Heratemis Walker (Hymenoptera: Braconidae: Alysiinae: Alysiini): revision and reconstruction of the phylogeny combining molecular data and morphology

Transcription

1 Heratemis Walker (Hymenoptera: Braconidae: Alysiinae: Alysiini): revision and reconstruction of the phylogeny combining molecular data and morphology S. Yaakop, C. van Achterberg & Idris bin Abd. Ghani Fourteen new species of the genus Heratemis Walker, 1860 are described and illustrated: H. innodulosa van Achterberg, sp. n. and H. dauluensis van Achterberg, sp. n. from Sulawesi, H. devriesi van Achterberg & Yaakop, sp. n. from Vietnam, Taiwan (China) and West Malaysia, H. fuscicoxa van Achterberg, sp. n. from Indonesia (Papua), H. malayensis Yaakop & van Achterberg, sp. n. from West Malaysia (Pahang, Johor) and East Malaysia (Sabah), H. maculifera van Achterberg, sp. n. from Uganda, H. maiphuquyi van Achterberg, sp. n. from Vietnam, H. mellisternum van Achterberg, sp. n. from Uganda and Kenya, H. nigristernum van Achterberg, sp. n. from Uganda, H. pahangensis Yaakop & van Achterberg, sp. n. from West Malaysia (Pahang), H. pseudofilosa van Achterberg, sp. n. from Java (Indonesia), H. scrobifera van Achterberg, sp. n. from South Africa, H. solomonensis van Achterberg, sp. n. from Solomon Islands and H. sulafilosa van Achterberg, sp. n. from Sula Islands (Indonesia). In addition, the type species of Conalysia Papp, 1969, viz. Heratemis laticeps (Papp, 1969), is fully illustrated. The phylogeny is discussed, combining morphological and molecular data of 28S, 16S, COI and ND1 for those species from which recently collected material was available. Kritscherysia Fischer, 1993, is a new synonym of Heratemis Walker, 1860, and is treated as a subgenus. Heratemis seyrigi (Granger, 1949), H. longimembrum (Fischer, 1993), H. nepalicola (Fischer, 2006) and Gnathopleura muelleri (Schulz, 1912) are new combinations. Hoplitalysia Ashmead, 1900, and Hoplitalysia slossonae Ashmead, 1900, are excluded. A key to the species of the genus Heratemis Walker is added. S. Yaakop*, Department of Terrestrial Zoology, Nationaal Natuurhistorisch Museum Naturalis, Postbus 9517, 2300 RA Leiden, The Netherlands. yaakop@naturalis.nnm.nl C. van Achterberg, same address, achterberg@naturalis.nnm.nl Idris bin Abd. Ghani, School of Environmental and Natural Resource Sciences, Universiti Kebangsaan Malaysia, Bangi, Selangor, Malaysia. idrisgh@pkrisc.cc.ukm.my Introduction The genus Heratemis Walker, 1860 (Braconidae: Alysiinae Stephens, 1829) contains medium-sized parasitoids with conspicuously long antennae. The antennae are often nearly three times as long as the body and have a subapical white band in the females (Figs 8, 9). The genus has never been fully revised and its limits have been unknown for a long time. Wharton & Chou (1983) considerably expanded the definition of the genus in their review of the two species from Taiwan. Wharton (2002) described a new species from Australia and noted a close relationship Tijdschrift voor Entomologie 152: 3 64, Figs [ISSN ] Nederlandse Entomologische Vereniging. Published 1 August * Corresponding author

2 4 Tijdschrift voor Entomologie, volume 152, 2009 between Heratemis and Kritscherysia Fischer, 1993 Molecular data are hardly known; in GenBank we found only two sequences (28S and 16S), both from H. malayensis sp. n. The phylogeny of the Malaysian species of Heratemis was studied for the first time by combining molecular and morphological data. Wharton & Chou (1993) found morphological evidence for a sister-group relation with Phaenocarpa Foerster, Gimeno et al. (1997) reached the same conclusion using three markers (28S, 16S and cytb) of a limited number of taxa. We included three additional taxa as outgroups in the molecular analysis; a species of a new genus near Coelalysia Cameron, 1911, one of the genus Phaenocarpa and one of the genus Cratospila Foerster, In this paper the genus Heratemis is revised and key characters of most species are illustrated. Twentyeight species are recognised, of which fourteen are new to science. Fourteen species are known from the Oriental region (including Nepal), eight from the Afrotropical region, three from Wallacea and three from Australasia. The tribe Alysiini Stephens, 1829, contains koinobiont endoparasitoids of cyclorrhaphous Dipterous larvae. No published records are known for Heratemis (see Yu et al. 2005); only one specimen has been examined that was reared, but the identification of the supposed host family is probably incorrect (Wharton 2002; see notes under H. filosa Walker, 1860). Included species Heratemis Walker, 1860 Subgenus Conalysia Papp, 1969 H. (C.) bakeri (Papp, 1969) H. (C.) devriesi van Achterberg & Yaakop, sp. n. H. (C.) laticeps (Papp, 1969) H. (C.) maiphuquyi van Achterberg, sp. n. H. (C.) nepalicola (Fischer, 2006) comb. n. H. (C.) pahangensis Yaakop & van Achterberg, sp. n. H. (C.) solomonensis van Achterberg, sp. n. H. (C.) ustulata Wu & Chen, 1996 Subgenus Heratemis Walker, 1860 H. (H.) innodulosa van Achterberg, sp. n. H. (H.) filosa Walker, 1860 H. (H.) fuscicoxa van Achterberg, sp. n. H. (H.) malayensis Yaakop & van Achterberg, sp. n. H. (H.) pseudofilosa van Achterberg, sp. n. H. (H.) subnodulosa Wharton, 2002 H. (H.) sulafilosa van Achterberg, sp. n. Subgenus Kritscherysia Fischer, 1993 H. (K.) cubiceps (Papp, 1969) H. (K.) dauluenis van Achterberg, sp. n. H. (K.) enodis Wu & Chen, 1994 H. (K.) longicornis Brues, 1924 H. (K.) longimembrum (Fischer, 1993) comb. n. H. (K.) maculifera van Achterberg, sp. n. H. (K.) madagascariensis (Szépligeti, 1913) comb. n. H. (K.) mellisternum van Achterberg, sp. n. H. (K.) nigristernum van Achterberg, sp. n. H. (K.) scrobifera van Achterberg, sp. n. H. (K.) seyrigi (Granger, 1949) comb. n. H. (K.) tjibodasi (Papp, 1967) H. (K.) vegeta (Papp, 1967) Subdivision of the genus Heratemis The five Malaysian species used for the phylogenetic study are assigned to three subgenera based on morphology. Kritscherysia, was originally described as a genus and is included in the genus Heratemis as a subgenus (stat. n.). It has the typical character states of the genus, viz. the very long vein 1r-m of the hind wing and the narrow first subdiscal cell of the fore wing. The members of Kritscherysia (including Heratemis cubiceps) have a very long third pseudo antennal segment (Figs 31, 184, 194) and the tarsal claws of the females are comparatively robust (Figs 29, 193). The pseudo antennal segment consists of the joined third and fourth antennal segments; the separation between the former segments is sometimes indistinct. Species of the subgenera Conalysia and Heratemis have the third antennal segment about as long as the fourth segment or somewhat shorter and the female tarsal claws are very slender. Members of the subgenus Heratemis (including Heratemis malayensis and H. filosa) have a distinct spine on the scutellum. Members of the subgenus Conalysia (including H. pahangensis and H. devriesi) have the scutellum more or less convex posteriorly and lack a spine on the scutellum. Molecular and phylogenetic analyses Material and methods Five of the fourteen Oriental species of Heratemis were included in our molecular study, Heratemis cubiceps, H. devriesi, H. filosa, H. malayensis and H. pahangensis. The major aim of the molecular study is to find additional support for the relationships based on morphological characters. Four genetic markers were used: one nuclear (28S) and three mitochondrial markers (16S, COI and ND1). In this paper we compare the cladograms generated

3 Yaakop et al.: Revision and phylogeny of Heratemis 5 Table 1. List of DNA vouchers and Gen Bank Accession numbers, all (except Heratemis sp.) from West Malaysia. No. Species Locality Gen Bank Accession No RMNH INS. 28S COI 16S ND1 1 new genus near Coelalysia, Pahang, Hutan EF EF EF EF (SY24) Kuala Lompat 2 Phaenocarpa sp. (2104) Pahang, Taman EF EF EF EF Negara Merapoh 3 Cratospila sp. (SY21) Pahang, Hutan EF EF EF EF Kuala Lompat 4 Cratospila sp. AZR-2005 Pahang, Tanah - AY AY Rata 5 Heratemis sp. No locality data - Z Z Heratemis pahangensis Pahang, Hutan EF EF EF EF (2147) Kuala Lompat 7 Heratemis pahangensis Pahang, Hutan EF EF EF EF (2144) Kuala Lompat 8 Heratemis devriesi (SY7) Cameron EF EF EF EF Highlands 9 Heratemis filosa (SY50) Pulau Pinang, EF EF EF EF Telok Bahang 10 Heratemis filosa (SY6) Cameron EF EF Highlands 11 Heratemis malayensis (S44) Perak, Bukit Larut EF EF EF EF Heratemis malayensis (S33) Pahang, Taman EF EF EF EF Negara Merapoh 13 Heratemis malayensis Johor, Endau EF EF EF (2005) Rompin, Selai 14 Heratemis malayensis Pahang, Taman EF EF EF (2007) Negara Endau Rompin 15 Heratemis cubiceps (SY46) Pahang, Hutan EF EF EF EF Kuala Lompat from the molecular data with those based on morphological characters. The specimens of Heratemis used for the molecular analyses were collected at six localities in Peninsular Malaysia in the period The specimens were preserved in 70% alcohol. Unfortunately, taxon sampling is limited; there was no other recently collected material available which could be used for the molecular analysis. The analysed specimens and the GenBank accession numbers are listed in Table 1. For the recognition of the subfamily Alysiinae, see van Achterberg (1990, 1993, 1997), and for the terminology used in this paper, see van Achterberg (1988). Abbreviations for depositories BILF Beneficial Insects Laboratory, Fuzhou, China BMNH The Natural History Museum, London, U.K. RMNH Nationaal Natuurhistorisch Museum (Naturalis), Leiden, The Netherlands TAMU Texas A&M University, College Station, Texas, U.S.A. UKM Universiti Kebangsaan Malaysia, Bangi, Selangor, Malaysia USNM U. S. National Museum of Natural History, Smithsonian Institution, Washington D.C., U.S.A. ZMB Zoological Museum Bogor-Cibinong, Indonesia. DNA extraction The whole insect was used for DNA extraction, using a modified method from DNeasy Blood & Tissue Kit (Qiagen, Valencia, California, U.S.A.) (the modification was referred as freezing method ). The first to third steps from the manufacturer were modified. According to the original protocol, samples should be cut into small pieces and added to 180 µl of buffer ATL + 20 µl of proteinase K, then the sample has to be incubated at 55 C. However, with the freezing method, the sample is soaked with 180 µl of buffer ATL + 20 µl of proteinase K without destroying

4 6 Tijdschrift voor Entomologie, volume 152, 2009 Table 2. List of primers sequences used in this study. Gene Sequence (5 3 ) 28S 28S AGA GAG AGT TCA AGA GTA CGT G 3 (Forward) (Belshaw and Quicke 1997). 28S TTG GTC CGT GTT TCA AGA CGG G 3 (Reverse) (Campbell et al. 1993). COI Ron- 5 GGA TCA CCT CAT ATA GCA TTC CC 3 (Forward) (Monteiro and Pierre 2000). Nancy- 5 CCC GGT AAA AAT TAA AAT ATA AAC TTC 3 (Reverse) (Monteiro and Pierre 2000). 16S 16SWb- 5 5 CACCTGTTTATCAAAAACAT 3 (Forward) (Dowton and Austin 1994) 16S outer 5 CTTATTCAAATCGAGGTC 3 (Reverse) (Whitfield 1997). ND1 ND1-5 ACT AAT TCAG ATT CTC CTT CT 3 (Forward) (Smith and Kambhampati 1999). ND1-5 CAA CCT TTT AGT GAT GC 3 (Reverse) (Smith et al. 1999). the sample, followed with 10 minutes incubation at 55 C and then kept in a freezer at -22 C overnight. After that the general protocol was used for the remaining steps. The advantage from this modified method is that samples (vouchers) used in this molecular study still exist. If necessary, the specimen can be re-examined and sequenced again. Selection of genetic markers Four markers were selected based on earlier successful use in entomology: n28s rdna, D2 region, mt16s rdna and two mitochondrial protein coding markers, COI and ND1. Gimeno et al. (1997) showed that 28S and 16S markers were informative for resolving the relationships of the subfamilies Alysiinae and Opiinae. The resolution of the cladogram for both subfamilies improved after combining datasets, but failed to resolve the proposed paraphyly of Alysiinae and Opiinae. Belshaw et al. (1998) used the 28S marker for resolving the phylogeny of the Ichneumonidae. Shi et al. (2005) recovered wellsupported relationships in the family Braconidae using 28S and 16S markers. Kambhampati et al. (2000) used the 16S marker to resolve the relationships among genera of the subfamily Aphidiinae and Dowton et al. (1998) for the family Braconidae in general. Smith et al. (1999) and Michel-Salzat & Whitfield (2004) showed that NADH dehydrogenase subunit 1 (ND1) was successful at resolving the relationships in the subfamily Aphidiinae and in the genus Cotesia Cameron, respectively. The COI marker was selected because it successfully resolved the phylogeny of the cyclostome subfamilies in Braconidae with combination of 28S and morphological datasets (Zaldívar- Riverón et al. 2006). Although COI has not frequently been used in braconids, it was successfully used in phylogenetic reconstructions of other insects groups, e.g. in studies of Lepidoptera (Monteiro & Pierre 2000). Polymerase Chain Reaction (PCR) PCR was performed under different conditions for each primer combination using Thermocycler Perkin Elmer The primers used in this study are listed in Table 2. The PCR conditions for each marker is given below. PCR reaction volume was 25µl using 0.25µl of 0.2mM DNTPs, 1µl of 10 pmol of each primer, 0.25µl of 5 U of Taq DNA polymerase, 2.5µl 10 Buffer and 0.5µl of 15 mm MgCl 2 from Qiagen. Sequence and data alignment PCR products were purified using Wizard Genomic DNA Purification Kit by PROMEGA and were subsequently sent to MACROGEN, Korea for sequencing. Sequences obtained were edited using Sequencher 4.2 and were aligned using Clustal W Multiple Alignment (Thompson et al. 1994) using default settings. Coding sequences (COI and ND1) were translated into amino acids with MacClade 4.08 using mitochondrial Drosophila genetic coding. New sequences in this paper were deposited in Gen- Bank (Table 1). Morphological data matrix Ten morphological characters were used in this study. The data matrix is presented in Table 3 and the list of character states is given in Table 4. The three outgroups were included in the analysis as composite taxa because of variation within the taxa. Phylogenetic analysis For maximum parsimony (MP) tree(s) PAUP* 4.0- test version 4.0d63 (Swofford 1998) was used to get the most parsimonious tree(s). A heuristic parsimony search (Hillis et al. 1996) was performed using 100 replicates of random addition sequences, and including the TBR (tree bisection reconnection) option for branch swapping. Each base was treated as an unordered character with equal weight, with gaps treated as missing data. The statistical support was obtained

5 Yaakop et al.: Revision and phylogeny of Heratemis 7 Table 3. Data matrix for the morphological characters of Heratemis. Taxon Character Cratospila sp. 1 0& &1 new genus near Coelalysia sp. 0 0& &1 Phaenocarpa sp. 0 0& &1 Heratemis (Conalysia) bakeri Heratemis (Conalysia) devriesi Heratemis (Conalysia) laticeps Heratemis (Conalysia) maiphuquyi ? Heratemis (Conalysia) nepalicola ? Heratemis (Conalysia) pahangensis Heratemis (Conalysia) solomonensis Heratemis(Conalysia) ustulata Heratemis (Heratemis) innnodulosa Heratemis (Heratemis) filosa Heratemis (Heratemis) fuscicoxa Heratemis (Heratemis) malayensis Heratemis (Heratemis) pseudofilosa Heratemis (Heratemis) subnodulosa Heratemis (Heratemis) sulafilosa Heratemis (Kritscherysia) cubiceps Heratemis (Kritscherysia) dauluensis ? 1 1 1? Heratemis (Kritscherysia) enodis 1? Heratemis (Kritscherysia) longicornis?? Heratemis (Kritscherysia) longimembrum 1? Heratemis (Kritscherysia) madagascarensis?? ? Heratemis (Kritscherysia) maculifera Heratemis (Kritscherysia) mellisternum Heratemis (Kritscherysia) nigristernum Heratemis (Kritscherysia) scrobifera Heratemis (Kritscherysia) seyrigi 1? ? Heratemis (Kritscherysia) tjibodasi 1? Heratemis (Kritscherysia) vegeta 1? by bootstrap analysis with 1000 replications (Felsenstein 1985). MrModelTest version 2.2 (Posada & Crandall 1998) was used to determine the most appropriate model for the sequence model evolution, and the best-fit model (GTR+I+G) was selected by AIC. For the Bayesian analysis (Yang & Rannala 1997; Huelsenbeck et al. 2001), two Markov Chain Monte Carlo (mcmc) runs were done simultaneously with MRBAYES 3.0B4 (Huelsenbeck & Ronquist 2001). Each run was carried out for 10,000 generations with a sample frequency of 10 generations and the first 2,500 generations (250 trees) were discarded as burnin. Maximum Parsimony (MP) and Bayesian analysis were analysed for each molecular dataset and morphology. Combining molecular and morphological datasets was analysed using MP analysis. An Incongruence Length Different test (ILD, PAUP 4.0) or partition homogeneity test (Cunningham 1997) was performed on each marker-pair (four markers, six sets) and on a combined dataset of these four markers with and without the morphological dataset. A heuristic search (PAUP 4.0) was done with 100 replicates of simple addition sequences with TBR (tree bisection reconnection) branch swapping. Results The results of the phylogenetic analysis are summarized in Figs 1 7. The relationships among subgenera in Heratemis remain unresolved (Fig. 1). Maximum Parsimony (MP) and Bayesian analysis using morphological data resulted in a topology that gave general relationships among subgenera and species in Heratemis. Based on the topology, the subgenus Kritscherysia is assumed

6 8 Tijdschrift voor Entomologie, volume 152, 2009 Table 4. List of morphological characters and character states used in the phylogeny analysis of Heratemis. 1. Length of antenna: (0) third antennal segment slightly shorter than fourth or equal to fourth (Figs 21, 27, 41, 46); (1) third antennal segment much longer than fourth (Figs 31, 184, 194). 2. Colour of clypeus: (0) paler than face; (1) darker than face or similar to colour of face. 3. Development of occipital tubercles: (0) absent (Figs 93, 103, 124, 135); (1) present (Figs 32, 34, 37, 143). 4. Spine on the scutellum: (0) absent (Figs 23, 33, 39, 90, 123, 133); (1) present (Figs 16, 17, 57, 58, 107,112). 5. First tergite: (0) slender (Figs 35, 187, 188); (1) comparatively robust (Figs 15, 40, 44, 77). 6. Tarsal claws in female: (0) slender (Figs 12, 26, 42, 105); (1) robust (Fig 29, 121, 130, 183, 193). 7. Hind coxa: (0) rounded basally; (1) angulated basoventrally (Fig. 76). 8. Marginal cell of hind wing: (0) narrowed apically; (1) widened apically (Figs 11, 71, 104). 9. First subdiscal cell of fore wing: (0) narrow and long (Figs 19) (1) wide and short. 10. Length of setose part of ovipositor sheath; (0) times length of hind tibia; (1) more than 0.8 times length of hind tibia. to be the basal group within Heratemis s.l., while the subgenera Conalysia and Heratemis are sister-groups. The 16S dataset was aligned and several ambiguous parts were excluded from the dataset for the phylogenetic analysis. Thirty-two basepairs at positions; 13 14, 45, 77 79, 86 87, 95, 100, 116, , , , 285, 293, 300, 306, 312, 366, 375, 409, , 427 and 446 were excluded. All codon positions were used in the analysis of the COI and ND1 datasets. The topology obtained by combining 1 st + 2 nd codon positions was similar to topology of only 3 rd. codon position in each marker. Combining all codon positions resulted in higher bootstrap values compared to an analysis excluding third codon position. The argument was proven by plotting a graph of p-distance versus number of substitutions (results not shown). All molecular datasets showed that all Heratemis species included in this study were monophyletic (Figs 2 5). None of the markers completely resolved the phylogenetic relationships in Heratemis species and subgenera, and no fully supported phylogeny was congruent with the morphological cladogram (Fig. 1). The results from the homogeneity test are presented in Table 5. Combining the data partitions of four markers generally showed significant Table 5. P-values from individual ILD tests (100 replicates). Combine data partition p-value of ILD test 28S/COI S/16S S/ND COI/16S 1.00 COI/ND S/ND markers (28S/COI/16S/ND1) markers/morphology 1.00 congruence (p= 0.92). Analyses of the four datasets (10 taxa included; 1772 bp; 285 (63%) informative, 167 (37%) uninformative characters) resulted in a resolved cladogram for the subgenera and the species in Heratemis s.l. (Figs. 6a-b). The MP tree showed similar topology to the Bayesian tree, but the difference was only with lower bootstrap value compared to posterior probability at several nodes (Fig. 6a-b). Combining molecular and morphological datasets (10 taxa included; 1782 bp; 295 (64%) informative, 167 (36%) uninformative characters) was also tested with the homogeneity test (Table 5). The value showed significant congruence after combining the molecular markers/morphology datasets (P-values= 1.0). The relationships among Heratemis species after combining the four markers and morphology resulted in a resolved cladogram for the subgenera and the species in Heratemis s.l. (Fig. 7). The cladogram was also congruent to that obtained based on morphological characters only, and two sister subgenera were supported with 80% bootstrap value in the MP analysis (Fig. 7). Indeed, the phylogenetic relationships among taxa of Heratemis were resolved with combining four markers (28S, 16S, COI and ND1), but with low support at certain nodes (Figs. 6a-b). However, combining molecular and morphological data increased branch support values and resulted in a fully resolved cladogram (Fig. 7). Discussion Thirty-two basepairs were excluded from the 16S dataset due to existence of secondary structures. Inclusion of third codon positions in COI and ND1 did not affect topologies and did not influence the phylogenetic signals. So, third codon positions in both protein-coding markers were not saturated.

7 Yaakop et al.: Revision and phylogeny of Heratemis 9 Conclusions In summary, a combination of molecular and morphological data of Heratemis resulted in a fully resolved and supported cladogram (Fig. 7). The relationships among species of Heratemis s.l. were resolved and were in agreement to those found with the morphological dataset. The presence of a spine on the scutellum proved to be the only non-homoplastic character in the analyses. Our data showed that Kritscherysia is the most basal group within the genus, with the subgenera Heratemis and Conalysia as more derived sister groups. Cratospila Foerster is (of the three outgroups) the most closely related to Heratemis. The subgenus Kritscherysia has the widest distribution, occurring both in the Afrotropical and Oriental regions. The two other subgenera (Heratemis and Conalysia) occur in the Oriental region, with an extension to the Australasian region Phaenocarpa sp. Cratospila sp. new genus near Coelalysia Heratemis (Conalysia) bakeri Heratemis (Conalysia) devriesi Heratemis (Conalysia) laticeps Heratemis (Conalysia) maiphuquyi Heratemis (Conalysia) nepalicola Heratemis (Conalysia) pahangensis Heratemis (Conalysia) solomonensis Heratemis (Conalysia) ustulata Heratemis (Heratemis ) innodulosa Heratemis (Heratemis ) filosa Heratemis (Heratemis ) fuscicoxa Heratemis (Heratemis ) malayensis Heratemis (Heratemis ) pseudofilosa Heratemis (Heratemis ) subnodulosa Heratemis (Heratemis ) sulafilosa Heratemis (Kritscherysia) cubiceps Heratemis (Kritscherysia) dauluensis Heratemis (Kritscherysia) enodis Heratemis (Kritscherysia) longicornis Heratemis (Kritscherysia) longimembrum Heratemis (Kritscherysia) madagascarensis Heratemis (Kritscherysia) maculifera Heratemis (Kritscherysia) mellisternum Heratemis (Kritscherysia) nigristernum Heratemis (Kritscherysia) scrobifera Heratemis (Kritscherysia) seyrigi Heratemis (Kritscherysia) tjibodasi Heratemis (Kritscherysia) vegeta Fig. 1. Maximum parsimony tree resulting from MP analysis of the morphological dataset. MP with 1000 bootstrap replicates. 796 MP trees, length = 42, CI = , RI =

8 10 Tijdschrift voor Entomologie, volume 152, S Cratospila sp. AY Heratemis sp. Z93661 Heratemis filosa SY50 Heratemis filosa SY6 Heratemis malayensis SY33 Heratemis malayensis SY44 Heratemis malayensis 2007 Heratemis malayensis 2005 Heratemis cubiceps SY46 Heratemis pahangensis 2147 Heratemis pahangensis 2144 Heratemis devriesi SY7 new genus near Coelalysia SY24 Phaenocarpa sp Figs 2 5. Maximum parsimony tree resulting from MP analysis of the 28S, 16S, COI and ND1 datasets. MP with 1000 bootstrap replicates. 2, 28S, 3 MP trees, length = 78, CI = , RI = ; 3, 16S, 1 MP tree, length = 185, CI = , RI = ; 4, COI, 3 MP trees, length = 249, CI = , RI = ; 5, ND1, 1 MP tree, length = 284, CI = , RI = Cratospila sp. SY21 3 new genus near Coelalysia SY24 16S 100 Phaenocarpa sp Cratospila sp. SY21 Heratemis sp. Z93711 Heratemis malayensis SY33 93 Heratemis malayensis SY Heratemis malayensis 2007 Heratemis malayensis 2005 Heratemis filosa SY50 97 Heratemis cubiceps SY46 Heratemis devriesi SY7 100 Heratemis pahangensis 2147 Heratemis pahangensis Cratospila sp. AY new genus near Coelalysia SY24 Phaenocarpa sp Heratemis filosa SY50 COI Heratemis malayensis SY33 Heratemis malayensis 2007 Heratemis malayensis Heratemis malayensis SY44 Heratemis devriesi SY Heratemis pahangensis 2147 Heratemis pahangensis 2144 Heratemis cubiceps SY46 Cratospila sp. SY21

9 Yaakop et al.: Revision and phylogeny of Heratemis 11 5 ND1 new genus near Coelalysia SY24 Phaenocarpa sp Cratospila sp. SY Heratemis filosa SY50 Heratemis filosa SY6 Heratemis malayensis SY33 Heratemis malayensis SY Heratemis cubiceps SY Heratemis devriesi SY7 Heratemis pahangensis 2147 Heratemis pahangensis a new genus near Coelalysia SY24 Phaenocarpa sp Cratospila sp. SY21 Heratemis filosa SY50 Heratemis malayensis SY33 Heratemis malayensis SY44 Heratemis devriesi SY7 Heratemis pahangensis 2147 Heratemis pahangensis 2144 Figs 6a-b. Maximum parsimony tree (6a) and Bayesian phylogenetic tree (6b) resulting from the analyses of the combined four markers. MP with 1000 bootstrap replicates. 6a: 1 MP tree, length = 644, CI = , RI = ; 6b: Bayesian phylogenetic tree (numbers at the interior nodes are the marginal posterior probability of the clade being correct). Heratemis cubiceps SY46 6b new genus near Coelalysia SY24 Phaenocarpa sp Cratospila sp. SY21 Heratemis filosa SY Heratemis malayensis SY33 Heratemis malayensis SY44 Heratemis devriesi SY Heratemis pahangensis 2147 Heratemis pahangensis 2144 Heratemis cubiceps SY46

10 12 Tijdschrift voor Entomologie, volume 152, new genus near Coelalysia SY24 Phaenocarpa sp Cratospila sp. SY21 Heratemis filosa SY50 Heratemis malayensis SY33 Heratemis malayensis SY44 Fig 7. Maximum parsimony tree resulting from MP analysis of the combined four markers + morphological datasets. MP with 1000 bootstrap replicates. 1 MP tree, length = 659, CI = , RI = Heratemis devriesi SY7 Heratemis pahangensis 2147 Heratemis pahangensis 2144 Heratemis cubiceps SY46 Taxonomic part Heratemis Walker Figs Heratemis Walker, 1860: 310; Shenefelt 1974: 992; Wharton 1980: 43, 78 79; Wharton & Chou 1983: 8; Chen & Wu 1994: 82 83, 162; Wu & Chen 1994: 201, 1996: 21; Belokobylskij 1998: 168; Wharton 2002: 19, Type species (by monotypy): Heratemis filosa Walker, 1860 [examined]. Heratremis; Brues, 1924: (lapsus calami). Conalysia Papp, 1969: 147; Shenefelt 1974: 985; Wharton & Chou 1983: 8. Type species (by original designation): Conalysia laticeps Papp, 1969 [examined]. Synonymized by Wharton & Chou (1983). Kritscherysia Fischer, 1993: 484; Wharton 2002: 19. Type species (by original designation): Kritscherysia longimembrum Fischer, 1993 [examined]. Syn. n. Diagnosis. Length of fore wing mm, and of body mm; antenna times fore wing and of / with a subapical white band, in? white band absent but present in males of H. cubiceps; third antennal segment somewhat shorter than or subequal to fourth segment (Figs 21, 27) or both segments joined into a very long pseudo third segment (Figs 31, 184, 194); frons without a shallow groove medially and rather convex; vertex sparsely setose; ventral margin of clypeus not differentiated; anterior tentorial pits medium-sized and remaining far removed from eye; malar suture absent; pronope absent; marginal cell of hind wing strongly widened apically (Figs 11, 71, 104); mesosternal suture sparsely but distinctly crenulate; postpectal carina complete and rather strong, but absent in H. maiphuquyi; side of scutellum smooth; vein 3-SR of fore wing slightly longer than vein 2-SR; vein 1r-m of hind wing times as long as vein 1-M and posteriorly close to wing margin (Figs 28, 104, 145); scutellum usually posteriorly convex (Figs 23, 33, 39) or with medio-posterior spine (Figs 16, 17, 57, 58, 107, 112); first subdiscal cell of fore wing narrow (vein 2-CU1 5 6 times width of cell (Fig. 19); vein 3-SR of fore wing longer than vein 2-SR, and vein M+CU of hind wing shorter than vein 1-M; cu-a of hind wing short; hind coxa angulate baso-ventrally (Fig. 76); tarsal segments of / very slender (Figs 12, 26, 42, 105), but less so in the subgenus Kritscherysia (tarsal claws of the females are comparatively robust (Figs 29, 121, 130, 183, 193)) and of? more robust (Figs 50, 51), but of H. laticeps tarsal claws of both sexes are similar (Fig. 84) and of / H. solomonensis tarsal claws are robust (Fig. 170); inner side of hind tibia densely and long erect setose; first-fourth hind tarsal segments of Asobara -type, apical appendage usually glabrous (Fig. 12), but basally setose in e.g. H. sulafilosa (Fig. 173); dorsope of first metasomal tergite present (Figs 15, 44, 176), but absent in H. cubiceps (Fig. 35); second and following tergites smooth; second metasomal suture absent; upper valve of ovipositor with weak nodus and its lower valve without teeth; ovipositor sheath with apical spine; hypopygium medium-sized and apically truncate. Distribution. South Palaearctic and Palaeotropics: Oriental, Australian, and Afrotropical regions. Notes. Papp (1969) synonymized Hoplitalysia Ashmead, 1900, with Heratemis Walker. As a consequence two New World species were included in

11 Yaakop et al.: Revision and phylogeny of Heratemis Heratemis: the South Nearctic Hoplitalysia slossonae Ashmead, 1900 (type species of the genus Hoplitalysia Ashmead, 1900) and H. muelleri Schulz, 1912, from Brazil. Both lack the typical characters (e.g. the very long vein 1r-m of the hind wing and the narrow first subdiscal cell of the fore wing) of the genus Heratemis Walker and H. muelleri has an acute clypeus. Wharton (1980) re-instated the genus Hoplitalysia with only H. slossonae remaining in the genus. Here we transfer H. muelleri to the genus Gnathopleura Wharton, 1980 (G. muelleri (Schulz, 1912) comb. n.). These actions render the genus Heratemis to be a Palaeotropical genus. The subgenus Kritscherysia Fischer, 1993 (syn. n.) contains an aberrant group within the genus Heratemis of which part of the members have a very long pseudo-third antennal segment. In the subfamily Alysiinae and the Oriental region only members of genus Neurolarthra Fischer, 1976, rival the extremely long antenna of members of the genus Heratemis Walker (Figs 8, 9). In the Afrotropical region members of Haeselyusa Fischer, 1997, and in the Neotropical region of Ilatha Fischer, 1975, have similar long antennae. 10 Figs Heratemis spp. -5, Heratemis malayensis, /, paratype, Sabah, Mt Kinabalu. 9, 10. H. filosa, /, 9 from Sri Lanka, from cucumber fly and 10 from Sabah, Danum Valley. 8, 9, habitus, lateral aspect; 10, head and mesosoma, lateral aspect. Key to the species of Heratemis 1. Third (actually joined third and fourth segments, sometimes vaguely separated) antennal segment times as long as following segment and 9 11 times as long as wide (Figs 31, 184, 194, 199); but unknown of H. madagascariensis and longicornis) and division not well visible in lateral view; setose part of ovipositor sheath times as long as hind tibia and times as long as first metasomal tergite (but, respectively, 0.7 times and nearly twice in H. enodis and ustulata); first tergite slender (Figs 35, 187, 188, 196, 202), usually 2.2 times as long as its apical width or longer; tarsal claws of / comparatively robust (Figs 29, 183, 193, 203); (subgenus Kritscherysia) Third antennal segment times following (= real fourth) segment and about 3 times as long as wide (Figs 21, 27, 41), rarely third segment only partly separated from fourth segment, but the separation remain visible in lateral view; setose part of ovipositor sheath times as long as hind tibia and longer than 1.6 times first tergite; first tergite usually comparatively robust (Figs 15, 40, 44, 77), about twice as long as its apical width or shorter; tarsal claws of / very slender (Figs 12, 26, 84, 105,

12 14 Tijdschrift voor Entomologie, volume 152, ) to comparatively robust (Figs 121, 162, 170) Head widened behind eyes and rather subcubical; notauli largely absent; pterostigma pale brown; Madagascar... H. madagascariensis - Head parallel-sided or somewhat narrowed behind eyes and more or less transverse; notauli usually complete, rarely reduced posteriorly; pterostigma brown or dark brown Notauli obsolescent or absent posteriorly; hind tibia brownish-yellow; ventral half of pleural sulcus smooth or sparsely crenulate; Madagascar.... H. seyrigi - Notauli distinct posteriorly, deep; hind tibia brown, dark brown or blackish; ventral half of pleural sulcus distinctly crenulate Temple with a distinct tubercle (Figs 34, 201); dorsope of first metasomal tergite absent (Figs 35, 202) or obsolescent, but distinct in H. enodis; clypeus distinctly protruding (Figs 34, 201); antenna of? with white subapical band (but unknown of H. enodis); middle lobe of mesoscutum more convex than lateral lobes (Figs 33, 200) Temple without a distinct tubercle (Figs 186, 197), rarely slightly developed (Fig. 189); dorsope of first tergite present (Figs 187, 188, 196, but sometimes minute); clypeus variable (Figs 186, 189, 197); antenna of? without white subapical band (unknown of H. vegeta and tjibodasi); middle lobe of mesoscutum often similarly convex as lateral lobes (Figs 185, 190, 195)... 7 Note. If length of the first metasomal tergite is about 3 times its apical width, the head deeply excavated medio-posteriorly, the setose part of the ovipositor sheath about 0.9 times as long as its hind tibia and about 3 times as long as its first tergite and the exserted ovipositor distinctly longer than the hind tibia cf. H. longicornis Brues, 1924, from South Africa (Zululand). 5. Dorsope of first metasomal tergite distinctly developed; antenna of / with 20 th -27 th segments white and following segments dark brown; first metasomal tergite with complete median carina and laterally finely longitudinally striate; setose part of ovipositor sheath about 0.7 times as long as hind tibia; China (Yunnan)... H. enodis - Dorsope of first metasomal tergite absent (Figs 35, 202) or obsolescent; antenna of / with 30 th -40 th or 32 nd -41 st segments white (but in / of H. cubiceps from Java with only 4 5 white segments) and basal segments brownish; first metasomal tergite largely smooth (Fig. 35); setose part of ovipositor sheath times as long as hind tibia (unknown of H. dauluensis); [face black and usually rather coarsely punctate] Posterior half of first metasomal tergite evenly convex, smooth and strongly shiny (Fig. 35); hind femur yellowish or infuscated subapically, similar to colour of apex of femur; tubercle of temple acute (Fig. 34); mandible brown; Sundaland (West & East Malaysia (Sabah); Indonesia (Java)) H. cubiceps - Posterior half of first tergite flattened medially, distinctly striate and moderately shiny (Fig. 202); hind femur darkened subapically, darker than yellowish apex of femur (Fig. 204); tubercle of temple obtuse (Fig. 201); mandible dark brown; Wallacea (Sulawesi)...H. dauluensis 7. First metasomal tergite distinctly widened apically and times as long as its apical width (Fig. 196); propodeal areola with a pair of distinctly dorsally protruding obtuse lamelliform sublateral lobes (Fig. 195); hind femur, tibia and tarsus yellowish-brown; face, head dorsally and mesoscutum orangebrown; setose part of ovipositor sheath about 1.7 times as long as first tergite and about 0.6 times hind tibia; [32 nd -39 th antennal segments of / white, but 32 nd segment rather yellowish]; Philippines.... H. vegeta - First metasomal tergite hardly widened apically and times as long as its apical width (Figs 187, 188); propodeal areola without a pair of distinctly protruding lobes, or with posteriorly protruding corners (Fig. 185); hind tibia and tarsus dark brown; hind femur more or less infuscate dorsally; face blackish-brown or pale yellowish, head dorsally black or dark brown and mesoscutum dark brown or yellowish-brown and laterally infuscate; setose part of ovipositor sheath about 1.4 times as long as first tergite and about 0.5 times hind tibia Middle lobe of mesoscutum anteriorly distinctly protuberant in lateral view (Fig. 185); temple comparatively narrow (Fig. 186); face and clypeus blackish-brown; mesoscutum dark brown medially; first metasomal tergite largely smooth medially (Fig. 187); Oriental: Singapore, Malaysia (Cameron Highlands), Indonesia (Java), Philippines (Luzon) H. tjibodasi

13 Yaakop et al.: Revision and phylogeny of Heratemis 15 - Middle lobe of mesoscutum normal, anteriorly hardly protuberant in lateral view (Fig. 190); temple comparatively wide (Fig. 189); face and clypeus pale yellowish; mesoscutum medially yellowish-brown and laterally infuscate; first tergite at least with some striae medially (Fig. 188), usually completely coarsely longitudinally striate; Afrotropical: Seychelles... H. longimembrum 9. Scutellum of / with distinct apical spine posteriorly (Figs 16, 17, 63, 67, 107, 112); in? sometimes less developed); clypeus black or brown, often face similarly coloured of face or somewhat paler, but rather contrasting in some specimens of H. filosa and in H. sulafilosa; eyes distinctly protruding above level of antennal sockets; (subgenus Heratemis) Scutellum of / without trace of spine, but slightly convex at base and distinctly convex posteriorly (Figs 23, 39, 83, 90, 123, 133), rarely flat (Fig. 101); clypeus often yellow or pale brown and distinctly paler than face; size of eyes variable; (subgenus Conalysia, but Afrotropical species belong to subgenus Kritscherysia despite a more or less normal third antennal segment, but shape of basal part of first tergite and shape of tarsal claws indicate this relationship) Occipital tubercle of / obsolescent or absent, at most as a weak convexity (Figs 13, 68); eye comparatively large, 4 12 times wider than minimum width of temple above base of mandible (Figs 13, 68); depression in front of lateral lobes comparatively small (Fig. 14) Occipital tubercle of / distinctly developed (Figs 45, 55, 115, 116, 148; but in? sometimes less developed); eye medium-sized, 3 4 times wider than minimum width of temple above base of mandible (Figs 68, 115, 116, 148); depression in front of lateral lobes comparatively large (Figs 59, 108), but smaller in H. sulafilosa (Fig. 174) Length of setose part of ovipositor sheath about 1.7 times as long as hind tibia and about twice as long as mesosoma; eye 7 12 times wider than minimum width of temple above base of mandible; antenna of / with 7 8 white segments; Australia (Queensland).... H. subnodulosa - Length of setose part of ovipositor sheath times as long as hind tibia and times as long as mesosoma; eye 4 6 times wider than minimum width of temple above base of mandible (Fig. 13); antenna of / with 3 6 white segments Notauli anteriorly and depression in front of lateral lobes obsolescent (Fig. 67); clypeus and mandible dark brown; propleuron, mesoscutum, scutellum, mesopleuron ventrally and mesosternum black; base of hind tibia dark brown; tegulae brown; hind coxa dark brown; metasoma (except black first tergite) brown, but dorsally darkened; Indonesia (Papua)... H. fuscicoxa - Notauli anteriorly and depression in front of lateral lobes distinctly impressed (Fig. 16); clypeus and mandible, propleuron, mesoscutum, scutellum, mesopleuron ventrally and mesosternum yellowish-brown; base of hind tibia ivory or whitish; tegulae and hind coxa pale brownish-yellow; metasoma blackish, but ventrally and eighth tergite yellowishbrown; Indonesia (Sulawesi)... H. innodulosa 13. Scutellar spine somewhat up curved (Fig. 177); third antennal segment of / similarly golden yellow as scapus (but dark brown in?); antenna of / with about 9 white segments; clypeus of / yellowish-brown; depression in front of lateral lobes comparatively small (Fig. 174); notauli end in a wide depression and no separate medio-posterior depression of mesoscutum (Fig. 178); Indonesia (Sula Islands)... H. sulafilosa - Scutellar spine straight or down-curved (Figs 46, 53, 58, 60, 107, 149); third antennal segment of / brown, distinctly darker than scapus; antenna of / with 2 8 white segments; clypeus of / black or brown, rarely yellowish-brown; depression in front of lateral lobes comparatively large (Figs 59, 108); notauli end in a narrow depression and with a separate medio-posterior depression Length of setose part of ovipositor sheath times as long as hind tibia and times as long as fore wing; spine of scutellum in dorsal view times as long as median carina of scutellar sulcus (Figs 49, 54, 57, 152), if times then straight in lateral view (Fig. 149); hind trochantellus similarly pale yellowish or brown as hind trochanter and hind femur usually yellowish-brown; middle lobe of mesoscutum often strongly protuberant and distinctly above level of lateral lobe (Figs 53, 149); spine of scutellum more pointing dorsally compared to dorsal face of scutellum, straight and slender apically

14 16 Tijdschrift voor Entomologie, volume 152, 2009 (Figs 46, 53, 58, 60, 149); mesoscutum often completely yellowish-brown medio-posteriorly, similar to colour of mesopleuron ventrally and mesosternum; vein 3-SR of fore wing times as long as vein 2-SR (Figs 43, 56, 144) Length of setose part of ovipositor sheath times as long as hind tibia and about 0.65 times as long as fore wing; spine of scutellum comparatively short ( times median carina of scutellar sulcus; Fig. 112), if times then spine curved in lateral view and often somewhat widened apically (Fig. 113); hind trochantellus darker than hind trochanter and hind femur more or less dark brown; middle lobe of mesoscutum less protuberant, near level of lateral lobe (Figs 107, 113); spine of scutellum more pointing apically compared to dorsal face of scutellum, often curved and comparatively wide apically (Fig. 107); mesoscutum of? black or blackish-brown and of / often dark chestnut brown medio-posteriorly, if completely yellowish-brown (specimens from lowland Borneo (Sabah)) then distinctly darker than mesopleuron ventrally and mesosternum; vein 3-SR of fore wing times as long as vein 2-SR (Fig. 104); Sundaland: W & E Malaysia... H. malayensis 15. Antenna of / with 2 white segments; pedicellus infuscate, darker than yellowish-brown scapus; spine of scutellum in dorsal view times as long as median carina of scutellar sulcus (Fig. 152); vein M+CU of hind wing times as long as vein 1r-m of hind wing (Fig. 145); area in front of lateral lobe of mesoscutum rather short (Fig. 150); pterostigma of / triangular (Fig. 144); Indonesia (Java)... H. pseudofilosa - Antenna of / with 4 10 white segments; pedicellus pale yellowish as scapus or nearly so; spine of scutellum in dorsal view times as long as median carina of scutellar sulcus (Figs 49, 54, 57); vein M+CU of hind wing times as long as vein 1r-m of hind wing; area in front of lateral lobe of mesoscutum rather long (Fig. 59); pterostigma of / more or less elliptical (Fig. 56); Sri Lanka, China, Vietnam, Philippines (Mindanao), Malaysia (Sabah, West Malaysia) and Indonesia (Sumatra, Kalimantan, Lombok).... H. filosa Note. We have seen 1? + 1 / of a similar species from Luzon (USNM: Philippines: Mt. Makiling) too mutilated to be described but obviously belonging to a new species. They have the head completely yellowishbrown and the vertex is flattened in lateral view. 16. Legs completely black; ovipositor sheath about as long as fore wing... H. nepalicola - Legs yellowish-brown, at most partly dark brown; ovipositor sheath times as long as fore wing Scutellum flat posteriorly and near level of metanotum (Figs 101, 155); temple without distinct tubercle; medio-posteriorly mesoscutum paler than remainder of lateral lobes Scutellum distinctly elevated posteriorly above level of metanotum, more or less steep (Figs 23, 39, 83); temple variable, often with a tubercle (Figs 25, 41, 68), except of Afrotropical spp.; mesoscutum usually unicoloured Mesopleuron with round and deep episternal scrobe, isolated from pleural sulcus (Fig. 159); postpectal carina present; face coarsely punctate; notauli moderately wide and posteriorly ending in a small medioposterior depression (Fig. 161); mesopleuron largely dark chestnut brown; scutellum brownish-yellow; clypeus dark chestnut brown to yellowish-brown; third antennal segment about 6 times as long as wide (Fig. 160); vein SR1 of fore wing about thrice as long as vein 3-SR (Fig. 153); [fore leg with long ventral setae; antenna of / with 28 th - 34 th /35 th, 27 th -33 rd /34 th or 27 th -29 th segments white;] Afrotropical (South Africa; Cape)... H. scrobifera - Mesopleuron with linear and shallow episternal scrobe, connected to pleural sulcus; postpectal carina absent; face finely punctate; notauli narrow posteriorly and without a medio-posterior depression (Fig. 97); mesopleuron largely yellowish-ivory (except dorsally); scutellum more or less brown; clypeus brownish-yellow; third antennal segment about 4 times as long as wide (Fig. 99); vein SR1 of fore wing about twice as long as vein 3-SR (Fig. 95); [apex of clypeus truncate and clypeus nearly square]; Oriental (Vietnam).... H. maiphuquyi 19. Surface of scutellum distinctly oblique in lateral view (Figs 23, 138); tarsal claws of? moderately robust, distinctly different from slender claws of / (Fig. 142; unknown of H. bakeri) Surface of scutellum subhorizontal in lateral view (figs. 39, 75); tarsal claws of? of

15 Yaakop et al.: Revision and phylogeny of Heratemis 17 H. laticeps similar to claws of / (Fig. 84; unknown of other spp.) Temple of / below tubercle of head comparatively wide (Fig. 25), maximum width of head about 2.3 times length of eye in dorsal view (Fig. 22); setose part of ovipositor sheath about 0.7 times as long as hind tibia; protruding outer lamella of axilla of scutellum largely pale yellowish; mesoscutum yellowish-brown posteriorly; 23 rd antennal segment of / white; Philippines (Mindanao)... H. bakeri - Temple of / below tubercle of head comparatively narrow (Fig. 143), maximum width of head about 2.6 times length of eye in dorsal view (Fig. 139); setose part of ovipositor sheath about 0.9 times as long as hind tibia; protruding outer lamella of axilla of scutellum at least largely and often mesoscutum posteriorly largely dark brown; 23 rd antennal segment of / dark brown; West Malaysia (Pahang), East Malaysia (Sabah) H. pahangensis Note. If third antennal segment not well separated from fourth segment, the setose part of the ovipositor sheath about 0.7 times as long as hind tibia and slightly less than twice as long as the first tergite and 28 th -29 th antennal segments dark brown, cf. H. enodis from China. 21. First tergite slender and with a subbasal constriction (Figs 87, 118, 128); temple without tubercle (Figs 92, 125, 136); 20 th -25 th antennal segments of / brown; setose part of ovipositor sheath times as long as hind tibia; Afrotropical First metasomal tergite comparatively robust and without subbasal constriction (Figs 40, 77); temple with tubercle (Figs 41, 79), but absent in H. solomonensis (Fig. 166); at least part of 20 th -25 th antennal segments of / white; setose part of ovipositor sheath times as long as hind tibia; Oriental and Australasian Length of first metasomal tergite about 3 times its apical width; head deeply excavated medio-posteriorly; setose part of ovipositor sheath about 0.9 times as long as hind tibia and about 3 times as long as first tergite, exserted ovipositor distinctly longer than hind tibia; [28th-33rd antennal segments of / white; middle lobe of mesoscutum black and lateral lobes partly brownish]; South Africa (Zululand)... H. longicornis - Length of first tergite times its apical width (Figs 87, 118, 128); head at most shallowly excavated medio-posteriorly; setose part of ovipositor sheath times as long as hind tibia and times as long as first tergite, exserted ovipositor times as long as hind tibia; [eye times longer than temple in dorsal view]; East Africa Basal antennal segments with long erect setae and scapus more slender (Fig. 89); mesopleuron with dark patch antero-dorsally; setae of fore trochanter and trochantellus mediumsized (Fig. 91); fore tarsus completely infuscate; precoxal sulcus distinctly sculptured anteriorly; 29 th antennal segments of / dark brown; [scutellum largely dark brown; antenna of / with 31 st -35 th /38 th or 30 th -34 th segments white]... H. maculifera - Basal antennal segments with medium-sized and more adpressed setae and scapus more robust (Figs 126, 131); mesopleuron completely dark brown or yellowish-brown; setae of fore trochanter and trochantellus comparatively long (Figs 119, 132); fore tarsus partly or completely pale brown; precoxal sulcus narrowly sculptured anteriorly; 29 th antennal segments of / white or pale brown Vein 3-SR of fore wing times longer than vein 2-SR (Fig. 127); scutellum of /, mesosternum and mesopleuron dark brown or blackish; scutellum in lateral view less steep posteriorly (Fig. 133); densely setose near ventral border of precoxal sulcus; 28 th antennal segments of / pale brown or blackish-brown; [antenna of / with 29 th -33 rd or 30 th -34 th segments white]... H. nigristernum - Vein 3-SR of fore wing times longer than vein 2-SR (Fig. 117); scutellum of /, mesosternum and mesopleuron yellowishbrown; scutellum in lateral view steep posteriorly (Fig. 123); comparatively sparsely setose near ventral border of precoxal sulcus; 28 th antennal segments of / white; [antenna of / with 26 th -31 st or 28 th -33 rd /34 th segments white].... H. mellisternum 25. Mesoscutum and scutellum black; temple without tubercle (Fig. 166); setose part of ovipositor sheath about 0.6 times as long as hind tibia; antenna of / with about 11 white segments; middle and hind trochantelli darker than trochanters; tegulae and base of hind coxa dark brown; first metasomal tergite more robust (Fig. 164).. H. solomonensis - Mesoscutum and scutellum yellowishbrown; temple with tubercle (Figs 41, 75, 79), but absent in H. ustulata; setose part