Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus

Transcription

1 Acta Zoologica Taiwanica 10(2): (1999) Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus Tzi-Yuan Wang 1, Chyng-Shyan Tzeng 1, and Shih-Chieh Shen 2 1 Department of Life Science, National Tsing Hua University, Hsinchu, Taiwan 30043, R.O.C. 2 Department of Zoology, National Taiwan University, Taipei, Taiwan 10617, R.O.C. ABSTRACT The paradise fish (Macropodus opercularis) is naturally distributed in western Taiwan, but is rare now because of such factors as environment pollution and habitat loss. Conservation of this animal in Taiwan is becoming more urgent. Some closely related species, such as Chinese paradise fish (M. chinensis), are difficult to distinguish with morphological characters. We sequenced and compared the control region of mitochondrial DNA (mtdna) to reveal the genetic distance and molecular phylogeny of paradise fish populations from different geographical regions: Taiwan, Singapore, and mainland China. The interspecific distance between M. opercularis (Taiwan, Singapore) and M. chinensis (Zhejiang, Jilin) is ±0.0124, much more highly divergent than the distance between the Taiwanese and Singaporean populations, or within the Chinese populations. Five haplotypes from 11 specimens of the Taiwanese native population have been identified from a 1034-bp-length of mtdna. However, the lower haplotypic diversity (H = 0.68) indicates a decreasing population in Taiwan, in contrast with the M. chinensis (H = 0.89). In addition, the unique genotype in Miaoli and Taichung may imply their subdivision because of exotic input of fish from a different geographic region. Thus conservation work should focus on avoiding the random release of paradise fishes into the wild. Key words: Macropodus opercularis, Paradise fish, Mitochondrial DNA, Taiwan INTRODUCTION Only three species of Anabantoidei fishes occur in Taiwan: Anabas testudineus, Macropodus opercularis, and Tricogaster trichopterus. A. testudineus is close to extirpation on this island, while the last species is assumed to have been introduced from other areas. As a result, paradise fish, M. opercularis, is the only species of the Subfamily Macropodinae, Perciformes: Belontiidae (Forselius, 1957; Liem, 1963; Nelson, 1994) in Taiwan. The so-called colorful rabbit sold for aquariumuse is actually an introduced man-bred paradise fish strain. Some strains of paradise fish interbred with other species have also become popular in the aquatic pet market. Paradise fish was also one of the first tropical fishes that 19th century Europeans kept as pets (Shen et al., 1991). Taiwan paradise fish can be further divided into four groups, according to their body color: Nankang (Taipei) type, Sanyi (Miaoli) type, Shyrshoeike (Taichung) type, and Malaysia peninsula type (Jan et al., 1992). The natural distribution of paradise fish has been in western Taiwan, but is now limited because of environment pollution, habitat loss, etc. M. opercularis is dispersed extensively in plain and lower-elevation hills of western and northeastern Taiwan. Natural ponds, minor creeks, and farm drains areas-slow-moving, nearly quiescent waters are the preferred habitats. However, the broad distribution has dwindled to a sporadic occurrence according 121

2 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen Table 1. Collection data and sample information. Bold letters indicate that the samples are collected from aquarium. The others are all native populations in this investigation. Scientific name Region, Country Colony Specimens number (analyzed number) Macropodus opercularis (Mo) Taipei, Taiwan MN 2 (1) Hsinchu, Taiwan MB 3 (2) Miaoli, Taiwan MS 4 (2) Taichung, Taiwan MK 3 (3) Chiayi, Taiwan MJ 3 (2) Pingtung, Taiwan MP 3 (1) Aquarium, Taiwan MU 3 (1) Duan, Guangxi DA 5 (*) Juhae, Guangdong JH 4 (*) Aquarium, Singapore SG 2 (2) Macropodus chinensis (Mc) Wuyih, Zhejiang WE 5 (3) Jyrlin, Jyrlin GL 2 (2) Trichopsis pumilus (Tp) Aquarium TP 3 (2) Betta splendens (Bs) Aquarium BS 3 (3) * Sample was preserved in formalin without successful mtdna sequence data. to a 1991 investigation (Shen et al., 1991; Jan and Wu, 1994), despite the government's announcement to place the paradise fish in the list of rare and valuable species on 31 Aug Kimura (1937) first reported and established data of the Anabantidae fishes in China. Chen (1969) reported A. scandens and M. opercularis (Synonyms names: M. polyacanthus Linnaeus, M. viridiauratus Oshima) in Taiwan thereafter. Chen (1969) stated that M. opercularis could be found in Taipei, Taichung, and Luotung. Fig. 1A illustrates the distribution of the species native to southern China, the Malaysia peninsula, Hainan I., Okinawa, and Taiwan (Oshima, 1934; Nelson, 1994). Both Hong Kong- and Japan-inhabiting paradise fishes belong to either M. opercularis or M. chinensis (Oshima, 1934; Wen, 1981). Some similar species, such as Chinese paradise fish (M. chinensis) and M. opercularis, are difficult to distinguish solely with morphological characters. The Chinese paradise fish originally spread from the western Korean peninsula, then west of the Luohtung River to mainland China, to the north of the Yangtze River. The specimens in Japan were introduced from the Korean peninsula in 1914, and have proven capable of reproducing in the wild. Recently, Wakiyama (1997) employed 12 allozyme markers to analyze the relationships among 17 species of Anabantoid fishes. The result confirmed anatomy-based classification of five Macropodinae species: Betta splendens and M. opercularis were grouped together with Parosphromenus deissneri, whereas Trichopsis vittatus and Pseduosphromenus dayi constituted a separate group. Jan and Wu (1994) investigated M. opercularis since 1992, and 12 isolated, native, but small populations are found in this investigation. Conservation of M. opercularis remains pressing, and conserving the genetic diversity between populations will directly influence their long-term chance of survival. Resolving molecular phylogeny between two paradise fishes (M. opercularis and M. chinensis) appears to be the key to these problems, because they are confused by traditional taxonomic methods. The mitochondrial DNA (mtdna) control region has been shown to be a powerful marker in the analysis of inter- and intra-specific genetic differentiation owing to the implementation of rapid evolution rates than 122

3 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus (A) (B) Figure 1. Distribution of Macropodinae fishes in Asia (A); and (B) sampling locations of paradise fishes in Singapore (SG), China (DA, JH, WE, GL), and Taiwan (MN, MB, MS, MJ, MP). Detailed information is given in table 1. remainder of the mtdna genome (Brown et al., 1986; Lee et al., 1995; Sbisae et al., 1997). Maternal inheritance of mtdna genes also provides a sensitive tool for the detection of population subdivision (Birky et al., 1989). In this study, we examine the genetic divergence among samples of M. opercularis and M. chinensis using the entire mtdna control region to reveal the genetic information of M. opercularis. Betta splendens and Trichopsis pumilus are utilized as outgroups to compare the molecular phylogeography among different populations of M. opercularis. MATERIALS AND METHODS Sample collection and DNA extraction A total of 45 fully grown fishes were collected from western Taiwan, Zhejiang, Jilin, Guangdong, Guangxi, and Singapore from Sep to Dec (Fig. 1, Table 1). Specimens from Taiwan were kept alive in the laboratory. Total genomic DNA was extracted from muscle or fin tissue, using a protocol modified from Kocher et al. (1989). Approximately 50 mg of muscle tissue was placed in 700 µl of digestion buffer (10 mm Tris-HCl, ph 8.0; 2 mm EDTA, 10 mm NaCl, 1% SDS, 10 mg/ml DTT, 0.5 mg/ml Proteinase K) and incubated overnight at 45 to 55 C. Proteins and lipids were removed by phenol-chloroform extraction. DNA was precipitated at -20 C by adding two volumes of 100% ethanol. Pellets were washed with 70% ethanol, dried and resuspended in 50 µl TE (10 mm Tris-HCl, ph8.0; 1 mm EDTA, ph 8.0). PCR amplification and sequencing A segment of mtdna that encompasses a part of the cytochrome b gene, trna Thr gene, trna Pro gene, the control region, and a part of trna Phe gene, was chosen for sequencing analysis. The primers, Ec7, G22A, PE3, and PK3-2A, were modified from Tzeng et al. (1992); the primer PU was modified from Jean et al. (1995); the primers, PE4-1, PU4-1 and PU4-2, were used only for sequencing (Fig. 2, Table 2). PCR amplifications were performed in a 50- µl reaction volume containing 0.2 mm of dntp, 0.2 µm of each primers and ng of genomic DNA, 1 unit of Taq polymerase (HT Biotechnology Ltd., England), and the buffer supplied by the manufacturers. The amplification conditions were as follows: cycles at 93 C for 1 min of denaturation, annealing at 45 to 55 C for 1 min, and exten- 123

4 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen Table 2. List of primers used in this study. Name Primer sequence Location of mtdna Ec7 5 -ATYCTACGRTCAATYCC-3 Cytochrome b PE3 5 -AACTTCCATCCTCAACTCCCAAAGC-3 Pro-tRNA PE TAATAATTATWCAGGAC-3 Control region PK3-2A 5 -CTATTACTGGCATCTGG-3 Control region G22A 5 -TGKWCCTGAAATAGGAACC-3 Control region PU TYYTAGGAGTTTAGGGGG-3 Control region PU GCTTTAATTAAGCTACG-3 Phe-tRNA PU 5 -GGGCATTCTCACGGGGATGCG-3 Phe-tRNA Figure 2. Schematic diagram of partial mtdna and the locations of eight primers. The primers, indicated by arrows, were used for amplification and sequencing. For the sequence of each primer see table 2. Table 3. Specimen number and their haplotypes of mtdna among different colonies. MN MB MS MK MJ MP MU SG WE GL TP BS Mo Mo2 2 Mo3 2 Mo4 1 Mo5 1 Mo6 1 Mc1 1 Mc2 1 Mc3 1 Mc4 1 Mc5 1 Tp1 2 Bs1 3 sion at 72 C for 1 min; a final extension reaction of 10 min at 72 C was always added. Control reactions contained no template DNA. PCR product sizes were visualized by 1.5% agarose gel electrophoresis and ethidium bromide staining; molecular weights were estimated by comparison to the Bio100 DNA Ladder (PROtech Technology, Inc., USA). For sequencing, the amplification procedure was performed three times, and the doublestranded PCR product mixtures were used as the template for sequencing, which was carried out by using the Sequenase PCR Product Sequencing Kit (United States Biochemical, USA). At least one specimen from each population was analyzed. Each sample was sequenced in both directions to eliminate ambiguous positions. To assure accuracy, new haplotypes were amplified and sequenced twice. 124

5 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus Table 4. genetic divergence of paradise fishes constructed by the Kimura two-parameter model. The upper triangle matrix represents genetic distance, the lower standard error. Number indicates in bold indicate intraspecific divergence. OTUs Mo1 Mo2 Mo3 Mo4 Mo5 Mo6 Mc1 Mc2 Mc3 Mc4 Mc5 Mo Mo Mo Mo Mo Mo Mc Mc Mc Mc Mc The average divergence of Macropodus opercularis is ± ; the average divergence of Macropodus chinensis is ± ; and the average divergence between these two species is ± Data analysis mtdna sequences including a part of the cytochrome b gene, two trna genes ( trna Thr and trna Pro ), and the control region (D-loop), were aligned using the Pileup program of the GCG software package (Genetic Computer Group, version 9.1; Devereux et al., 1997), and then compared with published mtdna sequences of other fishes to verify the boundaries of the genes. The haplotypic diversity was estimated in a randomly chosen individual (Nei, 1987). The genetic distance was computed by the Kimura two-parameter method without gaps or missing data (Kimura, 1983). The phylogenetic analysis was done using the Neighbor-Joining (NJ) method (Saitou and Nei, 1987), as implemented in the MEGA software package (Molecular Evolutionary Genetics Analysis, version 1.02; Kumar et al., 1993). A total of 1000 bootstrap replicates (Felsenstein, 1985) were analyzed using the NJ method. RESULTS The original source of specimens from aquarium are doubtful that we can only count for the outgroup when comparing among the Taiwan populations (Table 1). Besides, we can only take several samples of each native population for this research, because of the limitation of government permission. Including the outgroups, 24 sequences from the cytochrome b gene to a part of the control region were aligned with Crossostoma lacustre (Cypriniformes: Balitoridae, Tzeng et al., 1992). The entire control region of 14 sequences from the M. opercularis and five from the M. chinensis colonies were also sequenced and aligned. Fig. 3 illustrates each haplotype and demonstrates the consensus box: termination associated sequence (TAS) and conserved-sequence blocks (CSB-II, CSB-III), which are usually found in vertebrate mtdna (Lee et al., 1995; Sbisae et al., 1997). Length variations and haplotypic diversity In the 1034-bp length of mtdna sequences, five haplotypes (Mo1-Mo5) of Taiwan native paradise fishes were discovered from 11 specimens in six different colonies (Table 3). Mo1 was the common haplotype among different populations of M. opercularis, but was not present in those of Miaoli (MS) or Taichung (MK). One variable site in the cytochrome b gene, and eight variable sites appearing in the control region were discovered (Fig. 3). Table 4 shows that the D-loop divergence of M. opercularis was lower than 1%. Their haplotypic 125

6 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen 1 Cytochrome b::thr 70 Mo1 CCCACTCGCGGGAATCGTAGAAGATAAAATTCTTTTAAAAAATACAAACGACGAATAGCCCTAGTAGCTC Mo A Mo A Mo A Mc1 A--T--T--C--G--TA-C--G C--C------G-A-AT--TA--C Mc2 A--T--T--C--G--TA-C--G C--C------G-A-AT--TA--C Mc3 A--T--T--C--G--TA-C--G C--C------G-A-AT--TA--C Mc4 A--T--T--C--G--TA-C--G C--C------G-A-AT--TA--C Mc5 A--T--T--C--G--TA-C--G C--C------G-A-AT--TA--C Pro-tRNA::D-loop210 Mo1 GAAAGATTTTAACTTCCACCCCTAACTCCCAAAGCTAGGATTCTAAACTAAACTATTCTTTGCGCAATTA Mc G G--T AAA----- Mc G G--T AAA----- Mc G G--T AAA----- Mc G G--T AAA----- Mc G G--T AA Mo1 TTAGCTAAAATTTATCTAAAACATACAAGTAAACATAATACTAAGAAATACATAAACCATATATATATAT Mo AC----- Mc1 -C--T--T-T-----A-T------T----A------T-A------GT-G---A ATAG--- Mc2 -C--T--T-T-----A-T------T----A------T-A------GT-G---A--C ATAG--- Mc3 -C--T--T-T-----A-T------T----A------T-A------GT-G---A--C ATAG--- Mc4 -C--T--T-T-----A-T------T----A------T-A------GT-G---A ATAG--- Mc5 -C--T--T-T-----A-T------T----A------T-A------GT-G---A ATAG : 490 Mo1 TATACCAGGACTCAAAATCTCGCCAAGAAAAACCATTTTAGCCCAATAAGAACCGACCATCAGTTGATAC Mc G T Mc G T Mc G T Mc G C-C T Mc G T 561 Central conserved region: 630 Mo1 CATTTGGTTCCTATTTCAGGTCCATTAATTGGTTCATTCCTCATTCTTTCATCGTAAATTACATAAGTTA Mo C Mc C Mc C Mc C Mc C Mc G C poly T region 770 Mo1 TTTTTTTTTTTTTCCTTTCAATAGGCTTTTCAGAGTGCATAAAACAGTGCACTAAA.CAAGGTAGTAC.C Mo G Mc C-C T---A G---TG-A---T-----GT-AG-AT Mc C-C T---A G---TG-A---T-----GT-AG-AT Mc C-C T---A G---TG-A---T-----GT-AG-AT Mc C-C T---A G---TG-A---T-----GT-AG-AT Mc C-C T---A G---TG-A---T-----GT-AG-AT Mo1 AGAGCATAAAGTATCAAGTATTTCTCCTAATTTATCTAATATATCCCCCTTCGTTTGTTCGCGTTAAACC Mc1 C AA---A-----A G GA Mc AA---A-----A G-G GA Mc AA---A-----A G GA Mc AA---A-----A G GA Mc AA---A-----A G GA Mo1 AAATCTAAAATCAGCCCATAATTGTGTTCATTTACACTATTATAATATTGCAAATGC Mo Mo Mo Mo Mo Mc1 ----T------T T T G---- Mc2 ----T------T T T G---- Mc3 ----T------T T T G---- Mc4 ----T------T T T Mc5 ----TC-----T T T G Thr-tRNA:: Pro140 Mo1 AGCGACCAGAGCGCCGGTCTTGTAAACCGGACGTCGGAGGTTAAATTCCCCCCTAGCGCTCATCAAAGAA Mc1 ---CCT C---T Mc2 ---CCT C---T Mc3 ---CCT C---T Mc4 ----CT C---T Mc5 ----C C---T TAS 280 Mo1 CATATATGTATTTACACCATATATTTATGTTAAACTAATCAATAATTATTCAGGACTAACATTTATAT.T Mc C------A T-? AC A-TA-A-- Mc C------A T-A AC A-TA-A-- Mc C------A T-A AC A-TA-A-- Mc C------A T-A AC A-TA-A-- Mc C------A T-T AC A-TA-AA Mo1 ATATATACATAATTTTAAATAAATACCGGGCGAAATTTAAGACCGAACTAATTTAACCCACTGGTTAAGT Mo G----- Mc1 -CC----T.---GA-C..----GA--TAAA---G T Mc2 CCC----T.---GA-C..----GA--TAA.---G C T Mc3 CCC----T.---GA-C..----GA--TAA.---G C T Mc4 -CC----T.---GA-C..----GA--TAAA---G T Mc5 -CC----T.---GA-C..----GA--TAAA---G T Central conserved region 560 Mo1 CTCTACGCATTCGTTTAATGATAGTCAGGTCCATTAATTGTGGGGGTTTCACGATATGATTTATTCCTGG Mo A Mo G Mc T C A------A-----T---- Mc T C A------A-----T---- Mc T C A------A-----T---- Mc T C A------A-----T---- Mc T C A------A-----T Mo1 ATGGTGGAGTACATACTCCTCTTTAACTTCACATGCCGGGCGTTCTCTCCACAGGCGCATGGGGTTTTTA Mo A Mc Mc Mc Mc Mc Mo1 CCTCCTTGGCATAAATAATATGTATGAGTGATGAAAAGACATTACATAAGAATTGCATATTAAAATATCA Mc1 TT-T----TA--T-T--?---T-G----C-G T ACTT-----A- Mc2 TT-T----TA--T-T--T---T-G---TC-G T ACTT Mc3 TT-T----TA--T-T--T---T-G----C-G T ACTT Mc4 TT-T----TA--T-T--T---T-G----C-G T ACTT Mc5 TT-T----TA--T-T--T---T-G----C-G T ACTT CSB-II CSB-III 980 Mo1 CCCCTACCCCCCTAAACTCCTAAAAAGCATAACACTCCTGCAAACCCCCCGGAAACAGGAAACTCTCTAG Mc G-T C-C---- Mc2 ----A G-T C-C---- Mc G-T C-C---- Mc G-T C-C---- Mc G-T C-C---- Figure 3. mtdna haplotypes of the genus Macropodus from the partial cytochrome b gene to the control region. Bold letters indicate the consensus box, TAS, CSB-II, CSB-III; dots denote gaps, and dashes indicate identical sites. 126

7 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus 1 Cytochrome b::thr 70 #Mo1 CCCACTCGCGGGAATCGTAGAAGATAAAATTCTTTTAAAAAATACAAACGACGAATAGCCCTAGTAGCTC #Mc1 A--T--T--C--G--TA-C--G C--C------G-A-AT--TA--C #Tp1 A---G-A--A--C--TC C-----T---T-ACAT #Bs1 A--TA-A--A---C-TC G-----G----C--GC-C-TT-C-T #Cro ---CT-G--A---TGGC-----A-----GCC--AGA-TG-GTCT T 71 Thr-tRNA::Pro 140 #Mo1 AGCGACCAGAGCGCCGGTCTTGTAAACCGGACGTCGGAGGTTAAATTCCCCCCTAGCGCTCATCAAAGAA #Mc1 ---CCT C---T #Tp T A A---T #Bs1 ----C AC CA #Cro --T.-TG-A---AT T---A-GA-T AC--A C...-G-A Pro-tRNA:: 210 #Mo1 GAAAGATTTTAACTTCCACCCCTAACTCCCAAAGCTAGGATTCTAAACTAAACTATTCTTTG... #Mc G G--T #Tp1 --G-----C-----C #Bs1 AG C G C--A #Cro A-G-----C-----CT GG C--A T-C--AATGCTGC 211 TAS 280 #Mo1...CGCAATTACATATATGTATTTACACCATATATTTATGTTAAACT #Mc AAA C------A #Tp TTT C------A----C-A #Bs TTA--A A A---A-AC---A #Cro AGGTATGGTATAGTACATATTATGCATAAT A-AT------TA-A----T #Mo1 AATCAATAATTATTCAGGACTAACATTTATAT.TTTAGCTAAAATTTATCTAAAACATACAAGTAAACAT #Mc1 -T-? AC A-TA-A---C--T--T-T-----A-T------T----A #Tp1 TT-AT---T-AG--A-AT-----T #Bs1 T--AT T-----AT-A----TA-ATA-GCATA-TT---ATATAT--C-C-CAT-TATC-T-- #Cro #Mo1 AATACTAAGAAATACATAAACCATATATATATATATATATACATAAT... #Mc1 T-A------GT-G---A ATAG----CC----T.---G #Tp1...-GA-G--G GA #Bs1 ----ATGAAGAATATATAATCTATATGTATTAACACCATATATATATATACAACATATATATAATTATTT #Cro...-GAC------G--GG--C--TAC---G---GT-G repeated sequence 490 #Bs1 AGGACATAAATTTTAAATATGCATAATTATTATATATAACCCTCATATATCATATAATAGCTAATATATA #Mo1...TTTAAATAAATACCGGGCGAAATTTAAGACCGAACTAATT #Mc A-C..----GA--TAAA---G #Tp AC-C--C-TGC-TAT-TAT-T---AC-T-GAC-TTAGCA- #Bs1 CATAAACCATATAAAGCTTAATTTAAAATAA-ATGT-TT-CCAATA AC-A- #Cro GAGCATAAA--TG-G--C-C--ATATATTT---T-----TGGG----C #Mo1 TAACCCACTGGTTAAGTTATACCAGGACTCAAAATCTCGCCAAGAAAAACCATTTTAGCCCAATAA... #Mc1 ----T G #Tp1 A--AA--AACA-ATTT-----TT-AA-TATTCCC-A-T TC--AAG-C-GTC-GG #Bs1 ---AT--T-A T TAA-T----.-T-----A-A--ATT--G #Cro G--TAAT-CCCA---AGCCC-T--TA--ATTTTC-T-GAAT--ATTTGC---CA-CTT-TG-G---TAAA 631 :Central conserved region 700 #Mo1...GAACCGACCATCAGTTGATACCTCTACGCATTCGTTTAATGATAGTCAGGTCCATTAA #Mc T T #Tp G T---GA-T-TTA C----C #Bs T-----T-TTA G #Cro TAATGTAGTAAGA----AC-A-C-----T---TAAAGGTTA----TGCATGAT-GT----A-GA--AA #Mo1 TT #Mc1 -C #Tp1 -- #Bs1 -A #Cro -- Figure 4. mtdna sequences among different species amplified by primer Ec7 to G22. Bold letters indicate the consensus box, TAS, CSB-II, CSB-III; dots denote gaps, and dashes indicate identical sites. Underlined letters denote repeated sequences of Betta splendens. diversities (H) are In contrast, similar results of D-loop divergence were found in M. chinensis. The length of the amplified fragment was only 1031 bp, and three deletions were observed in the control region. Fig. 3 also illustrates five haplotypes (Mc1-Mc5) of five specimens from Zhejiang (WE) and Jilin (GL). Two variable sites were discovered in the Thr-tRNA region, and 14 variable sites were located in the control region. Surprisingly, the genetic variation is only about 1% from the long geographic distance between Zhejiang and Jilin. This may imply the recent division, or their slow evolution rates of mtdna. The haplotypic diversities (H) are 0.89 for M. chinensis. Interspecific variations 142 variable sites were found when comparing the M. opercularis (Mo) and M. chinensis (Mc). The interspecies difference was 13 times greater than intraspecific variation within M. opercularis and M. chinensis. Moreover, we revealed the outgroups differences by sequencing only about a 500-bp-long fragment between primer Ec7 and G22A (Fig. 2, Fig. 4). Table 5 demonstrates the length variations between different species and different mtdna fragments. M. opercularis and M. chinensis were more similar than were the others, with only a little difference in the D-loop region as we have mentioned. The entire length of these two D-loops was slightly shorter than that of C. 127

8 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen Table 5. Lengths of sequences from the cytochrome b gene to the control region in mtdna between species. Species Cytochrome b Thr-tRNA Pro-tRNA D-loop Repeat Total length Entire D-loop Mo Mc Bs Tp Cro A 126-bp sequence was repeated seven times in Betta splendens. Table 6. Mean and standard error of the number of nucleotide substitutions per 100 sites. (A) The upper triangle matrix is Pro-tRNA (70 bp), the lower is Thr-tRNA (70 bp); (B) The upper is the control region (221 bp), the lower is cytochrome b (46 bp); (C) The upper is weighted distance, the lower is average distance. (A) Mo1 Mc1 Tp1 Bs1 Cro Mo1 4.8± ± ± ±8.1 Mc1 5.1± ± ± ±10.3 Tp1 5.9± ± ± ±6.3 Bs1 5.9± ± ± ±5.8 Cro 25.5± ± ± ±6.3 (B) Mo1 Mc1 Tp1 Bs1 Cro Mo1 14.0± ± ± ±9.5 Mc1 36.6± ± ± ±10.0 Tp1 30.6± ± ± ±12.7 Bs1 37.3± ± ± ±13.5 Cro 68.3± ± ± ±23.7 (C) Mo1 Mc1 Tp1 Bs1 Cro Mo1 13.4± ± ± ±9.9 Mc1 13.1± ± ± ±11.0 Tp1 30.7± ± ± ±11.3 Bs1 24.4± ± ± ±12.1 Cro 67.3± ± ± ±6.2 Mean and standard error of Macropodus opercularis: 0.6 ± 0.5. Mean and standard error of Macropodus chinesis: 1.0 ± 0.7. lacustre (Cro). The outgroup, B. splendens (Bs), and T. pumilus (Tp), showed significant length variations with each other. Interestingly, a repeated sequence of 126 bp in length was only found in B. splendens, and repeats seven times in its control region (Fig. 4). Genetic distance and phylogenetic tree We examined the nucleotide substitutions of each segment (cytochrome b, Thr-tRNA, Pro-tRNA, and the D-loop fragment) in these species (Table 6). The length-weighted substitution is similar to the unweighted substitution between different species. In other words, we may consider that these gene segments have a coincident substitution tendency. According to the present results in tables 4 and 6, the interspecific and intraspecific phylogenetic trees were established as shown in Fig. 5. Each tree is highly convergent, confirmed by different 128

9 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus Figure 5. Neighbor-joining tree of paradise fishes in Taiwan and adjacent regions. (A) partial sequences from cytochrome b gene to 5' end of the control region were used to construct the phylogenetic tree; (B) Total length (1034 bp) of paradise fish sequences was used to construct an unrooted tree. distance estimated methods as usually examined. Fig. 5A reveals that over 10% divergence appeared in the 500 bp between Mo and Mc, and these two revealed about 30% subdivergence with Tp or Bs. To resolve the subdivision of different paradise fish populations, we compared the entire sequence (1034 bp) between Mo and Mc, and constructed the phylogeny tree (Fig. 5B). Both Mo and Mc were shown to diverge into different clades. Meanwhile, three haplotypes (Mo2, Mo3, and Mo4) formed a distinct clade, which showed a high bootstrap value in comparing with the Mo1 and Mo5 clade. A similar result can be illustrated when including addition populations, MI and ED in Fig. 1B, from northeastern Taiwan and southern China (data not shown). DISCUSSION Distribution of Macropodus opercularis in Taiwan According to recent reports (Shen et al., 1991; Jan and Wu, 1994) and personal investigations, scattered populations of M. opercularis still exist in western Taiwan (Fig. 1). Wild populations fluctuate frequently and are laborious to find. The bottleneck effect resulting from drastic environmental changes may severely reduce genetic diversity and survival rates of these populations. Inappropriate artificial breeding and releases further aggravate the predicament of native populations (Jan and Wu, 1994). The Taiwanese population is regarded as tributary to southern Chinese population (Kawanbe and Mizuno, 1989). Furthermore, local populations around Taiwan do not demonstrate apparent reproduction isolation judging from laboratory breeding experiences. Phylogeography in paradise fishes Fig. 5A illustrates the molecular phylogeny between each species (Table 1). This result is similar to that obtained with allozyme data (Wakiyama et al., 1997). Divergent distances among species of the genus Macropodus are half-way between those of T. pumilus or B. splendens (Table 6). In M. opercularis, we selected samples from adjacent but geographically separate areas as outgroups to analyze the relationships among the populations in Taiwan (Table 1). At least one specimen from each native population was chosen for analysis of mtdna sequence variation, since morphological characters cannot help us figure out the differences among these populations. As indicated in table 3, the Mo1 haplotype appears naturally in each population, but not in the Miaoli or Taichung populations. Two specimens (SG) from Singaporean aquarium carry the same haplotype (Mo1), and another (MU) from Taiwan aquarium is Mo6 haplotype. The result may imply that M. 129

10 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen opercularis from the native populations still have its own genetic variation, which is different from aquarium strains. Specimens from Singapore are the Malaysia peninsula type, which is larger than specimens from Taiwan. They may be interbreeding with Taiwan native population (Jan and Wu, 1994). As to biogeographical evidence (Oshima, 1934; Kawanabe and Mizuno, 1989), the generally accepted hypothesis states that northern China is occupied by M. chinensis while M. opercularis resides in southern China with the Yangtze River as the nouth-south boundary (Fig. 1). Zhejiang is localized at this boundary area while Jilin belongs to the northern Chinese range of M. chinensis. We cannot measure significant characters among these specimens, but interestingly, specimens from Zhejiang (WE) seem a little bit different from those of Taiwan, Singapore (SG), Duan (DA), and Juhae (JH). Unexpectedly, in genetic inheritance, specimens from Zhejiang differ conspicuously from those of Taiwan and Singapore in the D-loop of mitochondrial DNA, and the average divergence is ± (Table 4). Compared to other fishes, the genetic distance between the Taiwanese and Chinese populations has already surpassed the interspecific level as that between different species of loach, ricefish, gobby, porgy, and eel (Tzeng, 1992; Lin, 1995; Lin, 1996; Jean et al., 1995; Sang et al., 1994). Unfortunately we were unsuccessful in amplifying the mtdna of the formalin-preserved samples from Duan and Juhae. We need more evidence to confirm whether the genetic divergence is an interspecific relationship or is caused by geographic divisions. Fortunately, we received two specimens from Jilin (GL), of which one specimen (Mc5) with its circular caudal fin belongs to M. chinensis (Table 3). After mtdna sequencing, the genetic distance between the Zhejiang and Jilin populations was found to be less than 1%, while the genetic distance between the Taiwanese and Chinese populations still showed great variation. Recently, one specimen from Guangdong (ED) has been analyzed. Only 1% difference in control region is discovered when comparing within the Taiwanese populations (data not shown). All these data emphasize that the specimens from Zhejiang and Jilin are M. chinensis, and the Taiwanese populations should be M. opercularis. Interestingly, the geographic distance from Zhejiang to Jilin is closed to two thousand kilometers, but their genetic distance is less than 1%. More affirmative conclusions will probably be drawn with the addition of samples from around Taiwan, Korean M. chinensis and M. opercularis, and southern Chinese M. opercularis. Genetic information and conservation As we discussed above, only nine variation sites are appeared from mtdna. Table 4 shows that the divergence of M. opercularis was lower than 1%. The genetic information is not significant. However, five haplotypes of M. opercularis from Taiwan native populations are divided into two clades, Mo1-Mo5 and Mo2- Mo3-Mo4, separated by a high bootstrap value. Mo1 haplotype, naturally present in many isolated specimens, may be the ancestral haplotype. In this view, the Miaoli and Taichung populations are subdivided from the ancestral clade. The haplotypic diversity of the Taiwanese populations is 0.68; by contrast, the haplotypic diversity in the Chinese populations is The mtdna genetic diversity in China is higher than that in Taiwan. Although this result should be caused by long geographic distance between two Chinese populations, the haplotypes of M. chinensis are different among each population. This may emphasize the genetic diversity of Taiwan native population is getting lower and lower, because of decreasing population size. The conservation of genetic diversity is urgent and imperative. We can carefully distinguish four phenotypes by morphological characters (Jan and Wu, 1994). But preserving the entire gene pool, the genetic phylogeny is an important part for conservation works. In our investiga- 130

11 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus tion, we can understand that M. opercularis of Taiwan native populations still has genetic diversity, though only a few specimens in each colony have been analyzed. Only two separated groups are discovered, because of the low diversity of mtdna and the limitation of collecting specimens. In the short term, we suggest that remarkably small wild groups in the same zone could be interbred with each other to elevate survival rates. Suitable habitats should be obtained for intermittent release of restored groups to increase genetic diversity. Any habitats of stable populations subsequently discovered should be protected to ensure natural propagation. In the long term, native populations must be secluded from foreign ones to minimize artifacts and to certify the accuracy of research results. The low variations in mtdna of paradise fishes are a limitation to revealing the population structure and gene flow problem. New techniques have been developed in Taiwan, such as use of minisatellites, microsatellites, SSCP, and DSCP. We hope these new techniques will allow the descendents to discovery more genetic information for preserving this threatened fish in Taiwan. ACKNOWLEDGMENTS This research was financially supported by the National Science Council, Republic of China (NSC B B17) and had permission from the Council of Agriculture, Executive Yuan. We are very grateful to Mr. Heok Hui Tan, Biological Sciences Department, Natl. Singapore Univ. in Singapore, Mr. Jinn Chyuang Sheu, Life Science Department, Natl. Tsing Hua Univ. in Hsinchu, Dr. T. H. Lee, Zoology Department, Natl. Chung Hsing Univ. in Taichung, and Mr. J. P. Jan, Taichung, for providing specimens. REFERENCE Avise, J. C. (1994) Molecular markers, natural history and evolution. Chapman & Hall, New York. Avise, J. C. (1995) Mitochondrial DNA polymorphism and a connection between genetics and demography of relevance to conservation. Conserv. Biol. 9: Birky, C. W., P. Fuerst and T. Maruyama (1989) Organelle gene diversity under migration, mutation, and drift: equilibrium expectations, approach to equilibrium, effects of hetroplasmic cells, and comparison to nuclear genes. Genetics 121: Brown, G. G., G. Gadaleta, G. Pepe, C. Saccone and E. Sbisa (1986) Structural conservation and variation in the D-loop-containing region of vertebrate mitochondrial DNA. J. Mol. Biol. 192: Chen, C. S. (1969) The vertebrate animals in Taiwan. Commercial Publication, Taipei, pp (In Chinese) Degani, G. and M. Veith (1990) Electrophoretic variations of isozyme systems in the muscle and liver of Anabantidae fish. ISR. J. Aquacult./Bamidgeh 42(3): Devereux, J., P. Haeberli and P. Marquess (1997) Genetic computer group manual, version 9.1. Wisconsin Univ. Press, Madison, WI. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: Forselius, S. (1957) Studies of anabantid fishes. 1,2,3. Zool. Bid. Fraen Uppsala 32: Jan, J. P. and S. L. Wu. (1992) The biogeography of Taiwan fishes between northern and southern areas. China Fisheries Monthly 478: (In Chinese) Jan, J. P. and S. L. Wu. (1994) Ecology and conservation of Macropodus opercularis. Taichung Mountain Environment Protection Association, Taichung. (In Chinese) Jan, J. P., S. L. Wu, and C. R. Chen. (1992) The ecology and conservation evaluation of Taiwan paradise fishes. Tachia River Environ- 131

12 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen ment Protection Association, Taichung, pp. 39. (In Chinese) Jean, C. T., C. F. Hui, S. C. Lee and C. T. Chen (1995) Variation in mitochondrial DNA and phylogenetic relationships of fishes of the subfamily Sparinae (Perciformes: Sparidae) in the coastal waters of Taiwan. Zool. Stud. 34(4): Kawanabe H. and N. Misuno (1989) Freshwater fishes in Japan. Mountain and Stream Valley Lo., Tokyo, pp (In Japanese) Kimura (1937) Study in Chinese Macropodiniae fishes. Bull. Inst. Nat. Sci., Shanghai. 7(3): (In Japanese) Kimura, M. (1983) The neutral theory of molecular evolution. Cambridge Univ. Press, New York. Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paeaebo, F. X. Villablanca and A. C. Wilson (1989) Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 86: Kumar, S., K. Tamura and M. Nei (1993) MEGA: molecular evolutionary genetics analysis, version : Pennsylvania State Univ., University Park, PA, pp Lee, W. J., J. Conroy, W. H. Howell and T. D. Kocher (1995) Structure and evolution of Teleost mitochondrial control regions. J. Mol. Evol. 41: Liem, K. F. (1963) The comparative osteology and phylogeny of the Anabantoidei (Teleostei, Pisces). IL Biol. Monogr. 30(iviii): Lin, S. M. (1995) Characterization of medaka fish (Oryzias latipes) mtdna D-loop. Master thesis, National Tsing Hua Univ, Hsinchu. (In Chinese) Lin, Y. S. (1996) Phylogenetic relationships of Rhinogobius giurinus of Taiwan and mainland of China based on the mitochondrial DNA sequence analysis. Bachelor Thesis, National Tsing Hua Univ, Hsinchu. (In Chinese) Moritz, C., T. E. Dowing and W. M. Brown (1987) Evolution of animal mitochondrial DNA: relevance for population biology and systematics. Ann. Rev. Evol. Syst. 18: Moritz, C. and W. M. Brown (1987) Tandem duplications in animal mitochondrial DNA: variation in incidence and gene content among lizards. Proc. Natl. Acad. Sci. USA 84: Nei, M. (1987) Molecular evolutionary genetics. Columbia Univ. Press, New York. Nelson, J. S. (1994) Fishes of the word. 3rd ed. J. Wiley, New York, pp Oshima, M. (1919) Contribution to the study of the freshwater fishes of the island of Formosa. Ann. Carneg. Mus. XII(2-4): (in Japanese) Oshima, M. (1923) Studies on the distribution of the freshwater fishes of Taiwan and discuss the geographical relationship of Taiwan island and the adjacent area. Zool. Mag. 35(411): (in Japanese) Oshima, M. (1934) Japanese Labrynthici fishes, Zool. Mag., 12(4): (In Japanese) Sang, T. K., H. Y. Chang, C. T. Chen, and C. F. Hui (1994) Population structure of the Japanese eel, Anguilla japonica. Mol. Biol. Evol. 11(2): Sanger, F., S. Nicklen and A. R. Coulson (1977) DNA Sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: Saitou, N. and M. Nei (1987) The neighborjoining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:

13 Conservation and Phylogeography of Taiwan Paradise Fish, Macropodus opercularis Linnaeus Sbisae, E., F. Tanzariello, A. Reyes, G. Pesole and C. Saccone (1997) Mammalian mitochondrial D-loop region structure analysis: identification of new conserved sequences and their functional and evolutionary implications. Gene 205: Shen, S. C., C. S. Tzeng and C. Y. Shoang (1991) Studies on the mosquito control by using endogenous fishes. Institute of Zoology, Natl. Taiwan Univ., Taipei, pp. 39. (In Chinese) Tamura, K. and M. Nei (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 10: Tzeng, C. S. (1986) Distribution of the freshwater fishes of Taiwan. J. Taiwan Mus. 39(2): Tzeng, C. S. (1992) Genomic structure of mitochondrial DNA of Taiwan stream loach, Crossostoma lacustre, and molecular evolution of Family Homalopteridae in Taiwan. Ph. D. thesis, National Taiwan Univ. Tzeng, C. S., C. F. Hui, S. C. Shen and P. C. Huang (1992) The complete nucleotide sequence of the Crossostoma lacustre mitochondrial genome: conservation and variations among vertebrates. Nucleic Acids Res 20: Wakiyama, A., H. Kohno and Y. Taki (1997) Genetic relationships of anabantoid fishes. J. Tokyo Univ. Fish. 83(2): Ward, R. D., M. Woodwark, and D. O. F. Skibinski (1994) A comparison of genetic diversity levels in marine, freshwater, and anadromous fishes. J. Fish Biol. 44: Wen, S. S. (1981) The freshwater fishes in Hong Kong. Hong Kong Municipal Government, Hong Kong, pp.71. (In Chinese) (Received Feb. 11, 1999; Accepted Mar. 15, 2000) 133

14 Tzi-Yuan Wang, Chyng-Shyan Tzeng, and Shih-Chieh Shen mtdna) M. chinensis 1990 Macropodus opercularis DNA mitochondrial DNA; control region sequence 13.4% bp haplotype 5 134