GH DEFICIENCY (GHD) in adults is associated with

Transcription

1 X/03/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 88(11): Printed in U.S.A. Copyright 2003 by The Endocrine Society doi: /jc Myostatin Is a Skeletal Muscle Target of Growth Hormone Anabolic Action WEI LIU, SCOTT G. THOMAS, SYLVIA L. ASA, NESTOR GONZALEZ-CADAVID, SHALENDAR BHASIN, AND SHEREEN EZZAT Department of Medicine (W.L., S.E.), Mount Sinai Hospital and University of Toronto; Faculty of Physical Education and Health (S.G.T.), University of Toronto; Department of Laboratory Medicine and Pathobiology, University Health Network and University of Toronto, Freeman Centre for Endocrine Oncology, and Ontario Cancer Institute (S.L.A.), Toronto, Ontario, Canada M5G 2M9; and Division of Endocrinology, Metabolism and Molecular Medicine (N.G.-C., S.B.), Charles R. Drew University of Medicine and Science, Los Angeles, California Myostatin is a cytokine that has recently been shown to selectively and potently inhibit myogenesis. To investigate the mechanisms of anabolic actions of GH on skeletal muscle growth, we examined the in vitro and in vivo effects of GH on myostatin regulation. Twelve GH-deficient hypopituitary adult subjects were treated with recombinant GH (5 g/kg d) in a double-blind, placebo-controlled fashion. Body composition and physical function were assessed and skeletal muscle biopsies from the vastus lateralis performed at 6-monthly intervals during 18 months of treatment. Myostatin mrna expression was significantly inhibited to 31 9% (P < 0.001) of control by GH but not by placebo administration (79 11%) as determined by quantitative real-time PCR normalized for the housekeeping glyceraldehyde-3-phosphate dehydrogenase Abbreviations: GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; GHD, GH deficiency; GHR, GH receptor; SPW, self-paced walking; VeT, ventilation threshold; VO 2 max, maximum oxygen uptake. gene. The inhibitory effect of GH on myostatin was sustained after 12 and 18 months of GH treatment. These effects were associated with increases in lean body mass and translated into enhanced aerobic performance as determined by maximal oxygen uptake and ventilation threshold. Parallel in vitro studies of skeletal muscle cells demonstrated significant reduction of myostatin expression by myotubes in response to GH, compared with vehicle treatment. Conversely, GH receptor antagonism resulted in up-regulation of myostatin in myoblasts. Given the potent catabolic actions of myostatin, our data suggest that myostatin represents a potential key target for GH-induced anabolism. (J Clin Endocrinol Metab 88: , 2003) GH DEFICIENCY (GHD) in adults is associated with excessive fatigue, impaired physical performance, and reduced skeletal muscle mass (1). That GHD is causally related to significant skeletal muscle impairment is supported by a wealth of studies demonstrating reversal of sarcopenia in response to systemic GH administration and increased circulating levels of its target IGF-I (2). We have previously used adult-onset GHD as a model to investigate the mechanisms of in vivo action of GH on skeletal muscle growth (1). We demonstrated that GH treatment increases submaximal measures of physical performance in concert with increases in skeletal muscle fiber size and local expression of IGF-I. The mechanism(s) by which GH mediates these anabolic actions on skeletal muscle growth, however, is not clear. A number of candidate cytokines have been implicated in differentiated skeletal muscle growth. Of these, myostatin (also known as growth/differentiation factor-8) is a member of the TGF family that has gained attention due to its remarkable expression profile and dramatic actions. Myostatin mutations have been linked to the double-muscled phenotype in cattle (3), and mice with targeted disruption of the myostatin gene display marked increase in skeletal muscle mass (4). In humans, hypercatabolic states such as HIVassociated wasting have been characterized by marked upregulation of myostatin (5), but little is known about its regulation. In this study, we tested the hypothesis that a potential mechanism for GH action on skeletal muscle may be suppression of locally synthesized myostatin. Using parallel examination of muscle biopsies from GH-deficient adults treated with GH or placebo and in vitro treatment of skeletal muscle cells, we demonstrate that GH effectively suppresses myostatin expression. Furthermore, we took advantage of a GH receptor (GHR) antagonist to demonstrate that attenuated GHR signaling results in significant upregulation of myostatin. The data strongly implicate myostatin as an important target of GH action in skeletal muscle. Patients and Methods Patients and treatment protocol The study was conducted in accordance with the principles of the Declaration of Helsinki and with approval from the University of Toronto human ethics review board and after patient written informed consent. Twelve patients (nine males and three females) with adult-onset (age, yr) hypopituitarism due to pituitary adenoma surgery (and radiation in three) who met the criteria of GHD (peak GH g/liter after an insulin tolerance test) of 1 yr stable pituitary hormone replacement including gonadal steroid hormones were recruited as previously described (6). After baseline assessments, patients were randomized in a double-blind manner to receive either placebo or recombinant human GH (Saizen; Serono, Rockland, MA) 5 g/kg night sc for 6 months. After completion of the placebo-controlled phase of the study, all patients received GH at an initial dose of 5 g/kg d for an additional 12 months of treatment. The study was unblinded at the 12-month time point after which the GH dose was reduced by 50% in those subjects complaining of persistent joint arthralgias. 5490

2 Liu et al. GH and Myostatin J Clin Endocrinol Metab, November 2003, 88(11): Body composition Body composition was assessed by whole-body dual-energy x-ray absorptiometry (model QDR-2000; Hologic, Inc., Bedford, MA), which was calibrated using a standard on the day of testing. Phantoms were used to monitor accuracy, precision, and trending variations over time. Aerobic fitness Aerobic fitness was measured during a continuous, progressive, pseudoramp treadmill walking protocol to symptom-limited maximum [American College of Sports Medicine guidelines (7)]. The initial treadmill work rate was based on the level of physical activity and fitness of each subject. Gas exchange was measured with a metabolic cart (MOXUS, AEI Technologies, Pittsburgh, PA). Measures included maximum oxygen uptake (VO 2 max) and ventilation threshold (VeT). VO 2 max was the highest oxygen uptake achieved. Objective criteria for ascertaining VO 2 max were that VO 2 and heart rate plateaued despite further increase in work rate. A noninvasive method was used to estimate VeT from ventilatory equivalents for oxygen and carbon dioxide as previously described (1, 8). Two treatment-blinded investigators were able to clearly identify VeT for 10 of 12 subjects at each of the four time points. Discrepancy in VeT between investigators was less than 10% in all cases. Self-paced walk Self-paced walking (SPW) speed in meters/second was measured using a computerized photocell timing device at normal and fast paces (9). At each visit, subjects walked 160 m in response to the instruction, Walk at a normal pace, neither fast nor slow ; after a 3- to 4-min rest, they were instructed to walk rather fast but without overexerting yourself. Circulating growth factors Serum GH and IGF-I levels were measured using immunoassays from Diagnostic Systems Laboratories (Webster, TX) as described previously (8). Muscle biopsies Muscle biopsies from the vastus lateralis muscle of the dominant leg were obtained at baseline and the different time points as described previously (1). After extraneous connective tissue and fat were removed, samples were snap frozen in liquid nitrogen and stored at 80 C for batch analysis. Muscle biopsy samples were homogenized and total RNA was prepared using Tri Reagent (Molecular Research Center, Inc., Cincinnati, OH) according to the manufacturer s instructions. Real-time quantitative PCR Four hundred nanograms of total RNA were reverse transcribed in 30 l reaction mixture containing 250 m of each deoxynucleotide triphosphate, 20 U ribonuclease inhibitor, and reverse transcriptase using TaqMan reverse transcription reagents (Applied Biosystems, Inc., Branchburg, NJ). The reaction mixture was incubated at 25 C for 10 min, 48 C for 30 min, and 95 C for 5 min. PCR was performed on cdna samples in triplicate using an ABI PRISM 7700 sequence detection system (Applied Biosystems, Inc.). The TaqMan PCR core reagent kit was used according to the manufacturer s protocol (Applied Biosystems, Inc.). The primers and probe for amplification of human myostatin (forward, 5 -TGGTCATGATCTTGCTGTAACCTT-3, reverse, 5 - TGTCTGTTACCTTGACCTCTAAAA ACG-3 ; probe, 5 -CCAGGAC- CAGGAGAAGATGGGCTGAAT-3 ) were designed using the Primer Express 1.0 software (Applied Biosystems). These primers are situated in exons 2 and 3, and the hybridization probe spanned an intron to exclude annealing to genomic DNA. When used in a conventional RT- PCR reaction, they yield the predicted 80-bp product whose identity was confirmed by DNA sequencing. As an endogenous control, the primers and probe for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (TaqMan GAPDH control reagents; Applied Biosytems, Inc., Foster, CA) were used to normalize for variations in RNA. After optimization, PCR reactions were performed in a 25- l volume containing 2 l cdna, 5.5 mm MgCl 2, 200 m datp, dctp, dgtp, and 400 m deoxyuridine 5-triphosphate, 200 nm of each primer, 100 nm of each probe, 0.01 U/ l AmpErase uracil-n-glycosylate, and U/ l AmpliTaq Gold DNA polymerase using the following conditions: 50 C for 2 min, 95 C for 10 min, 40 cycles of 95 C for 15 sec, and 60 C for 1 min. The results were analyzed using a comparative method similar to a standard curve model, except it uses an arithmetic formula to derive the same result for relative quantitation as suggested by the manufacturer. The amount of target, normalized to the endogenous reference and relative to a calibrator, is given by the formula 2 - Ct, where Ct represents the threshold cycle, indicating the fractional cycle number at which the amount of amplified target reaches a fixed threshold. Cell culture, RNA, and RT-PCR analysis The mouse C2C12 skeletal muscle cell line was cultured in DMEM containing 10% fetal bovine serum (Gibco BRL, Gaithersburg, MD), 2 mm l-glutamine, and antibiotics. These cells initially have a myoblast phenotype with minimal myostatin expression. As myoblasts reached 90% confluence, the medium was changed to DMEM containing 2% horse serum (Gibco BRL). Seven to 10 d of additional incubation were required for myotube differentiation when myostatin levels rose. Treatment with rodent GH (National Hormone and Peptide Program, Harbor University of California Los Angeles Medical Center, Torrance, CA) or the GH antagonist (pegvisomant; Pharmacia Corp., Arlington Heights, IL), which is known to bind the mouse GHR (10), was performed at different doses and times ranging from 12 to 48 h. Total RNA was extracted from the cells with TriZol reagent (Invitrogen Corp., Carlsbad, CA) according to the manufacturer s instructions, and cdna was synthesized using TaqMan reverse transcription reagents kit as above. To compensate for variations in RNA, multiplex PCR was performed using the following primers: myostatin, forward, 5 -AGA- CAAAACACGAGGTACTC-3, reverse, 5 -TGGATTCAGGCTGTTT- GAGC-3 generating a 532-bp product; GAPDH, forward, 5 -ATCACT- GCCACCCAGAAGACT-3, reverse, 5 -CATGCCAGTGAGCTTCCC- GTT-3 generating a 153-bp product. PCR reactions contained a fifth of the cdna reaction, 0.4 m of each primer, 0.4 mm deoxynucleotide triphosphate, 1 PCR buffer, 1.5 mm MgCl 2, and 2 U AmpliTaq DNA polymerase (PE Applied Biosystems, Foster City, CA) in a final volume of 25 l. Reaction conditions included denaturation at 94 C for 5 min, followed by 35 cycles at 94 C for 15 sec, annealing at 56 C for 30 sec, and extension at 72 C for 1 min, followed by a 10-min final extension at 72 C. PCR products were separated on a 1.5% agarose gel. Western blotting After treatment with GH, GH antagonist, or vehicle controls, cells were lysed in radioimmunoprecipitation assay buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 100 g/ml phenylmethylsulfonyl fluoride, aprotinin, and sodium orthovanadate in PBS). Total cell lysates were incubated on ice for 30 min, followed by microcentrifugation at 10,000 g for 10 min at 4 C. Fifty micrograms of protein were separated by 12% sodium dodecyl sulfate-polyacrylamide electrophoresis and transferred onto nitrocellulose membranes, which were blocked in 5% nonfat milk and 0.1% Tween 20 in TBS [20 mm Tris-Cl and 500 mm NaCl (ph 7.5)] for 1 h and incubated overnight at 4 C with a polyclonal antimyostatin antibody at 1:1000 (11) or actin (1:500; Sigma, St. Louis, MO). After washing, membranes were incubated for 1 h at room temperature with peroxidase-conjugated secondary antibody (1:2000; Santa Cruz Biotechnology Inc., Santa Cruz, CA). Protein bands were visualized by chemiluminescence as described by the supplier (Amersham, Oakvilla, Ontario, Canada) and band intensities quantified by densitometric scanning. Statistical analysis All data are presented as mean sem. We used two-way ANOVA with a repeated-measures design to compare the outcome measures in patients treated with GH with those receiving placebo and each group with baseline levels. The time in treatment (baseline or 6, 12, or 18 months) and the type of treatment (GH or placebo) were the two factors in two-way ANOVA. If the overall ANOVA revealed a significant effect, the statistical significance of the between-group differences was tested

3 5492 J Clin Endocrinol Metab, November 2003, 88(11): Liu et al. GH and Myostatin by the Tukey-Kramer multiple comparison procedure. The repeated measures analysis compares amount of change over time between groups and is considered to be appropriate for relatively small sample sizes such as employed in this study. Similarly, the effects of GH treatment on myostatin in vitro in C2C12 muscle cell cultures were analyzed by a two-way ANOVA, with the different GH doses and incubation times as the two factors. The alpha for these comparisons was set at 0.05; thus, P values 0.05 were considered significant. Results Effect of GH on serum IGF-I levels GH treatment had the anticipated effect on circulating IGF-I levels with a significant increase observed between baseline and 6 months in the treatment group (change in IGF-I, 267 g/liter; P 0.001), whereas no significant change was observed in the placebo-treated group (4.3 g/liter; P 0.94). Serum IGF-I did rise from 6 to 12 months in patients who started receiving GH at 6 months (change in IGF-I 230 g/liter; P 0.004). Serum IGF-I values declined (change in IGF-I 148 g/liter; P 0.002) to g/liter (Fig. 1) because the GH dose was reduced by half in four subjects due to joint pain. All four subjects had achieved IGF-I levels more than 50% above their age-matched controls. Effect of GH on lean body mass Total body mass and body mass indices were not significantly altered over time regardless of treatment. Mean lean body mass increased by 2.53 kg after 6 months of GH treatment (P 0.01) but did not change significantly with placebo (mean change kg, P 0.05). Twelve months of GH treatment increased lean body mass by 4.53 kg (P 0.005). By 18 months of GH treatment, the increase from baseline in lean body mass, compared with baseline, was slightly less (3.92 kg; P 0.001), possibly due to GH dose reduction (Fig. 1). Aerobic function To determine whether the changes in lean body mass observed in this group of subjects were translated into altered muscle function, we examined the effect of treatments on aerobic performance. There was no significant difference in VeT or VO 2 max between the GH and placebo-treated groups at baseline. VO 2 max increased significantly over the first 6 months of GH treatment (mean increase, 7.4 ml/ kg 1 min 1, P 0.016) but was not significantly influenced by placebo treatment (mean change 3.7 ml/kg 1 min 1, P 0.26) (Fig. 2, top). VeT increased by 4.0 ml/kg 1 min 1 (P 0.09) for the group receiving GH, whereas patients receiving placebo did not exhibit a significant change in VeT (mean difference of 1.4 ml/kg 1 min 1, P 0.61) (Fig. 2, bottom). By 12 months of GH treatment, the increase in the combined group was 3.9 ml/kg 1 min 1 (P 0.02). Functional performance SPW speed was not significantly changed from the baseline value in either placebo or GH-treated group across the measurement points. No significant change between baseline and 6 months was observed for the GH treatment group FIG. 1. Effect of GH treatment on circulating IGF-I levels ( g/liter) and lean body mass changes in GH-deficient adults. Twelve GHdeficient adults were randomized for treatment with either GH (5 g/kg d) or equivalent placebo for 6 months. After the initial phase of the study, all subjects received GH for an additional 12 months. Due to persistent arthralgias, the GH dose was reduced at the 1-yr time point in four subjects, resulting in a decline in circulating IGF-I levels and lean body mass change. Statistically significant differences (*, P 0.05 by ANOVA), compared with baseline were noted for GH but not placebo at all time points. (mean change of m s 1, P 0.05) or the placebo group (mean change of 0.03, P 0.05). Normal walking pace was 1.34 m/s 1 at baseline and 1.39 m s 1 after 18 months. Similarly fast walking pace was not significantly altered from baseline ( ) after 18 months of treatment ( ). No significant change in fast SPW between baseline and 6 months was observed for the GH treatment group (mean change 0.02 m/s 1, P 0.05) or the placebo group ( 0.08 m/s 1, P 0.05). Effect of GH on tissue myostatin in GH-deficient adults Myostatin mrna expression was significantly inhibited to 31 9% (P 0.001) in response to GH administration (Fig. 3). In contrast, myostatin levels were not greatly affected

4 Liu et al. GH and Myostatin J Clin Endocrinol Metab, November 2003, 88(11): FIG. 3. Effect of GH treatment on myostatin mrna expression in GH-deficient subjects. Skeletal muscle biopsies were obtained from vastus lateralis muscles of adult hypopituitary patients treated with GH or placebo as indicated. RNA was isolated and subjected to realtime PCR for myostatin adjusted internally for GAPDH as detailed in Patients and Methods. Note the selective effect of GH, but not placebo, treatment on myostatin inhibition. Note also the 18-month time point increase in myostatin levels, mirroring changes in circulating IGF-I levels and lean body mass changes associated with the GH dose reduction. Statistically significant differences (*, P 0.05), compared with baseline control, were reached after 6, 12, and 18 months of GH treatment but not in placebo-treated subjects. FIG. 2. Impact of GH-induced lean body mass increase on physical performance. The influence of GH treatment-associated changes in body composition on physical performance was examined by gas exchange to determine VO 2 max (top) and VeT (bottom). The increases in measures of exercise aerobic function achieved statistical significance (compared with baseline; denoted by asterisks) when the groups received 12 months of GH treatment. after 6 months of treatment with placebo (79 11%) as determined by quantitative real-time PCR normalized for the housekeeping GAPDH gene. Interestingly, the inhibitory effect of GH on myostatin was sustained during the course of GH administration. After 12 months of GH treatment, myostatin levels remained significantly depressed (37 6%; P 0.01), compared with baseline. In line with the impact of GH dose reduction on circulating IGF-I levels and body composition, the inhibitory effect on myostatin was sustained but slightly attenuated at 18 months (48 5%; P 0.01) of treatment (Fig. 3). Effect of GH and GH antagonism on myostatin in skeletal muscle cells To determine whether the effects of GH treatment observed in vivo represent a potential direct influence of GH on myostatin regulation, the effect of GH was tested in vitro using the well described skeletal muscle C2C12 cell line. Twenty-four-hour treatment with GH resulted in inhibition of myostatin mrna in myotubes, compared with baseline levels (Fig. 4). Treatments up to 48 h were not associated with significantly different responses (not shown). To examine the specific effect of GH signaling on myostatin regulation, we took advantage of the GHR antagonist pegvisomant. Treatment of cells with this compound was performed at the myoblast phase under low serum (2%) conditions when myostatin levels are endogenously depressed (11). This treatment resulted in a dose-dependent ( ng/ml) up-regulation of myostatin expression adjusted for the GAPDH housekeeping gene (Fig. 4). These findings are consistent with antagonism of GH present in serum. Interestingly and for unclear reasons, a supramaximal dose (0.8 g/ml) of pegvisomant resulted in a relative decline in myostatin mrna levels. To determine whether these myostatin mrna changes were reflected by protein levels, treated cells were also examined by Western immunoblotting. As reported previously (11), myoblasts displayed undetectable levels of myostatin, compared with myotubes (Fig. 5, left). GH treatment of myotubes resulted in attenuation of myostatin protein levels (Fig. 5, right), whereas treatment with the GH antagonist pegvisomant resulted in up-regulation of myostatin protein (Fig. 5). These findings are consistent with the trends observed in mrna changes. Discussion Evidence from experimental animal and human data confirms the role of GH in regulating DNA, RNA, and protein synthesis in several tissues (2). GH stimulates growth in several tissues through the action of its target, IGF-I. Indeed, we previously demonstrated that human skeletal muscle represents an important target of GH action with local mus-

5 5494 J Clin Endocrinol Metab, November 2003, 88(11): Liu et al. GH and Myostatin FIG. 4. Effect of GH or GH antagonist on myostatin mrna expression. Skeletal muscle C2C12 cells were cultured as described in Patients and Methods. At the myotube phase of differentiation (left), cells were treated with GH or vehicle, or at the myoblast stage (right) when basal myostatin levels are lowest for treatment with the GH antagonist (GHa) at the indicated doses. After 24 h of incubation, cells were lysed, RNA extracted and subjected to multiplex RT-PCR for myostatin and the housekeeping GAPDH gene. A representative gel is shown. Densitometric analysis of results (mean SEM in arbitrary units) obtained from three independent experiments are shown in the corresponding bar graphs. Statistically significant changes (P 0.05) compared with control are indicated with an asterisk. cle IGF-I mrna increasing in response to systemically administered GH (1). Furthermore, we showed that the increase in IGF-I mrna expression correlates with increased muscle fiber size, primarily involving type I fibers (1). The mechanisms by which the GH/IGF-I axis regulates skeletal muscle growth, however, remain unclear. Myostatin is now well recognized as a negative regulator of myogenesis through control of myoblast proliferation and inhibition of differentiation to myotubes (12). Consistent with the established role of the Smad family in mediating TGF signaling, myostatin-induced inhibition of myoblast differentiation was shown to be mediated through Smad 3 by interfering with myogenic factor MyoD activity (12). This model is consistent with the notion that myostatin plays a critical role in myogenic differentiation, and that the hypertrophy seen in the absence of this factor is possibly the result of increased proliferation and disrupted differentiation of myoblasts. Myostatin might also have additional effects on muscle protein synthesis (11). Although a recent study of systemically administered GH in healthy elderly males failed to identify significant alterations in myostatin mrna expression, it also showed no significant effect on lean body mass (13). Our study was conducted in hypopituitary adults in whom we documented a significant increase in lean body mass that was also accompanied by myostatin down-regulation. The difference between the two studies may thus be accounted for by the difference in study populations, which is consistent with other known differences in GH effects in the two populations. It should be noted that another group demonstrated that GHR mrna levels negatively correlate with myostatin mrna levels in elderly healthy males (14). In hypophysectomized rats, administration of GH increases muscle mass and restores the proportion of fatigueresistant type 1 muscle fibers (15). GH administration in GH-deficient humans, however, resulted in conflicting findings (16). Despite robust evidence of significant muscle atrophy from body composition measures and computerized tomographic studies, previous work failed to demonstrate a consistent change in muscle fiber type cross-sectional areas or proportions in GH-deficient patients (16). Some have concluded that the differences were not significant due to a lack of power, given the relatively small sample size in human studies. In the current study, we observed an increase in lean body mass of 5% in the first 6 months of GH treatment. This increase occurred across the same time interval as the decreased myostatin expression. These observations suggest that GH-induced reduction in myostatin expression may at least play a permissive role in GH-associated anabolic action on skeletal muscle mass. Human adults with GHD frequently complain of muscle weakness and fatigue (16). In a previous study, we documented deficits in aerobic function (VeT), which related to the level of fatigue reported by the GHD patients (1). Our current findings, that both VeT and aerobic power (VO 2 max) increase with GH treatment, are congruent with that previous report. We observed an increase of VO 2 max in the GH group that was approximately 20% above that observed in the placebo group. Cuneo et al. (16) similarly observed a 17% increase in VO 2 max in response to 6 months of GH treatment. In addition, Beshyah et al. (17) observed progressive increases in exercise endurance time over months of GH treatment in GH-deficient adults. GH treatment displays multiple actions through several components of the oxygen transport system including increasing red cell mass, blood volume, and cardiac function (18, 19). Cardiac systolic function, in particular, is well doc-

6 Liu et al. GH and Myostatin J Clin Endocrinol Metab, November 2003, 88(11): FIG. 5. Effect of GH on myostatin protein expression in C2C12 cells. Western immunoblotting demonstrates that myoblasts do not express detectable levels of myostatin compared with myotubes. At the myotube phase of differentiation, cells were treated with GH (left), whereas myoblasts were treated with the GH antagonist pegvisomant (right) or vehicle control for 24 h as described in Patients and Methods. Cells were subsequently lysed and subjected to immunoblotting with a polyclonal antimyostatin (MST) antibody (52 kda) or actin (42 kda). A representative gel is shown. Densitometric analysis of MST/actin ratios (mean SEM in arbitrary units) are shown immediately below. Significant changes (P 0.01), compared with basal levels, are denoted by an asterisk. umented to improve with GH treatment of both male and female GH-deficient subjects (6). Oxygen uptake, however, depends not only on the delivery of oxygen but is highly dependent on the ability of muscle tissue to consume oxygen (20). As such, GH-induced increased lean body mass changes may also permit increased consumption of oxygen contributing to the diminished sense of fatigue in GH-deficient subjects (1). Furthermore, measures of oxygen uptake also serve as one physiologic indicator of biologically relevant increases in lean body mass in this population. Isometric quadriceps strength is nearly 35% lower in GHdeficient adults, compared with age-matched controls, suggesting decreased intrinsic muscle strength (21). Studies evaluating the effects of GH treatment on the relationship between thigh muscle mass and muscle strength in GHdeficient adults using computerized tomography (16, 22), magnetic resonance imaging (23), and muscle biopsies (24) have reported that the increase in muscle mass is only partially accompanied by an increase in strength of the quadriceps extensor mechanism. These findings emphasize that increases in muscle mass in the absence of peripheral or central neural adaptations in motor unit recruitment may not be sufficient to enhance peak force production. Indeed, despite the increases in lean body mass and increased exercise capacity indicated by a higher VeT and VO 2 max in our study, we did not observe a significant increase in SPW pace. This is consistent with the notion that muscle atrophy is most amenable to combinations of exercise and growth factor manipulation (25 27). The optimal approach to improve muscle function may be to combine exercise with GH treatment to improve neural activation and enzymatic processes, in addition to the increase in muscle mass that occurs, to enable maximum force production. Our current data would also suggest that measures that can further inhibit myostatin may help augment the anabolic effects of GH on skeletal muscle growth. Acknowledgments Received March 21, Accepted August 6, Address all correspondence and requests for reprints to: Dr. S. Ezzat, University of Toronto Mt. Sinai Hospital, 600 University Avenue, #437, Toronto, Ontario, Canada M5G-1X5. sezzat@mtsinai.on.ca. References 1. Woodhouse LJ, Asa SL, Thomas SG, Ezzat S 1999 Measures of submaximal aerobic performance evaluate and predict functional response to growth hormone (GH) treatment in GH-deficient adults. J Clin Endocrinol Metab 84:

7 5496 J Clin Endocrinol Metab, November 2003, 88(11): Liu et al. GH and Myostatin 2. Jones JI, Clemmons DR 1995 Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16: Kambadur R, Sharma M, Smith TP, Bass JJ 1997 Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res 7: Szabo G, Dallmann G, Muller G, Patthy L, Soller M, Varga L 1998 A deletion in the myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice. Mamm Genome 9: Gonzalez-Cadavid NF, Taylor WE, Yarasheski K, Sinha-Hikim I, Ma K, Ezzat S, Shen R, Lalani R, Asa S, Mamita M, Nair G, Arver S, Bhasin S 1998 Organization of the human myostatin gene and expression in healthy men and HIV-infected men with muscle wasting. Proc Natl Acad Sci USA 95: Ezzat S, Fear S, Gaillard RC, Gayle C, Landy H, Marcovitz S, Mattioni T, Nussey S, Rees A, Svanberg E 2002 Gender-specific responses of lean body composition and non-gender-specific cardiac function improvement after GH replacement in GH-deficient adults. J Clin Endocrinol Metab 87: American College of Sports Medicine 1988 Resource manual for guidelines for exercise testing and prescription. Philadelphia: Lea, Febiger; Thomas SG, Woodhouse LJ, Pagura SM, Ezzat S 2002 Ventilation threshold as a measure of impaired physical performance in adults with growth hormone excess. Clin Endocrinol (Oxf) 56: Bassey EJ, Fentem PH, MacDonald IC, Scriven PM 1976 Self-paced walking as a method for exercise testing in elderly and young men. Clin Sci Mol Med Suppl 51: Van Neck JW, Dits NF, Cingel V, Hoppenbrouwers IA, Drop SL, Flyvbjerg A 2000 Dose-response effects of a new growth hormone receptor antagonist (B2036-PEG) on circulating, hepatic and renal expression of the growth hormone/insulin-like growth factor system in adult mice. J Endocrinol 167: Taylor WE, Bhasin S, Artaza J, Byhower F, Azam M, Willard Jr DH, Kull Jr FC, Gonzalez-Cadavid N 2001 Myostatin inhibits cell proliferation and protein synthesis in C2C12 muscle cells. Am J Physiol Endocrinol Metab 280:E221 E Langley B, Thomas M, Bishop A, Sharma M, Gilmour S, Kambadur R 2002 Myostatin inhibits myoblast differentiation by down-regulating MyoD expression. J Biol Chem 277: Brill KT, Weltman AL, Gentili A, Patrie JT, Fryburg DA, Hanks JB, Urban RJ, Veldhuis JD 2002 Single and combined effects of growth hormone and testosterone administration on measures of body composition, physical performance, mood, sexual function, bone turnover, and muscle gene expression in healthy older men. J Clin Endocrinol Metab 87: Marcell TJ, Harman SM, Urban RJ, Metz DD, Rodgers BD, Blackman MR 2001 Comparison of GH, IGF-I, and testosterone with mrna of receptors and myostatin in skeletal muscle in older men. Am J Physiol Endocrinol Metab 281:E1159 E Ayling CM, Moreland BH, Zanelli JM, Schulster D 1989 Human growth hormone treatment of hypophysectomized rats increases the proportion of type-1 fibres in skeletal muscle. J Endocrinol 123: Cuneo RC, Salomon F, Wiles CM, Hesp R, Sonksen PH 1991 Growth hormone treatment in growth hormone-deficient adults. II. Effects on exercise performance. J Appl Physiol 70: Beshyah SA, Shahi M, Foale R, Johnston DG 1995 Cardiovascular effects of prolonged growth hormone replacement in adults. J Intern Med 237: Christ ER, Cummings MH, Westwood NB 1997 The importance of growth hormone in the regulation of erythropoiesis, red cell mass, and plasma volume in adults with growth hormone deficiency. J Clin Endocrinol Metab 82: Lombardi G, Colao A, Ferone D, Marzullo P, Orio F, Longobardi S, Merola B 1997 Effect of growth hormone on cardiac function. Horm Res 48(Suppl 4): Lindstedt SL, Wells DJ, Jones JH, Hoppeler H, Thronson Jr HA 1988 Limitations to aerobic performance in mammals: interaction of structure and demand. Int J Sports Med 9: Cuneo RC, Salomon F, Wiles CM, Sonksen PH 1990 Skeletal muscle performance in adults with growth hormone deficiency. Horm Res 33(Suppl 4): Jorgensen JO, Pedersen SA, Thuesen L, Jorgensen J, Ingemann-Hansen T, Skakkebaek NE, Christiansen JS 1989 Beneficial effects of growth hormone treatment in GH-deficient adults. Lancet 1: Janssen YJ, Doornbos J, Roelfsema F 1999 Changes in muscle volume, strength, and bioenergetics during recombinant human growth hormone (GH) therapy in adults with GH deficiency. J Clin Endocrinol Metab 84: Cuneo RC, Salomon F, Wiles CM, Round JM, Jones D, Hesp R, Sonksen PH 1992 Histology of skeletal muscle in adults with GH deficiency: comparison with normal muscle and response to GH treatment. Horm Res 37: Grindeland RE, Roy RR, Edgerton VR, Grossman EJ, Mukku VR, Jiang B, Pierotti DJ, Rudolph I 1994 Interactive effects of growth hormone and exercise on muscle mass in suspended rats. Am J Physiol 267:R316 R Linderman JK, Gosselink KL, Booth FW, Mukku VR, Grindeland RE 1994 Resistance exercise and growth hormone as countermeasures for skeletal muscle atrophy in hindlimb-suspended rats. Am J Physiol 267:R365 R Roy RR, Tri C, Grossman EJ, Talmadge RJ, Grindeland RE, Mukku VR, Edgerton VR 1996 IGF-I, growth hormone, and/or exercise effects on nonweight-bearing soleus of hypophysectomized rats. J Appl Physiol 81: