Molecular phylogenetic status of some marine Cymothoid isopods in southeast coast of India

Transcription

1 Molecular phylogenetic status of some marine Cymothoid isopods in southeast coast of India Thangaraj M *., Saranya S., Divya S., Ramanadevi V. & Subburaj J. Centre of Advanced Study in Marine Biology, Annamalai University, Parangipettai , TamilNadu, India [ * E.mail: coralholder@yahoo.com] Received ; revised In this study, 16S rrna and COI genes of four Indian isopod species and nine other species (retrieved from NCBI) of the three parasitic habits were examined to present a different hypothesis on the evolutionary history of the family. Present study infers that there is no relationship among the habitat-specific species. Phylogenetic tree support the monophyly of the family and the specialized mouth parts bearing species (endoparasites) are not necessarily derived from the scale attaching ones (ectoparasites). The use of more molecular markers can greatly improve the taxonomic revisions of the Cymothoidae and the present work could be a valuable first step towards this task. [Keywords: Cymothoidae, ectoparasites, mitochondrial gene, phylogeny, evolution] Introduction Cymothoid isopods represent one of the most derived lineages of isopods 1,2,3, and currently include 42 genera with over 325 described species and most parasitizing teleost fish, particularly in warm temperate and tropical seas 4. In India, earlier study showed the morphology, diversity, life cycle of four isopod parasites and the secondary infection in the host fishes 5. Some species attach externally, under the scales or at the base of fins, while other more specialized forms inhabit the gill chamber or the buccal cavity, exhibiting very distinctive eco-morphological adaptations and peculiar life-history traits 4. Brusca 6, initially proposed that the externally attaching forms would represent a distinct lineage from the internal forms, whose specialized adaptations reflect a more derived status. A decade later, a thorough revision was made by Bruce 7 and identified three subfamilies, putatively corresponding to three different evolutionary lineages: Anilocrinae, Livonecinae and Cymothoinae. However, careful field observations within the Anilocrinae have shown that some degree of behavioural flexibility can be observed even within a genus 8. 1

2 In general, the distinctive phenotypic adaptations of cymothoids, strongly constrained by the type of parasitic strategy, may hinder the choice of reliable morphological characters suitable for phylogenetic reconstruction 9. Despite the power and effectiveness of molecular markers in phylogenetic analysis, their use is seldom strictly confined to the recovery of a pattern of phylogenetic relationships among a set of studied taxa 10. In recent years, a number of studies have successfully focused on the positioning of phenotypically measurable adaptive traits on the main branches of the phylogenetic tree of several groups of organisms. These results have proven momentous in the reconstruction of the evolutionary history of several high-profile taxa 11,12 and allowed for major reinterpretations of the adaptive transformations that led to the present-day ecological diversity 13,14. In this study, we have used 16S rrna and cytochrome oxidase I (COI) gene of four Indian isopod species and nine other species (retrieved from NCBI) of the three parasitic habits to present a preliminary hypothesis on the evolutionary history of the family. Materials and Methods The parasites were collected along with their host (Elops machnata) from Vellar estuary (Lat 11⁰ 29 N; Lon 79⁰ 46 E), Parangipettai, in southeast coast of India. samples were stored in 95% ethanol and sealed with parafilm and kept at room temperature for further analysis. Each collected species were morphologically identified based on the previous report 15. The total DNA was extracted from the stored parasites leg tissue by the standard protocol 16 with the addition of 5µl Proteinase K and 10% SDS in the digestion buffer. The DNA samples from individuals of each species was diluted to about 25 ng/µl with deionized distilled water and used for polymerase chain reaction. The 16S rrna gene was amplified using the primers, 16S-cymF 5 -AGCCCTGTTCAA TGGGATTA -3 ; 16S-cymR 5 -TCCCTGGGGTAGTTTCATCTT-3 4. The PCR condition was: initial denaturation at 94ºC for 2 min, followed by 35 cycles of 1 min at 95ºC, 30 S at 50ºC and 1 min at 72ºC with a final elongation of 10 min at 72ºC. The COI gene was amplified using the primers, Fish F1 5 -TCAACCAACCACAAAGACATTGGCAC-3 ; Fish R1 5 - TAGACTTCTGGGTGGCCAAAGAATCA The PCR condition was: initial denaturation at 94ºC for 2 min, followed by 35 cycles of 1 min at 95ºC, 30 S at 54ºC and 1 min at 72ºC with a 2

3 final elongation of 10 min at 72ºC. The PCR products were purified with a PCR purification kit and sequenced in a commercial sequencing facility (Ramachandra Innovis, Chennai). The gene partial sequences of COI and 16S rrna from four isopod species were unambiguously edited using BioEdit sequence alignment editor14 and aligned using CLUSTAL- W in BioEdit 18 and then checked manually. Another twelve 16S rrna gene and COI sequences of nine species were retrieved from the GenBank and the details are given in Table1. Analyses were conducted using the Kimura 2-parameter model 20. Identical sequences were assigned in the same haplotype identity and only a single example of each species used in the genetic distance (K2P) estimation and assuming that identical haplotypes shared the same evolutionary origin. Phylogenetic and molecular evolutionary analyses, haplotype and nucleotide diversity indices were calculated using MEGA (v. 3.0) 21. The model of sequence divergence used was of Tamura 22, that accounted for multiple substitutions per site which allowed different substitution rates between transitions and transversions. The neighbour-joining (NJ) trees for the two genes were constructed using MEGA (v. 3.0) and to verify the robustness of the internal nodes of these trees, bootstrap analysis was carried out using 1000 pseudoreplications. Result and Discussion Totally 32 sequences (16S rrna + COI) from nine isopod species were analysed for its genetic relatedness. Kimura 2 Parameter (K2P) genetic distance in nine isopod species is given in Table 2. Based on the 16S rrna sequence data, Ceratothoa collaris, Anilocra physodes, Nerocila bivittata and Ceratothoa italica were didn t show any K2P genetic distance. Whereas, the COI sequence showed the K2P genetic distance was from to among the four species. The overall K2P distance for 16S rrna in all the nine species was and for COI it was Based on 16S rrna sequence, the K2P genetic distance was high (1.214) between the gill attaching parasite, Pentidotea resecata and the skin parasite, Nerocila poruvae. When we compared the COI gene sequence among the parasites the K2P genetic distance was more (0.860) between the skin parasite, Nerocila orbignyi and the mouth dwelling parasite, Ceratothoa italic. Whereas, the genetic distance was very less (0.235), between the skin parasite, Joryma hilsae and the gill attaching parasite, Lironeca vulgaris. Tajima s statistics (D) = for 16S rrna sequence and (D) = for COI gene sequence it was not significantly (p<0.01) different among sequences (Table 3). 3

4 All the fifteen 16S rrna and sixteen COI gene sequences were subjected in the phylogenetic analysis. The neighbour joining tree (NJ) of K2P distance was created to provide a graphical representation of the patterning of divergence of nine isopod parasite species. As per 16S rdna based NJ tree, there are three distinct clades were recognized with high bootstrap value (Fig. 1). The first clad having 100% bootstrap value included both the mouth dwelling and skin parasites. The second clade having 92% bootstrap value included the gill attaching and skin parasites. The third clade having 99% bootstrap value includes only gill attaching parasites. Based on the COI gene data, there were no clear clades that get separated, the NJ tree having seven small clades with more than 50% bootstrap value (Fig. 2). These two mitochondrial genes partial sequences suggests monophyly of cymothoids, but no definitive conclusions can be drawn in this study and this may be due to limited species selection. A molecular phylogenetic framework in Cymothoid isopods was reported in an earlier study 4. Where, the tree topology showed the mouth dwelling parasites, Ceratothoa italica and Ceratothoa collaris are sister species to the skin parasite, Nerocila bivittata and Anilocra physodes but the genetic distance did not was not show any significant difference. In the present study, based on the 16S rrna sequence data, many of the gills attaching parasites were clustered in to one group. But in the case of COI gene sequence based NJ tree, there was no significant grouping topology observed. This may be due to the disparity of the evolutionary rate among the mitochondrial genes. Previous study 4 concluded that, due to the nature of habit, many morphological characters commonly used in isopod taxonomy (i.e. setation and external ridges etc) have been lost or greatly reduced and other important characters are highly variable or polymorphic. Earlier reports have identified that three major lineages belongs to the family Cymothoidae: Anilocrinae, Livonecinae and Cymothoinae 1,6. The separation of these lineages has until now been based on the fashion of attachment (skin, gill cavity and buccal cavity) 4. Bruce 7 also suggested that Cymothoid taxonomic arrangements still being based on the host and it may reflect convergence due to similar life-styles rather than true phylogenetic affinities. Our phylogenetic trees also strongly support Bruce s 7 suggestion. Same type of conclusion was given by a recent study 4, and they reported that a similar complex of parasitic strategies in Cymothoid isopods and indicate that gill and buccal parasitic habits evolved independently rather than by a direct phylogenetic link. The present study does not allow for a definitive and exhaustive 4

5 description of the evolution of the ecological diversity in this family. The use of more molecular markers can greatly improve taxonomic revisions of the Cymothoidae, and the present work to be a valuable first step towards this task. Acknowledgement Authors thank the Director and Dean, Faculty of Marine Sciences and the authorities of Annamalai University for their interest, encouragement and providing facilities during execution of this work. References 1 Brusca R C & Wilson G D F, A phylogenetic analysis of the Isopoda with some classificatory recommendations, Mem. Queensl. Mus., 31 (1991) Dreyer H & Wa gele J W, Parasites of crustaceans (Isopoda: Bopyridae) evolved from fish parasites: molecular and morphological evidence, Zoology, 103 (2001) Brandt A & Poore G C B, Higher classification of flabelliferan and related Isopoda based on a reappraisal of relationships, Invertebr. Syst., 17 (2003) Ketmaier A, Joyce D A, Horton T & Mariani S, A molecular phylogenetic framework for the evolution of parasitic strategies in cymothoid isopods (Crustacea), J. Zool. Syst. Evol. Res., 46(1) (2008) Ravichandran S, Rameshkumar G & Kumaravel K, Variation in the morphological features of Isopod fish parasites, W. J. Fish. Mar. Sci., 1(2) (2009) Brusca R C, A monograph on the Isopoda, Cymothoidae (Crustacea) of the Eastern Pacific, Zool. J. Linn. Soc., 73 (1981) Bruce N L, The genera Catoessa, Elthusa, Enispa, Ichthyoxenus, Idusa, Livoneca, and Norileca n. gen. (Isopoda: Cymothoidae), crustacean parasites of marine fishes, with descriptions of eastern Australian species, Rec. Aust. Mus., 42 (1990) Bruce N L, Australian species of Nerocila Leach, 1818, and Creniola n. gen. (Isopoda: Cymothoidae), crustacean parasites of marine fishes, Rec. Aust. Mus., 39 (1987) Horton T, Ceratothoa steindachneri (Isopoda: Cymothoidae) new to British waters with a key to north-east Atlantic and Mediterranean Ceratothoa, J. Mar. Biolog. Assoc. UK., 80 (2000) Avise J C, Molecular Markers, Natural History, and Evolution, 2nd edn. Sinauer, Sunderland Massachusetts, (2004)

6 11 Milinkovitch M C, Meyer A & Powell J R, Phylogeny of all major groups of cetaceans based on DNA sequences from three mitochondrial genes, Mol. Biol. Evol., 11(1994) Springer M S, Teeling E C, Madsen O, Stanhope M J & de Jong W W, Integrated fossil and molecular data reconstruct bat echolocation, Proc. Natl. Acad. Sci. USA., 98 (2001) Teeling E C, Madsen O, Van Den Bussche R A, de Jong W W, Stanhope M J & Springer M S, Microbat paraphyly and the convergent evolution of a key innovation in Old World rhinolophoid microbats, Proc. Natl. Acad. Sci. USA., 99 (2002) Danforth B N, Conway L & Li S, Phylogeny of eusocial Lasioglossum reveals multiple losses of eusociality within a primitively eusocial clade of bees (Hymenoptera: Halictidae), Syst. Biol., 52 (2003) Trilles J, Ravichandran S & Rameshkumar G, A checklist of the Cymothoidae (Crustacea, Isopoda) recorded from Indian fishes, Acta Parasitologica, 56 (2011) Sambrook J, Fritsch E F & Maniatis T, Molecular cloning: A laboratory manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. (1989) 17 Ward R D, Zemlac T C, Innes B H, Last P R & Hebert P D N, DNA barcoding Australia s fish species. Phil. Trans. Royal Soc. B., 360 (2005) Hall T A, BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT, Nuc Acids Symp. Ser., 41 (1999) Wetzer R, Mitochondrial genes and isopod phylogeny (Peracarida: Isopoda), J. Crustacean Biol., 22 (2002) Kimura M, A simple method of estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences, J. Mol. Evol., 16 (1980) Kumar S, Tamura K & Nei M, MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinfo., 5 (2004) Tamura K, Estimation of the number of nucleotide substitutions when there are strong transitiontransversion and G+C content biases, Mole. Biol.Evol., 9 (4) (1992)

7 Table 1- Cymothoid species details used in this study and sample size (n). GenBank Accession Species n habit 16S rdna COI Reference Nerocila longispina 1 Skin Submitted Submitted Present study Joryma hilsae 1 Skin Submitted Submitted Present study Nerocila poruvae 1 Skin Submitted Submitted Present study Nerocila orbignyi 1 Skin - Submitted Present study Ceratothoa collaris 1 Mouth EF EF Ketmaier et al. (2008) 4 Anilocra physodes 2 Skin EF EF Ketmaier et al. (2008) 4 Nerocila bivittata 1 Skin EF EF Ketmaier et al. (2008) 4 Ceratothoa italica 3 Mouth EF EF Ketmaier et al. (2008) 4 Olencira praegustator 1 Gill AF AF Wetzer (2002) 18 Lironeca vulgaris 1 Gill AF AF Wetzer (2002) 18 Pentidotea resecata 1 Gill AF AF Wetzer (2002) 18 Crenoicus buntiae 1 Gill AF AF Wetzer (2002) 18 Cirolana rugicauda 1 Gill AF AF Wetzer (2002) 18 Table 2- K2P distance of Cymothoid parasites based on 16S rrna (below diagonal) and COI gene sequence (above diagonal) Species C. c A. p N. b C. i O. p L. v P. r C. b C. r N. l J. h N. p N. o Ceratothoa collaris Anilocra physodes Nerocila bivittata Ceratothoa italica Olencira praegustator Lironeca vulgaris Pentidotea resecata Crenoicus buntiae Cirolana rugicauda **** **** **** **** **** **** **** **** ****

8 Nerocila longispina Joryma hilsae Nerocila poruvae **** **** **** Table 3. Tajima test statistics for the 16S rrna and COI gene sequence of Cymothoid parasites Gene m S p s Θ π D 16S rrna COI m = number of sequences, S = Number of segregating sites, p s = S/m, Θ = p s /a 1, π = nucleotide diversity, and D= Tajima statistic value Figur Leagend Fig. 1. Neigbour Joining (NJ) estimate of the phylogenetic relationships among Cymothoid taxa obtained based on mitochondrial 16S rrna sequences Fig. 2. Neigbour Joining (NJ) estimate of the phylogenetic relationships among Cymothoid taxa obtained based on mitochondrial COI gene sequences 8