Molecular phylogeny of basal gobioid Wshes: Rhyacichthyidae, Odontobutidae, Xenisthmidae, Eleotridae (Teleostei: Perciformes: Gobioidei)

Transcription

1 Molecular Phylogenetics and Evolution 37 (2005) Molecular phylogeny of basal gobioid Wshes: Rhyacichthyidae, Odontobutidae, Xenisthmidae, Eleotridae (Teleostei: Perciformes: Gobioidei) Christine E. Thacker, Michael A. Hardman 1 Vertebrates-Ichthyology, Natural History Museum of Los Angeles County, 900 Exposition Blvd., Los Angeles, CA 90007, USA Received 17 February 2005; revised 5 May 2005 Available online 21 June 2005 Abstract Morphological character analyses indicate that Rhyacichthyidae, Odontobutidae, Eleotridae, and Xenisthmidae are the basal families within the perciform suborder Gobioidei. This study uses DNA sequence data to infer the relationships of genera within these families, as well as determine the placement of more derived gobioids (family Gobiidae) and the identity of the outgroup to Gobioidei. Complete sequences of the mitochondrial ND1, ND2, COI, and cyt b genes (4397 base pairs) are analyzed for representatives of 27 gobioid genera and a variety of perciform and scorpaeniform outgroup candidates; the phylogeny is rooted with a beryciform as a distal outgroup. The single most parsimonious tree that results indicates that, of the outgroups sampled, the perciform family Apogonidae is most closely related to Gobioidei. Gobioidei is monophyletic, and Rhyacichthys aspro is the most basal taxon. The remainder of Gobioidei is resolved into clades corresponding to the families Odontobutidae (plus Milyeringa) and Eleotridae + Xenisthmidae + Gobiidae. Within Eleotridae, the subfamily Butinae (minus Milyeringa) is paraphyletic with respect to Gobiidae, and Eleotrinae is paraphyletic with respect to Xenisthmidae. Other than these groupings, the primary disagreement with the current morphology-based classiwcation is that the molecular data indicate that the troglodytic Milyeringa should be placed in Odontobutidae, not Butinae, although support for this placement is weak. The most basal lineage of Gobioidei is known from the freshwaters of the Indo-PaciWc, with marine-dwelling lineages arising several times independently in the group. The phylogeny also indicates that diverent gobioid lineages are distributed in Asia, Africa, Madagascar and the Neotropics. Five sister pairs of basal gobioid species inhabit Atlantic and PaciWc drainages of Panama, with widely varying divergences Elsevier Inc. All rights reserved. Keywords: Gobioidei; Rhyacichthyidae; Odontobutidae; Eleotrididae; Eleotrinae; Butinae; Xenisthmidae; Gobiidae; Biogeography; Panama 1. Introduction The suborder Gobioidei is included in Perciformes, the largest vertebrate order, including most ocean Wshes as well as many fresh and brackish water groups. Perciformes includes roughly 9300 species, of which an estimated * Corresponding author. Fax: addresses: thacker@nhm.org (C.E. Thacker), m.hardman@ nhm.ac.uk (M.A. Hardman). 1 Present address: Department of Parasitic Worms, Natural History Museum, 6 Cromwell Road, London SW7 5BD, UK species (23%) are gobioids (Nelson, 1994). Inference of relationships both within perciformes, and among perciformes and other acanthopterygiian taxa, has been challenging due to the number and diversity of perciforms (Johnson, 1993; Johnson and Patterson, 1993) and it is likely that Perciformes is not monophyletic as currently construed. Large-scale molecular surveys of acanthopterygiian phylogeny (Elmerot et al., 2002; Miya et al., 2003) indicate that Perciformes is not monophyletic, forming a clade only if Caproidei (Zeiformes), Ophidiiformes, Lophiiformes, Scorpaeniformes, Pleuronectiformes, Tetraodontiformes, and Smegmamorpha are /$ - see front matter 2005 Elsevier Inc. All rights reserved. doi: /j.ympev

2 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) included. The exact placement of Gobioidei within Perciformes is also unclear; abundant morphological character evidence indicates that the suborder Gobioidei is monophyletic, but no sister taxon has been identiwed based on morphological data, although several candidates have been proposed (Johnson and Brothers, 1993; Winterbottom, 1993). The aim of this study is to infer relationships within Gobioidei and between Gobioidei and various candidate percomorph outgroups. A large (4397 base pairs) mitochondrial DNA dataset is used, consisting of the complete sequence of the nitrogen dehydrogenase subunit 1 (ND1), nitrogen dehydrogenase subunit 2 (ND2), cytochrome oxidase subunit I (COI), and cytochrome b (cyt b) genes. Sampling within Gobioidei is concentrated on basal taxa (Rhyacichthyidae, Odontobutidae, Eleotridae [including subfamilies Eleotrinae and Butinae (Hoese and Gill, 1993)], and Xenisthmidae, Table 1), although two gobiid species are included in order to place the more derived gobioids in this hypothesis. A previous molecular study of gobioid relationships (Thacker, 2003) showed that the more derived gobioid families (Gobiidae, Microdesmidae, Ptereleotridae, Kraemeriidae, and Schindleriidae) form a monophyletic group to the exclusion of the basal gobioid families listed above. That hypothesis did not include Rhyacichthyidae, and was rooted with an odontobutid, so no conclusions could be made regarding sister taxon placement. In addition to the single odontobutid taxon, Thacker (2003) included eight eleotrine eleotrids and a xenisthmid; these taxa formed a paraphyletic grade outside the higher gobioid clade. The current study provides a complement to Thacker (2003) in its more detailed analysis of basal gobioid and outgroup relationships. The four families targeted here have been considered basal relative to other gobioids due to the presence of six (rather than Wve) branchiostegal rays, and characters of the suspensorium and branchial apparatus (Hoese, 1984; Hoese and Gill, 1993) and in the case of Rhyacichthyidae and the Incertae sedis genera Terateleotris and Protogobius, the presence of lateral line canals on the body (absent in all other gobioids; Miller, 1973; Shibukawa et al., 2001; Watson and Pöllabauer, 1998). Basal gobioids generally attain a larger size than other gobioids, and exhibit less of the morphological reduction that occurs frequently among more derived gobioid taxa. Additionally, they are usually found in fresh or brackish water; the major radiation of gobioids, the gobiine gobiids, is known primarily from marine habitats. However, exceptions to these generalizations exist, including the marine-dwelling eleotrids Calumia, Grahamichthys, Thalasseleotris, and all Wve genera of Xenisthmidae. Size reduction is also known among basal gobioids, as exempliwed by the genera Kribia, Calumia, Leptophilypnus, Microphilypnus, and dwarf species of Oxyeleotris and Philypnodon, all of which attain an adult size of less than 40 mm. Two blind, cave-dwelling genera are also found Table 1 Valid genera of basal gobioid families, in their current classiwcation Taxon Distribution Ecology Rhyacichthyidae +Rhyacichthys W PaciWc Freshwater Odontobutidae Micropercops N Asia Freshwater +Odontobutis N Asia Freshwater +Perccottus N Asia Freshwater Eleotridae Butinae +Bostrychus W PaciWc Freshwater/estuarine +Butis Indo-W PaciWc Freshwater/estuarine Incara Indo-W PaciWc Freshwater/estuarine +Kribia Africa Freshwater +Milyeringa NW Australia Freshwater +Ophiocara Indo-W PaciWc Freshwater/estuarine +Oxyeleotris Indo-W PaciWc Freshwater/estuarine + dwarf Oxyeleotris N Australia/ Freshwater New Guinea Prionobutis Indo-W PaciWc Freshwater/estuarine Typhleotris Madagascar Freshwater Eleotrinae Belobranchus W PaciWc Freshwater/estuarine Bunaka W PaciWc Freshwater/estuarine +Calumia Indo-W PaciWc Marine +Dormitator E PaciWc/Atlantic Freshwater/estuarine +Eleotris Circumtropical Freshwater/estuarine +Erotelis Neotropical Freshwater/estuarine +Gobiomorphus SE Australia/ Freshwater/estuarine New Zealand +Gobiomorus Neotropical Freshwater/estuarine Grahamichthys New Zealand Marine +Guavina Neotropical Freshwater/estuarine +Hemieleotris Neotropical Freshwater +Hypseleotris Indo-W PaciWc Freshwater/estuarine Kimberleyeleotris NW Australia Freshwater +Leptophilypnus Neotropical Freshwater +Microphilypnus Neotropical Freshwater +Mogurnda N Australia/ Freshwater New Guinea +Ophieleotris Indo-W PaciWc Freshwater/estuarine +Philypnodon SE Australia Freshwater/estuarine +Ratsirakea Madagascar Freshwater +Tateurndina SE New Guinea Freshwater Thalasseleotris SE Australia/ New Zealand Marine Xenisthmidae Allomicrodesmus Indo-W PaciWc Marine Paraxenisthmus Indo-W PaciWc Marine Rotuma Indo-W PaciWc Marine Tyson Indo-W PaciWc Marine +Xenisthmus Indo-W PaciWc Marine Incertae sedis Protogobius New Caledonia Freshwater Terateleotris Laos Freshwater Taxa marked with + were sequenced for this study. among basal gobies, Typhleotris known from Madagascar, and Milyeringa from caves in northwestern Australia. One aim of the current study was to determine the placement of these marine, miniaturized or troglodytic

3 860 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) taxa, and to see if each of these characteristics arose single or multiple times in the evolution of basal gobioids. The distribution of basal gobioids was also investigated in a phylogenetic context. Most of the species diversity in the basal gobioid families is known from Australia and the islands of the Indo-West PaciWc (Table 1). However, some genera occur in Africa (Kribia and some species of the widespread genera Bostrychus, Dormitator, and Eleotris); Asia (odontobutids Micropercops, Odontobutis, and Percottus); New Zealand (Grahamichthys and some Gobiomorphus and Thalasseleotris); and the neotropics (some Dormitator and Eleotris; Erotelis, Gobiomorus, Guavina, Hemieleotris, Leptophilypnus, and Microphilypnus). Phylogeny of these taxa is used to infer the distribution patterns in Asia, Africa, New Zealand, and the Neotropics, and to determine if, in particular, the large group of neotropical genera is monophyletic. In addition to basal gobioids, a wide variety of perciform and scorpaeniform outgroups were included, and the phylogeny was rooted with a beryciform (Beryx splendens). Inclusion of many outgroups allows conwrmation or disconwrmation of gobioid monophyly as well as selection of a proximal sister taxon from among the candidates. The most comprehensive study of potential outgroups to Gobioidei is that of Winterbottom (1993). He examined 34 families representing a wide array of acanthopterygiian and paracanthopterygiian taxa for 23 morphological characters, in order to determine which group shares the most apomorphies with Gobioidei. Winterbottom (1993) narrowed down the list of likely sister taxa to three best candidates: Gobiesocoidei (including only the clingwsh family Gobiesocidae, a group for which relationship has been suggested with the Callionymidae, Notothenidae, or Paracanthopterygii; Nelson, 1994); some subset of the trachinoids, in particular the trachinoid families Percophididae, Trichonotidae, and Creedidae; or some subset of the scorpaeniforms, especially the family Hoplichthyidae. However, even the best candidate (Hoplichthyidae) only shared 11 of 23 characters with Gobioidei, and Winterbottom (1993) concluded that gobioids were so distinctive that more detailed analyses were needed to make a convincing argument as to the appropriate gobioid sister taxon. Miller (1973) also discussed the sister taxon problem in his treatment of the basal gobioid Rhyacichthys, and concluded that while gobioids were dewnitely acanthopterygiians, and shared some characters with perciform families Apogonidae, Kuhliidae, Centrarchidae, and Percidae as well as the notothenioid family Chaenichthyidae, no obvious sister taxon could be identiwed. In the present study, representatives of Gobiesocidae (Gobiesociformes), Dactylopteridae (Dactylopteriformes), Pinguipedidae, Cheimarrichthyidae, Trichodontidae (Trachinoidei: Perciformes), Cottidae, Cyclopteridae (Cottoidei: Scorpaeniformes), Triglidae (Scorpaenoidei: Scorpaeniformes), Lutjanidae, Apogonidae (Percoidei: Perciformes) are included, with the aim of providing a wide range of possibilities for potential outgroups. Gobiesocidae, Trachinoidei, and Scorpaenoidei are included as suggested by Winterbottom (1993); Apogonidae (some or all) was also identiwed by Winterbottom (1993) as sharing characters with Gobioidei including the presence of papillae (enlarged, raised neuromasts) on the head, loss of the basisphenoid, various fusions and losses of caudal skeleton elements, displacement of the dorsal articulation of the symplectic away from the interhyal, and a cartilaginous pad in the basipterygium which supports articulation of the pelvic Wn rays. Additionally, in both Apogonidae and most Gobioidei, eggs bear attachment Wlaments, are deposited on the substrate, and guarded by the male (Johnson, 1993). Dactylopteridae was the closest relative to Gobioidei in the molecular hypothesis of Miya et al. (2003), and other scorpaeniform and perciform taxa are added to provide denser sampling in the outgroups. 2. Materials and methods Fresh and ethanol-preserved tissues were obtained from a variety of sources (Table 2). Whenever possible, more than one individual of a species was sequenced (Fig. 1). A total of 78 individuals of 45 species representing 27 nominal basal gobioid genera were included as the ingroup (families Rhyacichthyidae, Odontobutidae, Eleotridae, and Xenisthmidae; Table 1). Sequence for Rhyacichthys aspro was obtained from GenBank (AP004454). The gobiine gobiids Gnatholepis scapulostigma and Bathygobius cocosensis were added as representatives of higher gobioids; sequence for the ND1, ND2, and COI genes for these species was obtained from GenBank (G. scapulostigma: AF391376, AF391448, AF391520; B. cocosensis: AF391388, AF391460, AF391532). The outgroup taxa Apogon maculatus, Apogon quadrisquamatus, Apogon nigrofasciatus (Perciformes: Percoidei: Apogonidae), Parapercis sp. (Perciformes: Trachinoidei: Pinguipedidae), and Cheimarrichthys fosteri (Perciformes: Trachinoidei: Cheimarrichthyidae) were sequenced for this study; sequence for additional outgroup taxa was obtained from Gen- Bank and included two species of Gobiesocidae (Arcos sp.: AP004452; Aspasma minima: AP004453); two species of Dactylopteridae (Dactyloptena tiltoni: AP004444; Dactyloptena peterseni: AP004440); one additional trachinoid, family Trichodontidae (Arctoscopus japonicus: AP002947); scorpaeniforms of the families Triglidae (Satyrichthys amiscus: AP004441), Cyclopteridae (Aptocyclus ventricosus: AP004443), Cottidae (Cottus reinii: AP004442); and a representative of the perciform family Lutjanidae (Pterocaesio tile: AP004447). The beryciform B. splendens (AP002939) was included as the

4 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) Table 2 Species of Odontonbutidae, Eleotridae, Xenisthmidae, Apogonidae, and trachinoids Pinguipedidae and Cheimarrichthyidae examined in this study, source of tissue sample used, and GenBank Accession Nos. Species Locality GenBank numbers Perciformes: Gobioidei Odontobutidae Odontobutis obscura Souro River, Japan AF391330,AF391402,AF Odontobutis potamophila China, AY722311,AY722371,AY722174,AY AY722290,AY722353,AY722153,AY Percottus glenni Amur R. Basin, Khanka Lake and Dniestr R., Russia AY722367,AY722170,AY AY722308,AY722368,AY722171,AY AY722284,AY722347,AY722146,AY AY722275,AY722339,AY Eleotridae: Butinae Bostrychus sinensis Careening Bay, WA, Australia AY722301,AY722164,AY Butis butis Innes Park, QLD, Australia AY722319,AY722377,AY Kribia nana Niger River at Sulukudjamba AY722287,AY AY722288,AY AY722222,AY722278,AY Milyeringa veritas Northwest Cape, WA, Australia AY722305,AY722168,AY AY722306,AY722169,AY Ophiocara porocephala Innes Park, QLD, Australia AY722314,AY Oxyeleotris lineolatus Adelaide, SA, Australia AY722302,AY722364,AY722165,AY AY722276,AY722340,AY722139,AY Oxyeleotris marmorata AY722315,AY722373,AY722176,AY AY722316,AY722374,AY722177,AY Oxyeleotris nullipora Howard River near Darwin, NT, Australia AY722313,AY AY722307,AY Oxyeleotris selhemi Adelaide, SA, Australia AY722318,AY722376,AY AY722303,AY722365,AY722166,AY Eleotridae: Eleotrinae Calumia godfrayi Philippines AY722262,AY722325,AY722125,AY Dormitator latifrons Rio Caimito, Panama AY722280,AY722343,AY722142,AY AY722274,AY722338,AY722138,AY Dormitator maculatus Palm Beach County, Florida and Rio Mindi, Panama AY722281,AY722344,AY722143,AY AY722273,AY722337,AY722137,AY Eleotris amblyopsis Rio San Lorenzo and Punto del Medio, Panama AY722291,AY722354,AY722154,AY AY722279,AY722342,AY722141,AY AY722272,AY722336,AY722136,AY Eleotris fusca Sulawesi AY722309,AY722369,AY722172,AY Eleotris picta Rio Caimito, Panama AY722286,AY722349,AY722148,AY AY722271,AY722334,AY722135,AY Eleotris pisonis Ounta de Mita, Mexico AY722294,AY722357,AY722157,AY Eleotris sandwicensis Kaaawa, Oahu, Hawaii AF391333,AF391405,AF391477,AY AF391334,AF391406,AF Erotelis armiger Bahia de Jiquilisco, El Salvador AY722304,AY722366,AY722167,AY Erotelis smaragdus Twin Cays, Belize AF391355,AF391427,AF391499,AY Gobiomorphus australis Bucca Bucca Ck and Coraki, NSW, Australia AY722285,AY722348,AY722147,AY AY722283,AY722346,AY722145,AY Gobiomorphus breviceps Ashley River, New Zealand AY722289,AY722352,AY722152,AY Gobiomorphus coxii Bucca Bucca Ck and Richmond R., NSW, Australia AY722351,AY722151,AY AY722350,AY722149,AY Gobiomorphus hubbsi New Zealand AY722295,AY722358,AY722158,AY AY722292,AY722355,AY722155,AY AY722293,AY722356,AY722156,AY Gobiomorus dormitor Rio San Lorenzo, Panama, Gatun Lake AY722282,AY722345,AY722144,AY AY722270,AY722334,AY722134,AY Gobiomorus maculatus Rio Caimito and Rio Mindi, Panama AY722317,AY722375,AY AY722261,AY722324,AY722124,AY AY722269,AY722332,AY722132,AY AY722333,AY722133,AY Guavina micropus La Palma, San Miguel Estuary, Panama AY722268,AY722331,AY722131,AY Hemieleotris latifasciatus Panama, Rio Cardenas, Corozal AY722310,AY722370,AY722173,AY Hypseleotris aurea Gascoyne River, WA, Australia AF391392,AF391464,AF391536,AY (continued on next page)

5 862 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) Table 2 (continued) Species Locality GenBank numbers Hypseleotris compressa Ross River, QLD, Australia AF391366,AF391438,AF391510,AY Hypseleotris klunzingeri Barcoo River, QLD, Australia AF391393,AF391465,AF391537,AY Leptophilypnus Xuviatilis Rio Mindi, Rio San Lorenzo, Panama AY722265,AY722328,AY722128,AY AY722267,AY722330,AY722130,AY AY722266,AY722329,AY722129,AY Leptophilypnus panamensis Rio Caimito, Panama AY722264,AY722326,AY722127,AY AY722263,AY722327,AY722126,AY Microphilypnus ternetzi Manari River, Guyana AY722320,AY722378,AY722181,AY Mogurnda adspersa Ross River, QLD, Australia AF391367,AF391439,AF391511,AY Mogurnda mogurnda Gorge Creek Spring, QLD, Australia AY722277,AY722341,AY722140,AY AY722260,AY722323,AY722123,AY Ophieleotris aporos Ross R., QLD, Australia and Sulawesi AY722296,AY722359,AY722159,AY AY722297,AY722360,AY722160,AY AY722298,AY722361,AY722161,AY AF391368,AF391440,AF Philypnodon grandiceps Glenelg River, VIC, Australia AF391386,AF391458,AF Ratsirakea legendrei Sakalava River, Madagascar AY722299,AY722362,AY722162,AY AY722300,AY722363,AY722163,AY Taeturndina ocellicauda Aquarium supplier (New Guinea) AY722312,AY722372,AY722175,AY Xenisthmidae Xenisthmus sp. Santa Cruz Island, Solomon Islands AF391372,AF391444,AF Perciformes: Percoidei Apogonidae Apogon maculatus Navassa Island, Caribbean AY72254,AY722121,AY Apogon quadrisquamatus Navassa Island, Caribbean AY72255,AY Apogon nigrofasciatus Moorea, Society Islands AY72256,AY Perciformes: Trachinoidei Pinguipedidae Parapercis sp. AY Cheimarrichthyidae Cheimarrichthys fosteri Ashley River, New Zealand AY722258,AY722321,AY722119,AY AY722259,AY722322,AY722120,AY distal outgroup and designated as the root of the phylogeny. A total of 15 ougroup taxa were included. Total genomic DNA was extracted from tissues using the DNeasy Tissue Kit (Qiagen, Chatsworth, CA). PCR reactions were performed directly from genomic DNA (using approximately 300 ng of DNA) with combinations of the goby-speciwc primers listed in Table 3, using Taq DNA Polymerase (Promega, Madison, WI), or Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA) for diycult templates. PCR was performed in 50-μL reactions consisting of 0.4 mm dntp, 1.25 mm magnesium chloride, 0.25-μM of each primer, with 1.25 units of Taq polymerase in a reaction buver containing 50 mm potassium chloride, 10 mm Tris hydrochloric acid (ph 9.0), and 0.1% Triton X-100. Thermal cycling conditions consisted of an initial denaturation step of 94 C for 3 min followed by 35 cycles of a denaturation step of 94 C for 30 s, a variable annealing step of between 43 and 58 C for 30 s, and an extension step of 72 C for 90 s. A Wnal incubation step of 72 C for 7 min was added to ensure complete extension of ampliwed products. PCR products were electrophoresed on a low melting point agarose gel, visualized and photographed, then excised and puriwed with the QIAquick gel extraction kit (Qiagen). AmpliWed DNA fragments were cycle sequenced using Big Dye 3.0 dye terminator ready reaction kits (Applied Biosystems, Foster City, CA). Sequenced products were puriwed by passing the reactions through 750-μL Sephadex columns (2.0 g in 32.0 ml ddh 2 O) and were visualized with an ABI Prism 377 automated DNA sequencer (Applied Biosystems). Both the heavy and light strands were sequenced separately for each short PCR fragment. Sequence chromatograms were edited with Sequencher (GeneCodes, Ann Arbor, MI) and corresponding forward and reverse sequences were aligned to produce a composite Wle of the ampliwed product for each individual sequenced. Sequences were then translated into amino acid residues and aligned by eye. There were no ambiguities or gaps in the alignment; all the gaps present in the Wnal matrix were due to missing data and treated as such (as? rather than a new character state) in the analysis. Aligned nucleotide sequences were exported from Sequencher as NEXUS Wles. All parsimony analyses were performed using PAUP*, version 4.0b8 (SwoVord, 2001). One thousand replications of a heuristic search were run, using TBR branch swapping. The data were designated as equally weighted, following Källersjö et al. (1999) and Broughton et al. (2000).

6 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) Fig. 1. Single most parsimonious phylogenetic hypothesis derived from analysis of ND1, ND2, COI, and cyt b sequence data. Numbers on nodes are decay indices. Brackets at right side indicate family names in current usage. Selected clades are labeled, including Gobioidei, OD (Odontobutidae plus Milyeringa), ED (Eleotridae plus Gobiidae and Xenisthmidae), BU (Butinae, not including Milyeringa, plus Gobiidae), and EN (Eleotrinae plus Xenisthmidae).

7 864 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) Table 3 Goby-speciWc primers used for ampliwcation of ND1, ND2, COI, and cyt b genes Primer Sequence Gene region GOBYL2812 CCCTTACCYAATGAAAVHAWCTAAA ND1 GOBYL2880 GCAAAAGRCCTAAGCCCTTT ND1 GOBYL3543 a GCAATCCAGGTCAGTTTCTATC ND1 GOBYH3985 AACCYYCATKATTCACTCTATCAAA ND1 GOBYH4389 a AAGGGGGCYCGGTTTGTTTC ND1 GOBYL4201 a GTTGCMCAAACMATTTCHTATGAAG ND1 GOBYH4937 a GGGGTATGGGCCCGAAAGC ND1 GOBYL4035 CCCATACCCCAAACATGTCGGTTA ND2 GOBYL4040 GCCCATACCCCWAAYATGTTGGT ND2 GOBYL4041 AAAACTCTTAGTGCTYCCA ND2 GOBYL4575 TGAGGNGGYYTMAAYCAAACHCAA ND2 GOBYL4919 a CCCATACCCCGAAAATGATG ND2 GOBYH5513 a GAGTAGGCTAGGATTTTWCGAAGYTG ND2 GOBYL4641 TGAGGNGGNYTNAAYCAAACTCAA ND2 GOBYL5464 a GGTTGAGGRGGCCTMAACCARAC ND2 GOBYH5174 GGGCTTTGAAGGCYCYTGGTCT ND2 GOBYH5258 TTCACYCYCGCTKAGRRCTTTGAA ND2 GOBYH6064 a CTCCTACTTAGAGCTTTGAAGGC ND2 GOBYL5490 ATGGGGCTACAATCCACCGCTT COI GOBYL6468 a GCTCAGCCATTTTACCTGTG COI GOBYH7127 a ACYTCTGGGTGACCAAAGAATC COI GOBYL7059 a CCCTGCMGGTGGAGGAGACCC COI GOBYH7696 a AGGCCTAGGAAGTGTTGAGGGAAG COI GOBYL5447 TTAGYCTGCTTCTYRAGATTT COI GOBYL5991 GRGCHATYAAYTTYATYACHACHAT COI GOBYL7558 a TTTGCWATTATGGCWGGATTTG COI GOBYH7093 TTCRAAKGTGTGRTARGGMGGWGGG COI GOBYH7141 GGTTATGTRGYTGGCTTGAAAC COI GOBYH8197 a ATTATTAGGGCGTGGTCGTGG COI GOBYL14673 TAATGGCGTGAAAAACCACCGTTGT Cyt b Glu-2 b AACCACCGTTGTTATTCAACTA Cyt b Pro-R1 b TAGTTTAGTTTAGAATTCTGGCTTTGG Cyt b Thr-R1 b TTTAGAATTCTGGCTTTGGGAG Cyt b OsCytb-F1 CACCCATACTTCTCMTAYAAAGA Cyt b GOBYL15314 CACCTHCTHTTYCTNCAYGAAACNGGHTCHAA Cyt b GOBYH15958 TTTGAGCAGDAGGGAGGATTTTA Cyt b Acytb-R1 TCCGGATTACAAGACCGGYGCTTT Cyt b All primers are given in the 5 to 3 direction. a Published in Thacker (2003). b Published in Hardman and Page (2003) and Hardman (2004). Decay indices (Bremer, 1988) were calculated with PAUP* and TreeRot v.2 (Sorenson, 1999). To assess whether the signal from each of the four gene regions was homogeneous, the incongruence length diverence test (ILD) of Farris et al. (1994, 1995) was conducted for all gene regions. The test was implemented as the partition homogeneity test in PAUP* (SwoVord, 2001), with 100 replicates. Tracing of ecology (freshwater or saltwater habitat) and geographic distribution was done with MacClade version 4.06 (Maddison and Maddison, 2000). 3. Results The mitochondrial regions and Xanking trnas of ND1, ND2, COI, and cyt b were ampliwed and sequenced. The entire ND1 (975 bases) was sequenced, as well as 988 bases of ND2 beginning 59 bases downstream of the start codon, and 1255 bases of the CO1 gene beginning 11 bases downstream of the start codon. The cyt b region (1179) began 33 bases downstream of the start codon and continued beyond the stop to include the entire threonine trna. The entire matrix measured 4397 aligned positions. In some cases, one or more gene fragments could not be ampliwed and sequenced successfully, resulting in gaps in the aligned matrix. The ND1 fragment is not included for Gobiomorphus coxii and one individual each of Gobiomorus maculatus and Percottus glenni, and the ND2 fragment is absent in Milyeringa veritas, Oxyeleotris nullipora, Kribia nana, Bostrychus sinensis, Ophiocara porocephala, Parapercis sp., and the three Apogon species. COI was not used for Oxy. nullipora, Ophiocara porocephala, Parapercis sp., A. quadrisquamatus, one individual of P. glenni, and two individuals of K. nana. Cyt b was absent for Philypnodon grandiceps, Ophieleotris aporos, Odontobutis

8 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) obscura, Butis butis, Xenisthmus sp., Parapercis sp., A. nigrofasciatus, one individual each of G. maculatus, Oxy. selhemi, and Eleotris sandwicensis, and the gobiids Bathygobius cocosensis and G. scapulostigma. GenBank numbers for ingroup taxa and newly sequenced outgroup taxa used in this study are given in Table 2. The partition homogeneity test indicates that the partitions are not incongruent (P D 0.45). A single most parsimonious hypothesis was obtained from analysis of the complete data set (Fig. 1). This phylogeny has a length of 29,758 steps (2381 of 4397 characters were parsimonyinformative), consistency index of 0.192, retention index of 0.567, and rescaled consistency index of Decay indices indicate strong support for most nodes, with the exception of some nodes in the Butinae + Gobiidae clade and at the base of the Odontobutidae clade. As mentioned above, several of these species have some missing data, contributing to the low support values for these nodes. All the species and genera examined were found to be monophyletic (based on current sampling), with the exceptions of Oxyeleotris (Oxy. nullipora is not part of Oxyeleotris sensu stricto) and Eleotris (Erotelis is nested within Eleotris, and El. sandwicensis contains El. acanthopoma), as discussed below. 4. Discussion 4.1. Outgroups and sister taxon to Gobioidei Representatives of six groups of percomorphs were used as outgroups, based on previous hypotheses of gobioid sister taxon relationships: Beryciformes (used to root the phylogeny), Dactylopteriformes, Gobiesociformes, Scorpaeniformes (three families), and two suborders of Perciformes: Trachinoidei and Percoidei. Two species of the family Dactylopteridae (found to be close relatives of gobioids in the molecular study of Miya et al., 2003) were included, as well as two species of Gobiesocidae, a candidate gobioid outgroup suggested by Winterbottom (1993). Winterbottom also identiwed the scorpaeniform family Hoplichthyidae as a possible outgroup; this family was not included in the current study, but the triglid Satyrichthys amiscus was considered; in the phylogeny of Smith and Wheeler (2004), Triglidae is placed in the same scorpaeniform subgroup as Hoplichthyidae. The other scorpanoids used in this study (families Cyclopteridae and Cottidae) are both part of an expanded Cottoidei (Smith and Wheeler, 2004). Representatives of the trachinoid families Cheimarrichthyidae, Pinguipedidae, and Trichodontidae were also included in accordance with the suggestions of Winterbottom (1993), although he particularly singled out the families Percophididae, Trichonotidae, and Creedidae. All of these families except the Trichodontidae are part of the Trachinoidei as enumerated by Pietsch (1989) and Pietsch and Zabetian (1990). In the phylogenies presented in these studies, Percophididae, Trichonotidae, and Creedidae form a clade, the sister to which is Pinguipedidae, followed by Cheimarrichthyidae. The placement of Trichodontidae is unresolved; historically and in some recent works (Nelson, 1994), it is placed in Trachinoidei, but Pietsch (1989) and Pietsch and Zabetian (1990) did not consider Trichodontidae a trachinoid. Additionally, many of the diagnostic trachinoid characters used by Pietsch (1989) and Pietsch and Zabetian (1990) were called into question by Mooi and Johnson (1997), in their arguments for removal of Champsodontidae from Trachinoidei; currently the composition and relationships of the various trachinoid families are unclear. Within Trachinoidei, the placement of Cheimarrichthys has been debated, and the genus has either been grouped with the Pinguipedidae (McDowall, 1973, 2000), or in its own family, Cheimarrichthyidae (Imamura and Matsuura, 2003; Pietsch and Zabetian, 1990). The Wnal outgroups considered in this hypothesis are the perciform Pterocaesio tile (Lutjanidae), included as a generalized perciform representative, and three species of the family Apogonidae. Although apogonids and gobioids do not superwcially resemble one another, they share a number of morphological characters of both the skeleton and soft tissues, and have similar reproductive behavior (Johnson, 1993; Winterbottom, 1993). The molecular phylogeny concurs with this character evidence, supporting a sister taxon relationship between Apogonidae and Gobioidei. The next most distal sister taxon is Dactylopteridae, in agreement with the molecular hypothesis of Miya et al. (2003) (Apogonidae was not included in their study). All the other outgroup taxa sampled form a clade outside the Gobioidei, Apogonidae, and Dactylopteridae. Within this clade, the families are mixed, with one group consisting of the trachinoids Cheimarrichthyidae and Pinguipedidae, plus Gobiesocidae and the scorpaeniform Triglidae. The other outgroup clade includes representatives of the perciform Lutjanidae, the scorpaeniform cottoids Cottidae and Cyclopteridae, and the questionable trachinoid Trichodontidae. However, these results must be interpreted cautiously, due to the sparse sampling compared to the overall diversity of percomorpha Monophyly of Gobioidei The molecular phylogeny conwrms abundant morphological evidence in supporting the monophyly of Gobioidei. This character evidence is comprehensive and includes characters of the skull, suspensorium, branchial apparatus, axial skeleton, and pectoral and pelvic Wns (Winterbottom, 1993). The gobioid otolith primordium is distinctive, a character which has been used to determine relationships of even extremely reduced, pedomorphic gobioids (Johnson and Brothers, 1993). Soft tissue

9 866 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) characters also conwrm gobioid monophyly: gobioids have an accessory sperm duct gland on the testis, which is used to secrete the matrix of a sperm trail deposited during demersal spawning (Mazzoldi et al., 2000; Miller, 1984, 1992; Wiesel, 1949). Externally, gobioids are diagnosed by the presence of enlarged, raised free neuromasts (papillae) generally found in a variety of patterns on the head, and the lack of lateral line canals on the body (except in the primitive Rhyacichthys, Protogobius, and Terateleotris), although these characters are also present in a few other percomorph groups (Winterbottom, 1993). Until the present study, investigations of gobioid monophyly with molecular data were limited. Largescale molecular phylogenies typically have included at most one gobioid, and previous molecular studies focused on gobioid interrelationships have generally not included taxa outside Gobioidei (Akihito et al., 2000; Thacker, 2003). Exceptions are the studies of Miya et al. (2003) and Wang et al. (2001). Miya et al. (2003) included two gobioids (Rhyacichthys aspro and E. acanthopoma) in their broad analysis of acanthomorph phylogeny, and these species formed a clade sister to two species of Dactyloptena. Wang et al. s (2001) examination of intra-gobioid relationships was rooted with the outgroup Scomber japonicus. This study concurs with both of those in conwrming the monophyly of Gobioidei, as compared to a diversity of outgroup taxa (Fig. 1) Rhyacichthyidae and Odontobutidae Within Gobioidei, the most basal taxon is R. aspro. The distinctive genus Rhyacichthys is the only member of the family Rhyacichthyidae (loach gobies), and includes two species (Dingerkus and Séret, 1992; Miller, 1973). Molecular data support the morphological evidence in placing R. aspro as the sister to all other gobioids. Rhyacichthys exhibits a suite of primitive characters such as retention of lateral line canals on the body, three epurals in the caudal skeleton, and several rows of ctenii on the scales (transforming ctenii; Miller, 1973; Springer, 1983). Rhyacichthys also is specialized for its ecology, living benthically in fast-xowing streams, and exhibiting a strongly dorsoventrally compressed head, a ventrally directed mouth with expanded lips, and Xeshy pectoral and pelvic Wns. These specializations have led some authors (Akihito, 1986) to doubt the basal placement of Rhyacichthys within gobioids, but the current molecular study conwrms that placement. The New Caledonian Protogobius attiti (Watson and Pöllabauer, 1998) was not assigned to a family when described, but shares with Rhyacichthys the retention of lateral line canals on the body, and is likely a close relative of Rhyacichthys (Akihito et al., 2000). Similarly, the genus Terateleotris (including only one species, T. aspro), known from Laos, possesses body lateral line canals, some transforming ctenii on the scales, and three epurals. Terateleotris was not placed in any gobioid family by its authors (Shibukawa et al., 2001), except to note that it shares some characters with Rhyacichthys and Protogobius, and some with Odontobutis. Protogobius and Terateleotris were not available for this molecular phylogeny. Sister to Rhyacicthys is a large clade containing the families Odontobutidae, Eleotridae, Xenisthmidae, and Gobiidae. Within this large clade, clade OD of Fig. 1 includes the genera Odontobutis and Percottus (Odontobutidae) from freshwaters of east Asia, as well as the Butine eleotrid Milyeringa, a troglodytic genus from Western Australia. Hoese and Gill (1993) erected Odontobutidae for the genera Odontobutis, Percottus, and Micropercops. This study indicates that the sampled taxa of Odontobutidae are monophyletic, although Micropercops was not sampled. Odontobutidae is characterized by: infraorbital bones usually present; large scapula, excluding proximal radial from cleithrum; autogenous middle radial of Wrst pterygiophore of second dorsal Wn; small dorsal procurrent cartilage, not supporting anterior unsegmented caudal rays or extending over distal tip of anterior epural; and a longitudinal papillae pattern. However, none of these characters are diagnostic (synapomorphic) for Odontobutidae. Birdsong et al. (1988) placed Micropercops and Percottus together in their Micropercops group based on axial skeletal features (Odontobutis shares these characters as well). This molecular study also indicates that the Western Australian troglodytic Milyeringa is sister taxon to the odontobutids, but this result must be interpreted cautiously; the decay index support values at the base of the OD, ED, and BU clades (the nodes separating Milyeringa from the rest of the Butinae) are the weakest part of the phylogeny Butinae and Gobiidae Clade ED of Fig. 1 includes all the genera of the family Eleotridae, plus representatives of Xenisthmidae and Gobiidae. Within clade ED, clade EN includes the subfamily Eleotrinae plus Xenisthmidae, and clade BU includes the subfamily Butinae (excepting Milyeringa) plus Gobiidae. Hoese and Gill (1993) provided several diagnostic characters for this clade (all Gobioidei except Odontobutidae and Rhyacichthyidae), including anterior elongation of the procurrent caudal cartilage; no autogenous middle radial in the Wrst pterygiophore of the second dorsal Wn; the upper proximal radial of the pectoral Wn usually in contact with the cleithrum, extending well above the scapula; and a lack of transforming ctenii on the scales. Butinae is undiagnosed in their hypothesis, but characters are provided to diagnose Eleotrinae (A1β sement of adductor mandibulae tendon attaching directly to maxilla, procurrent caudal cartilage extended posteriorly) and Gobiidae (Wve branchiostegal

10 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) rays, pelvic Wns often form a disk; this latter character is frequently reversed). Hoese and Gill (1993) indicated that with its lack of diagnostic characters, Butinae was likely to be paraphyletic. The current molecular hypothesis indicates that Butinae is indeed paraphyletic, with respect to Gobiidae. In the molecular hypothesis of Wang et al. (2001), Butinae is a monophyletic sister taxon to Gobiidae, with Eleotrinae placed outside that clade, and Odontobutidae basal to the remainder. The study of Akihito et al. (2000) is more diycult to interpret, as their phylogeny is not rooted. If Akihito et al. s (2000) data are reanalyzed and rooted with Rhyacichthys, their phylogeny indicates the following relationships: (Rhyacichthys) (Protogobius) (((Odontobutis + Xenisthmus)(Eleotrinae))(Butinae + Gobiidae + Micrope rcops)). This result agrees in most respects with the current phylogeny, with the exception of the placement of Xenisthmus and the absence of Micropercops from the current analysis. Within the BU clade of Fig. 1, two smaller clades are recovered; one includes the genera Oxyeleotris, Bostrychus, Ophiocara, and Kribia, and the other includes Butis and the gobiids Bathygobius and Gnatholepis. The phylogeny indicates that Oxyeleotris is not monophyletic, with the dwarf taxon Oxy. nullipora found outside the remainder of Oxyeleotris, as sister to the dwarf african genus Kribia. O. nullipora is found in northern Australia and southern New Guinea; Kribia is the only African representative included here (other eleotrids found in Africa include some Bostrychus, Dormitator, and Eleotris species). The remaining three Oxyeleotris species examined (Oxy. lineolatus, Oxy. selhemi, and Oxy. marmorata) form a clade sister to Bostrychus+ Ophiocara, a result which is also in accordance with the hypothesis of Wang et al. (2001). Of these, the sister taxa Oxy. lineolatus and Oxy. selhemi both inhabit northern Australia and southern New Guinea; Oxy. marmorata is widespread, recorded from Asia, Indonesia, and the Philippines. Similarly, Bostrychus and Ophiocara are widespread throughout the Indo-West PaciWc, Africa, Australia, and Asia. The remaining members of clade BU are the butine genus Butis and the two representatives of Gobiidae. The gobiids selected represent both major lineages of Gobiidae: Gobiinae (Bathygobius cocosensis) and Gobionellinae (G. scapulostigma). As expected, the gobiids are recovered as sister taxa. Although morphological characters have thus far not demonstrated a close relationship between Gobiidae and the butines, Butinae has not been diagnosed morphologically (Hoese and Gill, 1993). Butis is widespread in the Indo-West PaciWc, recorded from East Africa to Fiji Eleotrinae and Xenisthmidae The large clade EN of Fig. 1 contains all the sampled members of Eleotrinae, as well as the representative of Xenisthmidae. Xenisthmidae is distinctive within Gobioidei, diagnosed by such synapomorphies as the presence of an uninterrupted free ventral margin on the lower lip; reduced or absent premaxillary ascending process; and an ossiwed rostral cartilage (Hoese, 1984; Springer, 1983, 1988). Relationships among the Wve xenisthmid genera have been hypothesized (Gill and Hoese, 1993), but the relationship of Xenisthmidae to other gobioids is unknown; the only character identiwed that indicates higher-level xenisthmid relationships is the presence of six branchiostegal rays, as in other basal gobioid genera. On a Wner scale, within clade EN a subclade is formed by the neotropical dwarf genera Microphilypnus and Leptophilypnus, plus the eastern and central Australian Philypnodon. Microphilypnus and Leptophilypnus are not closely related to the other neotropical genera in this hypothesis, and additionally, are not sister to each other. Instead, the hypothesis is consistent with two invasions of dwarf neotropical eleotrids, or with the presence of more widespread ancestral groups giving rise to the currently present taxa. The distributions of Microphilypnus and Leptophilypnus are widely disjunct: Microphilypnus is known from South America, primarily the Orinoco and Amazon rivers and tributaries, while Leptophilypnus is restricted to Central America, from Panama north to Guatemala. The remainder of clade EN is divided into two subclades: a small group including Ratsirakea, Tateurndina, Ophieleotris, Mogurnda, and Xenisthmus, and a second clade including Gobiomorphus, Hypseleotris, Calumia, and the majority of new world eleotrines sampled (representatives of Dormitator, Guavina, Hemieleotris, Gobiomorus, Eleotris, and Erotelis). Ratsirakea is the only Malagasy endemic taxon included in this analysis (the other endemic Malagasy eleotrid, Typhleotris, was not sampled). Calumia and Xenisthmus are the only marine-dwelling basal gobioid taxa in this hypothesis, and they are not closely related. Calumia is the only reefdwelling eleotrid, and is known from East Africa to the Society Islands; the Australian Hypseleotris is sister to Calumia. Like Ratsirakea, Tateurndina has a relatively restricted distribution, being found only in eastern New Guinea. Xenisthmus and Ophieleotris are widespread in the Indian Ocean and West PaciWc, and Mogurnda is known from Australia and New Guinea. Gobiomorphus is represented by four species from New Zealand and Australia in this hypothesis; G. australis and G. coxii from Australia, and G. breviceps and G. hubbsi from New Zealand. The hypothesis indicates that the Australian taxa form a paraphyletic grade basal to the New Zealand radiation of freshwater Gobiomorphus. The relationships of the three Hypseleotris species examined are congruent with an earlier study of phylogeny for Hypseleotris (Thacker and Unmack, 2005), with H. compressa and H. aurea forming a clade exclusive of

11 868 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) H. klunzingeri. The remaining six genera in the EN clade form a monophyletic group, and these genera comprise a major radiation of eleotrids into the new world tropics. The genera Dormitator, Guavina, Hemieleotris, Gobiomorus, Eleotris, and Erotelis are all found in the neotropics. Of these, Dormitator includes one species known from West Africa (D. lebretonis); and Eleotris is widespread worldwide. Of the species sampled for this study, all were neotropical except for some Eleotris species: E. sandwicensis from Hawaii, E. fusca from Sulawesi, and E. acanthopoma from Indonesia. The genera Eleotris and Erotelis form a clade sister to the remainder of the neotropical genera; those four genera are grouped such that Dormitator is sister to Guavina, and Gobiomorus is sister to Hemieleotris. The basal taxa in these clades, Guavina and Hemieleotris, are both known from the PaciWc. In the molecular hypothesis, Eleotris is paraphyletic with respect to the two Erotelis species A close relationship between Eleotris and Erotelis is also indicated by morphological data. The genera share a common dorsal Wn pterygiophore pattern and vertebral number (Birdsong et al., 1988). The question of whether or not to synonymize Erotelis under Eleotris has been debated based on morphological data. Eleotris is diagnosed by the presence of a preopercular procurrent spine and patterns of sensory pores and papillae (Miller, 1998). Miller (1998) also indicates that Erotelis is distinguishable from Eleotris only in that the former has a high lateral scale count, with small, cycloid scales. Miller (1998) proposes that Erotelis and Eleotris be synonymized, but Pezold and Cage (2002) noted that Erotelis also divers from Eleotris in having a tapered caudal Wn with unsegmented procurrent rays that support a large membrane (rather than 8 10 with limited membrane in Eleotris), a more oblique jaw, more elongate body, more rays in the second dorsal and anal Wns, one more ray in the second dorsal Wn than anal Wn, and a distinctive pigmentation pattern on the Xanks. They recommend that Erotelis and Eleotris be retained as separate genera. This molecular study concurs with Miller (1998) in that Erotelis is nested within Eleotris, and thus the two genera should be synonymized. Miller (1998) also suggests that Leptophilypnus is the sister taxon to Eleotris, due to the shared presence of an opercular row of sensory papillae with some Eleotris species, although Pezold and Cage (2002) point out that the putative synapomorphy is present in only one of the Leptophilypnus species. The molecular phylogeny indicates that Leptophilypnus is distantly related to Eleotris, and instead, that the Eleotris/Erotelis clade is sister to the abovementioned clade of four other neotropical genera. Within the Eleotris/Erotelis clade, two smaller clades are recovered. One consists of El. fusca from Sulawesi, sister to El. amblyopsis from Atlantic drainages of Central and South America. The second clade contains three species pairs: most basal is the pair El. picta and El. pisonis, sister to the pairs E. acanthopoma and El. sandwicensis, and Er. armiger and Er. smaragdus; the Wrst two pairs were also indicated to be closely related by Miller (1998). The relationships of these species present a mixed pattern of distributions: El. picta and El. pisonis are known from PaciWc and Atlantic drainages of Central and South America, respectively, as are the pair Er. armiger and Er. smaragdus. The pair El. acanthopoma and El. sandwicensis are not neotropical; El. acanthopoma is widespread in the Western PaciWc and El. sandwicensis is endemic to Hawaii. Two specimens of El. sandwicensis and one of El. acanthopoma (from GenBank) were included; the nesting of El. acanthopoma within El. sandwicensis may be the result of a misidentiwcation of El. acanthopoma. Although the molecular hypothesis is informative as far as overall patterns within Erotelis and Eleotris, not all the species of Eleotris were sampled, so reconstruction of the complete biogeographic history of the genus would be premature. There are many additional Eleotris species known from Asia, Africa, the Western Atlantic, Eastern PaciWc and the PaciWc Islands not included in this study. The clades revealed in this analysis show remarkable concordance with the traditional, morphology-based taxonomy, and thus no alterations to the taxonomy are proposed. As with an earlier molecular study focussing on higher gobioids (Thacker, 2003), the primary conclusion of this analysis is that Eleotridae is paraphyletic with respect to both Xenisthmidae and Gobiidae. The extensive taxon sampling of this analysis allows more precise determination of the sister taxa to Xenisthmidae (Australian freshwater eleotrids Mogurnda and Ophieleotris), and reveals that Gobiidae is nested within the butines (paralelling Akihito et al., 2000 and Wang et al., 2001) Distribution and ecology of basal Gobioidei Overall, the molecular phylogeny allows interpretation both of distribution and the evolution of ecology in Gobioidei. The majority of the taxa sampled inhabit the Indo-West PaciWc, including Australia, New Guinea, and New Zealand. The basal R. aspro is found in Asia and Oceania, and clade OD includes the Western Australian Milyeringa, sister to the family Odontobutidae, known from Asia. Most of the basal goboid species are known from the Indo-West PaciWc and Australia. Radiations in Africa (Kribia), Madagascar (Ratsirakea), and New Zealand (Gobiomorphus breviceps and G. hubbsi) occurred independently in divergent clades. Invasion of the neotropics occurred at least twice and potentially three times (Microphilypnus and Leptophilypnus together or individually, plus the eleotrine radiation). Within the neotropical goboids, there are Wve examples of geminate taxa occurring on either side of the