolf, Horse and Bactrian Camel in Mongolia
Journal of Agricultural Science and Technology A 7 (2017) 350-356 doi: 10.17265/2161-6256/2017.05.007 D DAVID PUBLISHING 16S rrna Gene Sequence Analysis of Snow Leopard, Gray Wolf, Horse Munkhtuul Tsogtgerel
More informationDNA approaches to marine wildlife fishery monitoring and law enforcement. Mahmood S. Shivji
DNA approaches to marine wildlife fishery monitoring and law enforcement Mahmood S. Shivji Presentation given at FIU Forensics Workshop - July 26, 2010 Major forensics questions for marine wildlife 1.
More informationMolecular insights into the phylogenetics of spiny lobsters of Gulf of Mannar marine biosphere reserve based on 28S rdna
Indian Journal of Biotechnology Vol 11, April 2012, pp 182-186 Molecular insights into the phylogenetics of spiny lobsters of Gulf of Mannar marine biosphere reserve based on 28S rdna P Suresh*, G Sasireka
More informationGenetic Diversity of Chinese Indigenous Pig Breeds in Shandong Province Using Microsatellite Markers*
28 Asian-Aust. J. Anim. Sci. Vol. 24, No. 1 : 28-36 January 2011 www.ajas.info Genetic Diversity of Chinese Indigenous Pig Breeds in Shandong Province Using Microsatellite Markers* J. Y. Wang 1,2, J. F.
More informationMicrobial Ecology and Activity of Anaerobic Ammonium Oxidation (ANAMMOX) Bioreactors
Microbial Ecology and Activity of Anaerobic Ammonium Oxidation (ANAMMOX) Bioreactors Hongkeun Park hp2218@columbia.edu Ph.D. Student Earth and Environmental Engineering Columbia University Background:
More informationAnguilla marmorata (Giant Mottled Eel) Discovered in a New Location: Natural Range Expansion or Recent Human Introduction? 1
Anguilla marmorata (Giant Mottled Eel) Discovered in a New Location: Natural Range Expansion or Recent Human Introduction? 1 Alex Handler 2 and Shelley A. James 3 Abstract: Freshwater eels in the family
More informationA note on the population structure of leopards (Panthera pardus) in South Africa
A note on the population structure of leopards (Panthera pardus) in South Africa Laura Tensen 1 *, Dick Roelofs 2 & Lourens H. Swanepoel 3,4 1 Department of Zoology, Faculty of Science, University of Johannesburg,
More informationTridacna spp. and Hippopus hippopus
ARTICLE Updates on the status of giant clams Tridacna spp. and Hippopus hippopus in the Philippines using mitochondrial CO1 and 16S rrna genes Apollo Marco D. Lizano 1,2 and Mudjekeewis D. Santos 1 * 1
More informationMatthew Alan Bertone
Matthew Alan Bertone HOME: 109 Dunnsbee Drive - Garner, NC 27529 - phone: 919.210.9857 OFFICE: North Carolina State University - Campus Box 7613 - Raleigh, NC 27695 phone: 919.515.3429 - fax: 919.515.7746
More informationGenetic Investigation of Snake River and Yellowstone Cutthroat Trout
University of Wyoming National Park Service Research Center Annual Report Volume 27 27th Annual Report, 2003 Article 12 1-1-2003 Genetic Investigation of and Cutthroat Trout Jeffery B. Mitton University
More informationMolecular phylogenetic status of some marine Cymothoid isopods in southeast coast of India
Molecular phylogenetic status of some marine Cymothoid isopods in southeast coast of India Thangaraj M *., Saranya S., Divya S., Ramanadevi V. & Subburaj J. Centre of Advanced Study in Marine Biology,
More informationHaplotype analysis revealed candidate region for black/brown coat color gene in cattle
Original paper Haplotype analysis revealed candidate region for / coat color gene in cattle Shinji SASAZAKI 1, Munehiro USUI 1, Yuki YOSHIZAKI 1, Masaaki TANIGUCHI 2, Hiroshi HASEBE 3, Tsuyoshi ABE 3,
More informationISSN Original Article. Nucleotide sequence of 16S rrna gene of Clarias gariepinus and its molecular phylogeny with other catfishes
Available online at http://www.urpjournals.com International Journal of Research in Fisheries and Aquaculture Universal Research Publications. All rights reserved ISSN 2277-7729 Original Article Nucleotide
More informationSupplemental Data. Gutjahr et al. (2008). Arbuscular mycorrhiza-specific signaling in rice transcends the common symbiosis signaling pathway.
Supplemental Data. Gutjahr et al. (2008). Arbuscular mycorrhiza-specific signaling in rice transcends the common symbiosis signaling pathway. A H S S H B P. i. M H 2 O Pi Tef CP2 Supplemental Figure 1.
More informationPCR primers for 100 microsatellites in red drum (Sciaenops ocellatus)
Molecular Ecology Resources (2008) 8, 393 398 doi: 10.1111/j.1471-8286.2007.01969.x Blackwell Publishing Ltd PERMANENT GENETIC RESOURCES PCR primers for 100 microsatellites in red drum (Sciaenops ocellatus)
More informationLecture 2 Phylogenetics of Fishes. 1. Phylogenetic systematics. 2. General fish evolution. 3. Molecular systematics & Genetic approaches
Lecture 2 Phylogenetics of Fishes 1. Phylogenetic systematics 2. General fish evolution 3. Molecular systematics & Genetic approaches Charles Darwin & Alfred Russel Wallace All species are related through
More information6 Jon E. Hess 1, Nathan R. Campbell 1, Margaret F. Docker 2,
1 Use of genotyping-by-sequencing data to develop a highthroughput and multi-functional set of genetic markers for conservation applications in Pacific lamprey 2 3 4 5 6 Jon E. Hess 1, Nathan R. Campbell
More informationGenetic Relationship among the Korean Native and Alien Horses Estimated by Microsatellite Polymorphism
784 Genetic Relationship among the Korean Native and Alien Horses Estimated by Microsatellite Polymorphism G. J. Cho* College of Veterinary Medicine, Kyungpook National University, Daegu 702-701, Korea
More informationMolecular phylogeny of the Romanian cyprinids from the Danube River
Roumanian Biotechnological Letters Vol. 13, No. 5, 2008, pp. 3970 3975 Copyright 2008 Bucharest University Printed in Romania. All rights reserved Roumanian Society of Biological Sciences ORIGINAL PAPER
More informationGenetic Variations of Common Carp (Cyprinus carpio L.) In South-Eastern Part of Caspian Sea Using Five Microsatellite Loci
World Journal of Zoology 6 (1): 56-60, 2011 ISSN 1817-3098 IDOSI Publications, 2011 Genetic Variations of Common Carp (Cyprinus carpio L.) In South-Eastern Part of Caspian Sea Using Five Microsatellite
More informationUse of PCR-Restriction Enzyme Pattern Analysis and Sequencing Database for hsp65 Gene-Based Identification of Nocardia Species
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2006, p. 536 546 Vol. 44, No. 2 0095-1137/06/$08.00 0 doi:10.1128/jcm.44.2.536 546.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Use
More informationInsights into the genome of the De Donno strain of Xylella fastidiosa. Annalisa Giampetruzzi PhD researcher
Insights into the genome of the De Donno strain of Xylella fastidiosa Annalisa Giampetruzzi PhD researcher TOPICS OF PRESENTATION 1) Whole-genome phylogeny based on single nucleotide polymorphisms (SNPs)
More informationSupporting information
Supporting information Antimicrobial Metabolites from Streptomyces sp. SN0280 Hui Tian, Jamil Shafi, Mingshan Ji,, Yuhui Bi, and Zhiguo Yu *,, College of Plant Protection, Shenyang Agricultural University,
More informationMitochondrial DNA D-loop sequence variation among 5 maternal lines of the Zemaitukai horse breed
Research Article Genetics and Molecular Biology, 28, 4, 677-681 (2005) Copyright by the Brazilian Society of Genetics. Printed in Brazil www.sbg.org.br Mitochondrial DNA D-loop sequence variation among
More informationQuick method for identifying horse (Equus caballus) and donkey (Equus asinus) hybrids
Short Communication Quick method for identifying horse (Equus caballus) and donkey (Equus asinus) hybrids M.M. Franco 1,2,3, J.B.F. Santos 2, A.S. Mendonça 3, T.C.F. Silva 2, R.C. Antunes 2 and E.O. Melo
More informationPhylogenetic relationships of twenty Gymnothorax species based on cytochrome b sequence data
Phylogenetic relationships of twenty Gymnothorax species based on cytochrome b sequence data M. Du 1, S.W. Yin 2 and B.Z. Niu 1 1 Key Lab for Quality, Efficient cultivation and Security Control of Crops
More informationComparative study of genetic biodiversity in carp fish (Cyprinous carpio)
International Journal of Zoology Studies ISSN: 2455-7269 Impact Factor: RJIF 5.14 www.zoologyjournals.com Volume 3; Issue 2; March 2018; Page No. 80-85 Comparative study of genetic biodiversity in carp
More informationBiogeographical Distribution and Phylogenetic Analysis of Simulium (Wallacellum) (Diptera: Simuliidae) Based on the Mitochondrial Sequences
South Pacific Studies Vol.35, No.2, 2015 Biogeographical Distribution and Phylogenetic Analysis of Simulium (Wallacellum) (Diptera: Simuliidae) Based on the Mitochondrial Sequences OTSUKA Yasushi 1 * and
More informationHybridization of White, Yellow, and Striped Bass in the Toledo Bend Reservoir
2013 2013 SOUTHEASTERN Southeastern Naturalist NATURALIST 12(3):514 522 Vol. 12, No. 3 Hybridization of White, Yellow, and Striped Bass in the Toledo Bend Reservoir Sabrina S. Taylor 1,*, Stefan Woltmann
More informationResearch Article Molecular Systematics of the Phoxinin Genus Pteronotropis (Otophysi: Cypriniformes)
BioMed Research International Volume 2015, Article ID 2658, 8 pages http://dx.doi.org/10.1155/2015/2658 Research Article Molecular Systematics of the Phoxinin Genus Pteronotropis (Otophysi: Cypriniformes)
More informationAmpFlSTR Identifiler PCR Amplification Kit
Application Note Human Identification AmpFlSTR Identifiler PCR Amplification Kit In Applied Biosystems continual efforts to improve the quality of our products, we have made some modifications to the manufacturing
More informationElectronic Supplementary Material Note S1 Figures S1-S4 Tables S1, S2
Electronic Supplementary Material Note S Figures S-S4 Tables S, S Note S: Description of glaucinid reproductive system Glaucinins have diaulic (i.e., having two pallial gonoducts, 30) reproductive systems
More informationUWC research on wild meat products authentication in South Africa.
UWC research on wild meat products authentication in South Africa. Maria Eugenia D Amato, PhD, Ass Professor Forensic DNA Lab, University of the Western Cape, South Africa www.forensicdnalab.org.za 1 UWC
More informationMitochondrial DNA analysis as a tool for family and species identification of fish larvae: Emphasis on Snappers.
Mitochondrial DNA analysis as a tool for family and species identification of fish larvae: Emphasis on Snappers. Áurea E. Rodríguez, Juan C. Martínez-Cruzado, Ernesto Otero, Jorge R. García-Sais and Jennie
More informationThe myostatin (MSTN) gene encodes a growth
Pakistan J. Zool., vol. 48(5), pp. 1283-1290, 2016. The Correlation Between Polymorphisms of the MSTN Gene and Slaughter Traits in Sansui Ducks Zhong-Hai Zhao, 1,2 Hui Li, 1,2, * Heng-Jie Yi 1,2 and Bang-Xing
More informationMolecular Confirmation of Rhipicephalus haemaphysaloides Infesting Ruminants in Wayanad, Kerala, India
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 8 (2017) pp. 2304-2309 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.608.271
More informationMOLECULAR CHARACTERISATION AND PHYLOGENETICS OF MALAYSIAN GREEN AROWANA (Scleropages formosus) IN PENINSULAR MALAYSIA
First ASIAHORCs Joint Symposium 18-20 July 2009 Nagoya, Japan MOLECULAR CHARACTERISATION AND PHYLOGENETICS OF MALAYSIAN GREEN AROWANA (Scleropages formosus) IN PENINSULAR MALAYSIA M. Rizman-Idid 1, S.
More informationFinal Report Submitted to the Water Resources Institute May 24, 2017
1 Empirical Validation of the Use of Genetic Tags to Determine the Population and DPS Origin of Atlantic Sturgeon that Were Acoustically Tagged off the Delaware Coast and in Long Island Sound Final Report
More informationPHYLOGENETIC ANALYSIS ON FOUR SPECIES OF TILAPIA (Oreochromis niloticus, Tilapia zilli, Sarotherodon galilaeus, Sarotherodon melanotheron) IN NIGERIA
ISSN: Print - 2277-0755 Online - 2315-7453 FUNAAB 2016 Journal of Agricultural Science and Environment PHYLOGENETIC ANALYSIS ON FOUR SPECIES OF TILAPIA (Oreochromis niloticus, Tilapia zilli, Sarotherodon
More informationwi Astuti, Hidayat Ashari, and Siti N. Prijono
Phylogenetic position of Psittacula parakeet bird from Enggano Island, Indonesia based on analyses of cytochrome b gene sequences. wi Astuti, Hidayat Ashari, and Siti N. Prijono Research Centre for Biology,
More informationTracing the genetic origin of brown trout (Salmo trutta) re-colonizing the Ecker reservoir in the Harz National Park, Germany
ENVIRONMENTAL BIOTECHNOLOGY 8 (2) 22, 39-44 Tracing the genetic origin of brown trout (Salmo trutta) re-colonizing the Ecker reservoir in the Harz National Park, Germany Klaus Kohlmann, Otfried Wüstemann
More informationSi Ming Man, Nadeem O. Kaakoush, Sophie Octavia, and Hazel Mitchell*
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2010, p. 3071 3081 Vol. 76, No. 10 0099-2240/10/$12.00 doi:10.1128/aem.02551-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. The Internal
More informationLoopamp Bovine Embryo Sexing Kit Instruction Manual
Loopamp Bovine Embryo Sexing Kit Instruction Manual 1 Instruments required Detection equipment Loopamp End Point turbidimeter LA-100(manufactured by TERAMECS) Pipettes Adjustable micro-pipettes(adjustable
More informationJournal of Microbes and Infection, March 2009, Vol. 4, No. 1 ,
2009 3 4 1 Journal of Microbes and Infection, March 2009, Vol. 4, No. 1 45 : 16S rrna,, 200025 : 30S 16S rrna A 16S rrna, 4, 6- - ( ), G + C G + C, 16S rrna,, : 16S rrna ; ; A novel aminoglycoside resistance
More informationMolecular characterization of ornamental fish (Poeciliidae) using mitochondrial DNA 12S rrna and 16S rrna genes
Available online at www.scholarsresearchlibrary.com Annals of Biological Research, 2016, 7 (5):5-11 (http://scholarsresearchlibrary.com/archive.html) ISSN 0976-1233 CODEN (USA): ABRNBW Molecular characterization
More informationMorphological and Molecular Identification of species of Catfish Genus Cranoglanis from Lam River, Nghe an, Vietnam
ISSN No. (Print): 075-10 ISSN No. (Online): 4- Morphological and Molecular Identification of species of Catfish Genus Cranoglanis from am River, Nghe an, Vietnam Nguyen Dinh Vinh *, Tran Thi Thuy Ha **,
More informationCorresponding author: M. Delghandi
Novel genomic microsatellite markers for genetic population and diversity studies of tropical scalloped spiny lobster (Panulirus homarus) and their potential application in related Panulirus species M.
More informationQuagga Mussels in the West and the Colorado River Basin. Ricardo De Leon, Ph.D. Metropolitan Water District of Southern California
Quagga Mussels in the West and the Colorado River Basin Ricardo De Leon, Ph.D. Metropolitan Water District of Southern California Invasive Mussels Live quagga mussels discovered January 6, 2007 in Lake
More informationA duplex real-time polymerase chain reaction assay for differentiation between Bolbophorus damnificus and Bolbophorus type II species cercariae
Brief Research Reports 615 J Vet Diagn Invest 22:615 622 (2010) A duplex real-time polymerase chain reaction assay for differentiation between Bolbophorus damnificus and Bolbophorus type II species cercariae
More informationArticle. Abstract. Introduction
Zootaxa 2008: 1 22 (2009) www.mapress.com/zootaxa/ Copyright 2009 Magnolia Press Article ISSN 1175-5326 (print edition) ZOOTAXA ISSN 1175-5334 (online edition) Genetic identification and color descriptions
More informationTeleosts: Evolutionary Development, Diversity And Behavioral Ecology (Fish, Fishing And Fisheries) READ ONLINE
Teleosts: Evolutionary Development, Diversity And Behavioral Ecology (Fish, Fishing And Fisheries) READ ONLINE If searched for a ebook Teleosts: Evolutionary Development, Diversity and Behavioral Ecology
More informationAccepted Manuscript. Phylogenetic Position of the Enigmatic Genus Psilorhynchus (Ostariophysi: Cypriniformes): Evidence from the Mitochondrial Genome
Accepted Manuscript Phylogenetic Position of the Enigmatic Genus Psilorhynchus (Ostariophysi: Cypriniformes): Evidence from the Mitochondrial Genome Shunping He, Xun Gu, Richard L. Mayden, Wei-Jen Chen,
More informationGENETIC STRUCTURE OF ROCK BASS AND JOHNNY DARTERS: IMPLICATIONS FOR GAMEFISH MANAGEMENT IN WISCONSIN. Lacie Jo Westbrook
GENETIC STRUCTURE OF ROCK BASS AND JOHNNY DARTERS: IMPLICATIONS FOR GAMEFISH MANAGEMENT IN WISCONSIN by Lacie Jo Westbrook Wisconsin Cooperative Fishery Research Unit A Thesis submitted in partial fulfillment
More informationResearch Article. Mohd Danish* and I J Singh
Research Article Genetic Diversity Analysis of Labeo rohita (Hamilton, 1822) and Common carp (Cyprinus carpio var. communis ) from Swapan private hatchery located in Dineshpur in Udham Singh Nagar district
More informationRepresentativeness of Environmental DNA Metabarcoding signal in River Fish Biodiversity Assessment
Representativeness of Environmental DNA Metabarcoding signal in River Fish Biodiversity Assessment Pont D., Civade R., Valentini A., T. Dejean et P. Taberlet Ability of edna Metabarcoding * to describe
More informationResearch Article Application of RFLP-PCR-Based Identification for Sand Fly Surveillance in an Area Endemic for Kala-Azar in Mymensingh, Bangladesh
Parasitology Research Volume 2012, Article ID 467821, 4 pages doi:10.1155/2012/467821 Research Article Application of RFLP-PCR-Based Identification for Sand Fly Surveillance in an Area Endemic for Kala-Azar
More informationBRIEF COMMUNICATION Phylogenetic relationships within the genus Pimephales as inferred from ND4 and ND4L nucleotide sequences
Journal of Fish Biology (2002) 61, 293 297 doi:10.1006/jfbi.2002.2002, available online at http://www.idealibrary.com on BRIEF COMMUNICATION Phylogenetic relationships within the genus Pimephales as inferred
More informationLocation Confirmation of Sockeye, Coho and Pink Salmon Species on the Coast of British Columbia
1 Location Confirmation of Sockeye, Coho and Pink Salmon Species on the Coast of British Columbia Simryn Atwal, Finola Fogarty, Anna Madsen, Kevin Rasode Abstract: Migration patterns of Pacific Salmon
More informationGENETIC VARIATION IN CYPRINION MACROSTOMUS HECKEL, 1843 POPULATIONS AS REVEALED BY PARTIAL COI SEQUENCES OF MITOCHONDRIAL DNA
- 1899 - GENETIC VARIATION IN CYPRINION MACROSTOMUS HECKEL, 1843 POPULATIONS AS REVEALED BY PARTIAL COI SEQUENCES OF MITOCHONDRIAL DNA PARMAKSIZ, A. Department of Biology, Faculty of Science-Literature,
More informationUsage Mitochondrial 16S rrna Gene as Molecular Marker in Taxonomy of Cyprinin Fish Species (Cyprinidae: Teleostei)
JKAU: Mar. Sci., Vol. 23, No. 1, pp: 39-49 (2012 A.D. / 1433 A.H.) DOI : 10.4197/Mar. 23-1.3 Usage Mitochondrial 16S rrna Gene as Molecular Marker in Taxonomy of Cyprinin Fish Species (Cyprinidae: Teleostei)
More informationGenetic diversity and population structure inferred from the partially duplicated genome of domesticated carp, Cyprinus carpio L.
Genet. Sel. Evol. 39 (2007) 319 340 319 c INRA, EDP Sciences, 2007 DOI: 10.1051/gse:2007006 Original article Genetic diversity and population structure inferred from the partially duplicated genome of
More informationSociety for Wildlife Forensic Science Develop Wildlife Forensic Science into a comprehensive, integrated and mature discipline.
Society for Wildlife Forensic Science Develop Wildlife Forensic Science into a comprehensive, integrated and mature discipline. Wildlife Genetics Proficiency Testing Program Test # 021716 Consensus Report
More informationSAM510: SAM Methyltransferase Assay A Non Radioactive Colorimetric Continuous Enzyme Assay
462PR 01 A Geno Technology, Inc. (USA) brand name G-Biosciences, St Louis, MO. USA 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com SAM510: SAM Methyltransferase Assay A Non Radioactive Colorimetric
More informationJENJIT KHUDAMRONGSAWAT 1*, TUCKSAORN BHUMMAKASIKARA 2 AND NANTARIKA CHANSUE 3
Tropical Natural History 17(1): 175-180, April 2017 2017 by Chulalongkorn University Short Note Preliminary Study of Genetic Diversity in the Giant Freshwater Stingray, Himantura chaophraya (Batoidea:
More informationSix diagnostic single nucleotide polymorphism markers for detecting introgression between cutthroat and rainbow trouts
Molecular Ecology Resources (2009) 9, 759 763 doi: 10.1111/j.1755-0998.2009.02532.x Blackwell Publishing Ltd MOLECULAR DIAGNOSTICS AND DNA TAXONOMY Six diagnostic single nucleotide polymorphism markers
More informationaV. Code(s) assigned:
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). Code(s) assigned: 2009.016aV (to be completed by ICTV
More informationBarcoding Anurans from Brazilian Atlantic Forest
Barcoding Anurans from Brazilian Atlantic Forest Mariana L. Lyra, Célio F. B. Haddad & Ana Maria L. de Azeredo-Espin marilyra@unicamp.br Capes/CNPq Prodoc nº 563.975/05-9 International Symposium on DNA
More informationPCR detection of Schistosoma japonicum cercariae: a potential tool for the field Amanda Driscoll
PCR detection of Schistosoma japonicum cercariae: a potential tool for the field Amanda Driscoll Abstract Despite decades of prevention and control efforts, the water-borne parasitic disease schistosomiasis
More informationSupplementary file S1: Previous classification of Riodinidae
Supplementary file S: Previous classification of Riodinidae NEMEOBIINAE EUSELASIINAE MESOSEMIINI NEMEOBIINI ZEMERINI ABISARINI EUSELASIINI CORRACHIINI MESOSEMIINA NAPAEINA EURYBIINI RIODININAE HELICOPINI
More informationDepartment of Horse Breeding, Poznań University of Life Sciences, Wołyńska 33, Poznań, Poland
Animal Science Papers and Reports vol. 31 (2013) no. 2, 159-164 Institute of Genetics and Animal Breeding, Jastrzębiec, Poland Genotyping of coat color genes (MC1R, ASIP, PMEL17 and MATP) polymorphisms
More informationMicrosatellite markers for Australian temperate diadromous fishes Pseudaphritis urvillii (Bovichtidae) and Lovettia sealii (Galaxiidae).
Microsatellite markers for Australian temperate diadromous fishes Pseudaphritis urvillii (Bovichtidae) and Lovettia sealii (Galaxiidae). Daniel J. Schmidt A, D, Kathryn M. Real A, David A. Crook B, C,
More informationGOBY SPECIES DIVERSITY IN VIETNAM BASED ON MORPHOLOGICAL AND GENETIC CHARACTERISTICS
GOBY SPECIES DIVERSITY IN VIETNAM BASED ON MORPHOLOGICAL AND GENETIC CHARACTERISTICS Thai Thi Lan Phuong 1, Dang Thuy Binh 1* ABSTRACT The Gobiidae is one of the largest fish families in the world, with
More informationPeopling of the Marianas: An mtdna perspective
Peopling of the Marianas: An mtdna perspective 2 nd Marianas History Conference August 31, 2013 Miguel G. Vilar 1,3,5 Daniel E. Lynch 1,2,3 Chim W. Chan 1,2,3 Dana R. Santos 1,3 Ralph M. Garruto 2,3,4
More informationRevision of Tasmanian viviparous velvet worms (Onychophora : Peripatopsidae) with descriptions of two new species
Invertebrate Systematics, 2018, 32, 909 932 doi:10.1071/is17096_ac CSIRO 2018 Supplementary material Revision of Tasmanian viviparous velvet worms (Onychophora : Peripatopsidae) with descriptions of two
More informationJournal of Molecular Evolution
J Mol Evol (1992) 35:102-113 Journal of Molecular Evolution @ Springer-Verlag New York Inc. 1992 Molecules, Fossils, and the Origin of Tetrapods Axel Meyer and Sarah I. Dolven Department of Ecology and
More informationFirst report of the Taiwan sardinella Sardinella hualiensis (Clupeiformes: Clupeidae) in the Philippines
Journal of Fish Biology (2011) 79, 2087 2094 doi:10.1111/j.1095-8649.2011.03133.x, available online at wileyonlinelibrary.com First report of the Taiwan sardinella Sardinella hualiensis (Clupeiformes:
More informationThe power of single molecule real-time sequencing technology in the de novo assembly of a eukaryotic genome
The power of single molecule real-time sequencing technology in the de novo assembly of a eukaryotic genome Hiroaki Sakai 1, Ken Naito 2 *, Eri Ogiso-Tanaka 2, Yu Takahashi 2, Kohtaro Iseki 2, Chiaki Muto
More informationGoodyear Polyglas Tire Date Coding
Goodyear Polyglas Tire Date Coding M A R C U S A N G H E L R I C K S A U V E Ever wonder what the date code is on your Goodyear tires and if they are original? This article is written to answer that, and
More informationSet-up, programming and analysis RotorGene 3000/6000, Rotor-Gene Q
Set-up, programming and analysis RotorGene 3000/6000, Rotor-Gene Q How to start a Rotor-Gene run 1.Start the Rotor-Gene software. 2.Choose: Advanced/ Perform Last Run and press New. How to start a Rotor-Gene
More informationHigh performance carbon nanotube based fiber-shaped. supercapacitors using redox additives of polypyrrole and. hydroquinone
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting information High performance carbon nanotube based fiber-shaped
More informationCHEMICALS_MSDSEGFR_SAF_EN _E
Page 1 of 6 RB Reaction buffer; Taq PCR Tag Polymerase; dntps PCR dntps; BSA PCR BSA; 19WTF EGFR 19 WTF; 19WTR EGFR 19 WTR; 19 MF EGFR 19 MF; 19 MR EGFR 19 MR; 18F EGFR 18F; 18R EGFR 18R; 20F EGFR 20F;
More informationOccurrence of Equine Coital Exanthema in Pastured Draft Horses and Isolation of Equine Herpesvirus 3 from Progenital Lesions
FULL PAPER Virology Occurrence of Equine Coital Exanthema in Pastured Draft Horses and Isolation of Equine Herpesvirus 3 from Progenital Lesions Yoshihisa SEKI 1), Yukio M. SEIMIYA 1), Gakuji YAEGASHI
More informationSystematics and Biodiversity of the Order Cypriniformes (Actinopterygii, Ostariophysi) A Tree of Life Initiative. NSF AToL Workshop 19 November 2004
Systematics and Biodiversity of the Order Cypriniformes (Actinopterygii, Ostariophysi) A Tree of Life Initiative NSF AToL Workshop 19 November 2004 Gloria Arratia Nevin Aspinwall Hank Bart Miles Coburn
More informationIntraspecific polymorphism of 16S rrna genes in two halophilic archaeal genera, Haloarcula and Halomicrobium
Extremophiles (2009) 13:31 37 DOI 10.1007/s00792-008-0194-2 ORIGINAL PAPER Intraspecific polymorphism of 16S rrna genes in two halophilic archaeal genera, Haloarcula and Halomicrobium Heng-Lin Cui Æ Pei-Jin
More informationMolecular Phylogeny of the Neotropical Knifefishes of the Order Gymnotiformes (Actinopterygii)
Molecular Phylogeny of the Neotropical Knifefishes of the Order Gymnotiformes (Actinopterygii) by Francesco H. Janzen A thesis submitted in conformity with the requirements for the degree of Master of
More informationInternational Journal of Systematic and Evolutionary Microbiology (2002), 52,
International Journal of Systematic and Evolutionary Microbiology (2002), 52, 1405 1409 DOI: 10.1099/ijs.0.02145-0 NOTE Conservation of the unique rickettsial rrna gene arrangement in Anaplasma 1 Program
More information