MOLECULAR PHYLOGENY, BIOGEOGRAPHY, POPULATION STRUCTURE AND TAXONOMY OF LARGE BARBINE MINNOWS (LABEOBARBUS: CYPRINIDAE) KEBEDE ALEMU BESHERA

Transcription

1 MOLECULAR PHYLOGENY, BIOGEOGRAPHY, POPULATION STRUCTURE AND TAXONOMY OF LARGE BARBINE MINNOWS (LABEOBARBUS: CYPRINIDAE) by KEBEDE ALEMU BESHERA PHILLIP M. HARRIS, COMIITTEE CHAIR LESLIE RISSLER JUAN M. LOPEZ-BAUTISTA DANIEL GRAF RICHARD MAYDEN A DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Biological Sciences in the Graduate School of The University of Alabama TUSCALOOSA, ALABAMA 2012

2 Copyright Kebede Alemu Beshera 2012 ALL RIGHTS RESERVED

3 ABSTRACT The phylogeny, biogeography, population genetics and taxonomy of Labeobarbus (Cyprinidae), a genus of large hexaploid minnows, was estimated by a variety of phylogenetic and population genetics methods. In Chapter 2 relationships among species of large barbine minnows was examined based on analysis of variation in complete mitochondrial (mt) cytochrome b (cyt b) gene sequences. In all analyses hexaploid minnows from Saharan and Sub-Saharan Africa and the Middle East were recovered as a monophyletic taxon. This clade diverged from European tetraploid and African diploid and tetraploid lineages approximately 13 MYA. The earliest cladogewnetic event within this clade occurred ca 5.0 MYA giving rise to Sub-Saharn African and Saharan African-Levant clades. Subsequent cladodenesis within the clade took place during the Plio-Pleistocene. Chapter 3 investigated the phylogeography of Labeobarbus intermedius across its geographic distribution in Ethiopia based on analysis of complete cyt b gene sequences. Phylogenetic analysis recovered two distinct geographic lineages (northern and southern) within L. intermedius, which diverged from each other ca Late Pleistocene consistent with the timing of Pleistocene volcanic activities in East Africa. Chapter 4 developed microsatellite DNA markers for use in Chapter 5. Seventy-two microsatellite primers were developed based on a genomic library of Labeobarbus intermedius employing next generation 454 sequencing. Six polymorphic loci were examined over 35 L. intermedius specimens and tested for cross-species amplification in other Labeobarbus taxa. Genetic diversity was high with 99 alleles identified in L. intemedius with an average of 16.5 alleles per locus. Observed heterozygocity ranged from across all loci. These loci also ii

4 amplified successfully across all taxa. In Chapter 5, ten microsatllite DNA loci and mitochondrial cytochrome oxidase I (COI) and cyt b gene sequences were analyzed to investigate population structure and evolutionary relationships within the Labeobarbus species flock of Lake Tana. Phylogenetic analyses based on COI and cyt b gene sequences consistently rejected the monophyly of Lake Tana Labeobarbus haplotypes and recovered all haplotypes as part of a larger clade that contained haplotypes from independent drainages throughout Ethiopia. Bayesian clustering analysis of ten microsatellite markers employing STRUCTURE revealed little genetic differentiation within the Lake Tana Labeobarbus suggesting that alleles were shared among individuals and putative species in the species flock. The resolved phylogeny and lack of population differentiation in Lake Tana Labeobarbus may suggest either these evolutionary lineages are at an early stage of an ongoing adaptive radiation in Lake Tana or lack of signal in molecular markers examined. iii

5 DEDICATION This dissertation is dedicated to my parents, Alemu Beshera and Ayelech Wodajo, for all what they have done for me including giving me the opportunity to see the light. iv

6 LIST OF ABREVIATIONS a A ABI AMOVA ANL AWMISET bp BP C Ca CAR CBOL CI CO1 CRV CTOL Cytb o C DNA DNASP mean number of alleles per locus Adenine Applied Biosystems Analysis of Molecualr Variance Addis Ababa-Nekemt lineament Agricultural Water Management Information System of Ethiopia base pairs before present Cytocine around Central African Republic Barcode of Life Credible Interval Cytochrome Oxydease I gene Central Rift Valley Cypriniformis Tree of Life cytochrome b gene Degree Celsius Deoxyribonucleic Acid DNA Sequence Polymorphism (Software for analysis of DNA polymorphism) v

7 DNTP DRC e.g. EtOH Et al. FAM F FIG F S FIS G GBL GBN G IS GTR+ Γ h H d HEX HN Hap HiDi Deoxy Ribonucleotide Triphosphate Democratic Republic of Congo For example ethanol and others Carboxyfluorescein Forward primer Figure Fu s (1997) demographic statistic Hardy Weinberg (Fixation Index) Guanine Goba-Bonga Lineament GenBank number inbreeding coefficient Generalized Time Reversible (model of DNA evolution) haplotype diversity haplotype diversity Hexachloro-fluorescein Haplotype number Haplotype Highly deionized vi

8 H 2 O H E H N H O HPD H t i.e. IUCN K ΔK KU Water Expected Heterozygocity Haplotype number Observed heterozygocity Highest Posterior Density Interval Total heterozygocity That is to say International Union for Conservation of Nature The number of genetically differentiated clusters rate of change in the log probability of data between successive K values Kansas Universisty µ Micro µl Microliter µm Micromolar mtdna ncdna MCMC MgCl 2 MHC ML MY mitochondrial DNA nuclear DNA Markov chain Magnesium Chloride Major Histocompatibility Complex Maximum Likelihood million years vii

9 MYA MP Ng N A NS NSF OTU P PAUP PCR PEG PMY R R 2 million years Ago Maximum Parsimony Nanogram Number of alleles Number of samples National Science Foundation Operational Taxonomic Unit p-value Phylogenetic Analysis Using Parsimony (Computational phylogenetics program) Polymerase Chain Reaction Polyethylene Glycol Percent per million years Reverse primer Statistical test (developed by by Ramos-Onsins and Rozas, 2002) for detecting population growth RNAse RV SA SAIAB SL SLC Ribonuclease (type of nuclease that catalyzes the degradation of RNA) Rift Valley Allele size range South African Institute of Aquatic Biodiversity Standard length Sampling locality coordinates viii

10 SRV Ф ST R2 RAxML T TAMRA TCS TBR T m TMRCA UAIC YA Southern Rift Valley statistical measure of population differentiation statistics used to detect departures from constant population size Randomized Accelerated Maximum Likelihood Thymine One of four Fluorescent dyes used to label DNA templates Phylogenetic network estimation software using Statistical Parsimony Tree-Bisection-Reconnection Annealing temperature time to Most Common Ancestor University of Alabama Ichthyological Collections years ago ix

11 ACKNOWLEDGMENTS Thanks are especially due to Dr. Phillip M. Harris, my advisor, for his support and guidance from developing to completion of this dissertation. I couldn t have done this work without his help. I am also grateful to my Graduate Committee members, Drs. Leslie Rissler, Daniel Graf, Juan Lopez-Bautista, and Richard Mayden, for their support throughout this dissertation and constructive comments on the manuscript. Financial support of the Cypriniforms Tree of Life Project was invaluable in allowing me to conduct fieldwork in Ethiopia and covering all costs associated with my dissertation. My appreciation also goes to the Department of Biological Sciences and Graduate School, The University of Alabama, for providing additional financial assistance. I express my thanks to South African Institute of Aquatic Biodiversity (SAIAB) and University of Kansas Fish Collection for providng some samples used in this dissertation, Jimma University for logistic support during field work, local fisheries departments and personnel in Ethiopia for their assistance in field collections. I can t say enough to thank my friend, Brook Fluker, for the love, respect and support he showed me, taking time out of no time to share information, help in data analysis and reviewing some papers. I thank, my friend, Berhanu Tekle, who gave me constant support through this long, adventurous and sometimes arduous journey and helped me endure at times when the going was tough. I am grateful to Lindsay Clark, Yonathan Berhanu, and Yonas Goiton for their technical support. I also thank my friends Michael Sandel, Justin Bagley, Grey Hubbard, Jenjit x

12 Khudamrongsawat, Nathan Whelan, Alex Teoh, and John Pffefier for their helpful discussions and comments and the late Wally Holznagel for sharing his vast knowledge on Molecular techniques and his assistance in the lab. Finally, I thank my kids, Ruth, Candor, and Yanet, whose presence inspires me and gives me purpose to keep on going and my wife Tigist for assisting and supporting me through this process. Without them on my side nothing of this would have been possible. My parents deserve special thanks for their love and encouragement along with my brothers (Dagne, Shiferaw, Eyob, Getnet, and Yibeltal) who supported me all the way. xi

13 TABLE OF CONTENTS ABSTRACT....ii DEDICATION.... iv LIST OF ABREVIATIONS... v ACKNOWLEDGMENTS...x LIST OF TABLES..xiii LIST OF FIGURES......xiv CHAPTER 1: GENERAL INTRODUCTION CHAPTER 2: MOLECULAR PHYLOGENEY OF LARGE HEXAPLOID BARBINE MINNOWS (LABEOBARBUS: CYPRINIDAE)....7 CHAPTER 3: MITOCHONDRIAL DNA PHYLOGEOGRAPHY OF LABEOBARBUS INTERMEDIUS (CYPRINIDAE), EAST AFRICA..37 CHAPTER 4: ISOLATION AND CHARACTERIZATION OF SIX NOVEL MICROSATELLITE LOCI IN LABEOBARBUS INTERMEDIUS (CYPRINIDAE) AND THEIR CROSS-SPECIES UTILITY IN THE LAKE TANA LABEOBARBUS SPECIES FLOCK...60 CHAPTER 5: NUCLEAR MICROSATELLITE AND MITOCHONDRIAL DNA MARKERSREVEAL EXTREMELY LOW GENETIC DIFFERENTIATION IN LAKE TANA (ETHIOPIA) LABEOABARBUS SPECIES FLOCK (CYPRINIDAE..72 CHAPTER 6: OVERALL CONCLUSIONS REFERENCES xii

14 LIST OF TABLES 2.1 Species of large hexaploid barbs sampled, sampling localities and number of individuals used for each species in mtdna sequence analysis Date estimates for the divergence of major lineages of Labeobarbus List of haplotypes examined in this study with basin and water body sampled Microsatellite markers developed for L. intermedius Cross-species amplification results (size-range and number of alleles) of six microsatellites for 13 species of L. Tana Labeobarbus species, Varicorhinus beso, and Labeoarbus gananensis List of species and haplotypes and number of individuals of samples examined in the present study for mitochondrial CO1 and Cyt b and nuclear microsatellite analysis Microsatellite DNA diversity within the Labeobarbus of Lake Tana based on analysis of ten loci Distribution of samples of Lake Tana Labeobarbus in two Bayesian clusters (K=2) recovered based on Structure analysis of 10 microsatellite DNA loci.102 xiii

15 LIST OF FIGURES 2. 1 Map of Africa showing Major ichthyological provinces of Africa Phylogeny of Labeobarbus estimated by RAxML analysis of the complete cytochrome b gene Dated cyt b phylogeny of Labeobarbus based on BEAST analysis Map showing sampling localities of L. intermedius and the distribution of the northern and southern lineages Phylogram for RAxML analysis of cyt b gene Phylogeny of 43 haplotypes of Labeobarbus intermedius recovered from Maximum Likelihood analysis of mitochondrial cyt b sequence data Map of Lake Tana showing sampling area Phylogenetic relationships of Labeobarbus haplotypes based on Bayesian analysis of complete cyt b sequences of Lake Tana Labeobarbus and L. intermedius from adjacent water bodies Evolutionary relationships among Labeobarbus haplotypes based on mitochondrial COI data Results from Bayesian clustering analysis of microsatellite data of Labeobarbus populations from Lake Tana and adjacent water bodies using admixture model in STRUCTURE xiv

16 CHAPTER 1 GENERAL INTRODUCTION DRAINAGE BASIN HISTORY AND ICHTHYOFAUNA OF AFRICA Africa has a fairly well diversified ichthyofauna consisting of more than 3000 fish species (Lundberg et al., 2000). Although it shares affinities with other continents such as Asia and South America, the African ichthyofauna is peculiar in that it includes a number of primitive and phylogenetically isolated taxa (Lundberg et al., 2000; Snoeks et al., 2011). Bichirs (Polypteridae), lungfishes (Protopteridae), and weakly electric elephant fishes (Mormyridae), are among the many archaic fishes found only in African freshwaters (Lundberg et al., 2000). The African ichthyofauna is also unique in that it includes surprisingly diverse species flocks that resulted from adaptive radiations (Lundberg et al., 2000; Seehauson, 2005). These include the species flocks of cichlids in the Great lakes of East Africa (Lakes Malawi, Tanganyika, and Victoria) and Labeobarbus in Lake Tana (Ethiopia). The present day diversity and distribution of the ichthyofauna of Africa is the result of a long and complex geologic and hydrographic history and climatic fluctuations. In particular geodynamic processes and climatic changes that occurred during the second half of the Tertiary period are believed to have strongly influenced ichthyofaunal diversity and distribution in Africa by altering ecological barriers (Otero et al., 2009). Africa s river and lake basins are considered among the oldest in the world, having much longer geologic histories than those in the temperate zone or other tropical regions (Thieme et al., 2005). Pre-Miocene landscapes across the African continent experienced long periods of 1

17 tectonic stability, and the topographic relief of the continent is also thought to have been low (Beadle, 1981). As a result faunal barriers between water systems were easier to cross, and the fish fauna over the continent was therefore, rather widespread and uniform in composition (Beadle, 1981; Lévéque, 1997). Post-Miocene landscapes were altered by periods of volcanic and tectonic activities, however, that reconfigured drainage basins across the continent (Beadle, 1981). In particular, dramatic uplifting of extensive areas of central and eastern Africa accompanied by rifting, faulting and volcanism since the Miocene altered drainage patterns and modified distribution patterns of fishes and other aquatic taxa (Roberts, 1975, Beadle, 1981). The most prominent outcome of these geodynamic processes in eastern Africa was the formation of the Great Rift Valley and a great range of new lake habitats (Beadle, 1981), that provided conditions and opportunities for the evolution of a great variety of new species of fish and other animals. Africa s diverse lacustrine cichlid (Rift Valley lakes) and cyprinid (Lake Tana) species flocks, which are believed to have evolved from their respective riverine ancestral stocks, are the products of these changes. River basins in other parts of Africa have not been affected to the same extent as in Central and East Africa by the Post-Miocene geodynamic processes (Beadle, 1981). In addition to the aforementioned Pre-Quaternary geological processes, Quaternary climate change is believed to have strongly impacted the diversity and geographical distribution of extant species by altering the extent of water bodies and hydrologic connections between basins (Livingstone, 1975; Beadle, 1981; Lévéque, 1997). The long and recurrent periods of exondation (emergence of land) associated with retreating water levels due to climatic changes probably provided many opportunities for the isolation and divergence of fish populations and may explain why Africa has a diverse fish fauna (Lévéque, 1997). 2

18 Like other tropical regions Africa s freshwater fish communities are characterized by greater numbers of species for many taxonomic groups compared with those in the temperate zone (Thieme et al, 2005). Perhaps more familiar and certainly more numerous, are members of the two major freshwater fish radiations: the Otophysi (Cyprinidae, Characiformes, and Siluriformes) and Percomorpha (Cichlidae), that dominate, respectively, riverine and lacustrine habitats of Africa (Lundberg et al., 2000). Cyprinidae constitutes a major component of the total fish fauna of Africa and is the most widespread family in the continent (Skelton, et al., 1991). The overall diversity of African minnows is low, however, compared to that of the cyprinid faunas of Eurasia and North America (Briggs, 1979). There are about 477 described species in 24 genera in Africa (Skelton et al., 1991), a diversity exceeded only by the cichlids of the African Rift Lakes (Beadle, 1981; Lowe- Mcconnell, 1988). The diversity of evolutionary lineages within Labeobarbus (Cyprinidae) is the focus of this dissertation. THE GENUS LABEOBARBUS (CYPRINIDAE) Labeobarbus, a recently resurrected genus from synonymy with Barbus (Skelton, 2001), is widespread in Africa and contains fish commonly known as the large barbs. Members of Labeobarbus are characterized by hexaploidy (Golubstov and Krysanov, 1993; Guegan et al., 1995; Krysanov and Golubstov, 1996; Ollerman and Skelton, 1990; Naran et. al., 2007), large body size (>150 mm standard length as adults), and parallel striations on scales. The genus is known to constitute 39 valid species in Africa ( as of 25 April, 2012), that occur in major rivers such as the Nile, Niger, Congo and Zambezi as well as in the Great Rift and other lakes of East Africa. Recently, it has been shown that the species in Labeobarbus are of a 3

19 single, recent origin and constitute a monophyletic group (Machordom and Doadrio, 2001; Tsigenopoulos et al., 2002; Tsigenopoulos et al., 2010). The genus includes two hypothesized species groups among African large barbs, including the Labeobarbus bynni group and Labeobarbus intermedius group (Banister, 1973). Included within the L. intermedius species group are the Lake Tana Labeobarbus species flock (Nagelkerke et al., 1994; Nagelkerke and Sibbing, 2000) and L. intermedius, a polytypic species widely distributed in Ethiopia (including Lake Tana) and Northern Kenya (Banister, 1973). Thus far, no study has thoroughly assessed the phylogenetic status of these historic hypotheses of species groups and polytypic species. Although the scientific study of African freshwater fishes is more than a century old (Snoeks et al., 2011), our understanding of the phylogeny and taxonomy of Labeobarbus is incomplete with many important questions still remaining to be addressed, including the phylogenetic status of Banister s (1973) species groups, lack of a robust phylogeny for Labeobarbus, resolving the phylogeographic patterns of widely distributed species (e.g. L. intermedius), and inferring the taxonomic composition of, and limits to, evolutionary lineages of Labeobarbus in Lake Tana, Ethiopia. This dissertation has employed a variety of analytical methods (phylogenetic, population genetic and Bayesian clustering analyses) and molecular markers (mitochondrial CO1 and cyt b genes as well as nuclear microsatellite DNA markers) to address these questions. In Chapter 2, mitochondrial DNA cytochrome b (cyt b) gene sequence variation among constituent species was examined to reconstruct evolutionary histories of Labeobarbus. A previous study devoted to the phylogenetic treatment of Labeobarbus (Tsigenopoulos et al., 2010) had shortcomings in that it did not include all the currently known diversity and cover the full geographic range of Labeobarbus in its sampling. In addition, statistical support for major 4

20 clades was relatively low. A second objective of Chapter 2 was to test the monophyly of species groups proposed by Banister (1973). Based on morphological analysis Banister (1973) identified two species groups of large barbs, i.e., Labeobarbus intermedius group and Labeobarbus bynni group, but the monophyly of these proposed species groups has never been evaluated in a robust analysis. Chapter 3 examined the phylogeography of Labeobarbus intermedius over its broad geographic range in Ethiopia based on mtdna sequence variation of the cytochrome b gene to gain better understanding of evolutionary lineages within this species and their concomitant phylogeographic structure. Chapter 4 reports the isolation and characterization of six microsatellite DNA loci from L. intermedius and results from tests of their cross-species utility. The primary objective of this chapter was to develop genetic markers for use in Chapter 5. There have been conflicting taxonomic accounts on Lake Tana Labeobarbus with the number of constituent species varying from author to author (Ruppel, 1836; Boulengar, 1902, 1907, 1911; Bini, 1940; Banister, 1973; Nagelkerke, et al., 1994). In addition, several hypotheses have been proposed to explain their origin and morphological diversity (Berrebi, 1998). The lack of molecular markers suitable to assess genetic differentiation among populations has been an impediment to our understanding of the origin, phylogenetic relationships, taxonomic composition and adaptive radiation of Labeobarbus species in Lake Tana. Chapter 5 employed the microsatellite DNA loci developed in Chapter 4 plus four additional microsatellite markers previously developed by Chenuil et al. (1997) and variation in mitochondrial CO1 and cyt b gene sequences to investigate population structure and evolutionary relationships within the Lake Tana Labeobarbus. Chapter 6 provides a summary of the results obtained from the aforementioned chapters and directs attention to their limitations and significance in terms of guiding future studies. It 5

21 also presents implications of the results from Chapter 5 to the conservation of Lake Tana Labeobarbus species flock. 6

22 CHAPTER 2 MOLECULAR PHYLOGENEY OF LARGE BARBINE MINNOWS (LABEOBARBUS; CYPRINIDAE) ABSTRACT To examine phylogenetic relationships among large-bodied hexaploid minnows mitochondrial DNA cyt b gene sequence variation of a broadly based taxonomic and geographic sampling was analyzed. Phylogenetic analyses employing different reconstruction methods (Maximum Parsimony, Maximum likelihood, and Bayesian Methods) revealed that large barbine minnows from Saharan and Sub-Saharan Africa and the Middle East constitute a strongly supported clade (large African barbine minnows were non-monophyletic). Although phylogenetic results were broadly congruent with previously proposed lineages and hypotheses of species relationships, the present analysis recovered three lineages of hexaploid minnows: Clade E, specimens from the Congo and Zambezi River basins; Labeobarbus gananensis plus Varicorhinus jubae, and clade G, V. beso. Bayesian inference of timing of cladogenetic events suggested the Late Miocene as the primary period of Labeobarbus diversification. Vicariant processes associated with the isolation of Sub-Saharan African and Saharan African-Levant clades occurred ca 5 MYA with subsequent diversification events occurring in the Plio-Pleistocene. These vicariant events are concordant with timing of hydrographic and geologic events, such as desertification of Northern Africa and the Mio-Pleistocene volcanic-tectonic activities in Eastern and Central Africa. 7

23 INTRODUCTION Historically, African barbine minnows (Cyprinidae) were classified as either small or large Barbus (Agnese et al., 1990; Skelton et al., 1991). Small Barbus, that make up 75-80% of the species, are characterized by a relatively small adult size (smaller than 150 mm SL) and have radiating striae on their scales (Skelton et al., 1991). In contrast, large Barbus generally reach larger adult sizes (exceeding 150 mm SL) and have scales with longitudinal striations (Skelton et al., 1991). Small Barbus were hypothesized to be diploids whereas large Barbus were considered as tetraploids based on allozyme studies (Agnese et al., 1990; Berrebi et al. 1990). Subsequent studies using karyological data contradicted the suggested tetraploid status of large barbine minnows revealing that many large African minnow species, including the species assigned to the poorly defined genus, Varicorhinus, were hexaploids (Ollerman and Skelton, 1990; Golubstov and Krysanov, 1993; Krysanov and Golubstov, 1996; Guégan et al., 1995; Naran et al., 2007). Previous phylogenetic analyses based on cyt b gene sequences have shown that the large-sized hexaploid minnows constitute a separate evolutionary lineage distinct from Euro-Mediteranean tetraploid and African diploid and tetraploid lineages (Doadrio and Machordom, 2001; Tsigenopoulos et al., 2002; Tsigenopoulos et al., 2010). This lineage of large-sized hexaploid minnows was reclassified subsequently as Labeobarbus (Skelton, 2001; Skelton, 2002). The taxonomic limit of Labeobarbus has varied considerably since its description and according to the original concept Labeobarbus was hypothesized to constitute a purely African paleaohistorical lineage (Berrebi, 1995). The discovery of large hexaploid minnows outside of Africa (Krysanov, 1999; Gorshkova and Gorshkov, 2002) and close phylogenetic affinities of these species with large African hexaploid minnows contradicted the hypothesis of Labeobarbus 8

24 as an exclusively African lineage (Doadrio and Machordom, 2001; Tsigenopoulos et al, 2002). More recently, the concept of Labeobarbus was extended to some species originating from the Middle East as well as species in the closely related genus, Varicorhinus from Africa (Tsigenopoulos et al., 2010) based on their phylogenetic affinities. Banister (1973) erected two species groups of large-sized African hexaploid minnows, Labeobarbus intermedius and Labeobarbus bynni based on morphological characters. The Labeobarbus intermedius group included the species, Labeobarbus intermedius Ruppel 1836, L. altianalis Boulengar 1990, Barbus acuticeps Matthes 1959, and B rusae; the Labeobarbus bynni group was composed of L. bynni Forsskål, 1775, L. gananensis Vinciguerra 1895, L. oxyrhynchus Pfeffer 1889, and B longifilis Pellegrin The monophyly of these species groups has never been evaluated in a phylogenetic context. Tsigenopoulos et al. (2010) provided the first comprehensive phylogeny of large hexaploid barbine minnows based on Maximum likelihood and Bayesian analysis of mitochondrial DNA cyt b gene sequences of 34 taxa. Their analysis yielded a non-monophyletic Labeobarbus and Varicorhinus, defined major cyprinid lineages associated with karyotype, and provided a timeframe for the origin and diversification of large hexaploid minnows thereby advancing our understanding of the taxonomy and relationships of large barbine minnows. Caveats associated with this study, however, included limited taxon sampling of species diversity within Africa and limited sampling within Labeobarbus. In addition, bootsrap support for major clades was relatively low. In this Chapter, species relationships of large hexaploid minnows (i.e., Labeobarbus and Varicorhinus ) are examined based on analysis of complete mitochondrial DNA cyt b gene sequences to reconstruct phylogenies for large hexaploid minnows. An additional objective of 9

25 Chapter 2 is to test the monophyly of species groups proposed by Banister (1973) for large hexaploid minnows. MATERIALS AND METHODS SAMPLING A total of 153 cytochrome b sequences representing 49 large hexaploid minnow species and 65 African and Asian diploid as well as African and Euro-Mediteranean tetraploid minnow species were used as ingroup. Sequences of 30 species of large hexaploid minnows used in Tsigenopoulos et al. (2010) were retrieved from the GenBank. Some taxa examined by Tsigenopoulos et al. (2010) were excluded from the analyses due to either questionable identification (e.g., L. bynni occidentalis, AF180870) or taxon instability (e.g., Neolissochilus heterostomus, GenBank accession AY463516). Remaining sequences representing 19 species and 14 unidentified specimens of Labeobarbus were generated either from museum tissue collections (i.e. Kansas University Fish Collection and South African Institute of Aquatic Biodiversity) or fresh tissue samples collected for this study (Table 2. 1). Sampling for large hexaploid minnows covered 54 localities across Africa and the Middle East. Sampling covered 8 of the 10 ichthyological provinces (Fig. 2. 1) of Africa. Fifteen sequences from Labeo and Garra, were included as out group based on a preliminary analysis showing their phylogenetic proximity to the large barbine minnows. 10

26 POLYMERAS CHAIN REACTION (PCR), SEQUENCING AND SEQUENCE ALIGNMENT DNA was extracted from approximately 25 mg of tissue using Qiagen DNeasy Tissue Kits and Universal Tissue Extraction protocol (Teoh and Harris, unpublished) and the DNeasy tissue extraction kit (QIAGEN). The entire mtdna cytochrome b gene (1141 bp) was amplified via PCR whose reaction mix contained 2.0 µl of template DNA, 2.5 µl of dntps (2µM), 5 µl of 5x Promega green GoTaq Flexi buffer, 1.25 µl of each primer (10 µm), 1.5 µl of MgCl 2 (25 mm), µl of distilled water and 0.15 µl of promega GoTaq DNA polymerase (5 U/µ) from Promega Corp. The forward and reverse chains of the cytochrome b gene were amplified using the primer pairs L15267 (5 -AATGACTTGAAGAACCACCGT-3 ), H16461 (5 - CTTCGGATTACAAGACC-3 ) and H15891 (5 -GTTTGATCCCGTTTCGTGTA-3 ). PCR amplification protocol and sequencing primers were from Brioley et al. (1998). PCR products were purified using polyethylene glycol (PEG) precipitation. Cycle sequencing reactions were carried out using the primers H15891 and H16461 (Brioley et al., 1998). The reactions involved 40 cycles in 10 µl reaction mix, composed of 1-3 µl of PCR product, µl of H 2 O, 0.32 µl of primer (10 µm), 0.5 µl of florescent dye (ABI Big Dye Terminator V3.1) and 1.0 µl of 5x buffer. Cycle sequencing parameters for each cycle were 30 s of denaturation at 96 ºC, 10 s of annealing at 50ºC and 4 m of extension at 60 ºC. Cycle sequencing products were sequenced in 5 direction using PerkinElmer ABI PRISM 3100 sequencer (PE Applied Biosystems). The reverse complements of sequences obtained using the H15891 internal primer were used as forward sequences. DNA sequences were assembled, edited and manually aligned using BIOEDIT software package version (Hall, 1999). 11

27 PHYLOGENTIC ANALYSIS The present study examined two datasets. The first data set consisted of 33 taxa studied by Tsigenopoulos et al. (2010) and additional 19 taxa and 14 unidentified specimens of large hexaploid minnows. The second dataset included all taxa examined by Tsigenopoulos et al. (2011) except N. heterostomus, which was excluded from subsequent analysis because taxon instability analysis via Mesquite (Madison and Madisson, ) showed that it was the most unstable taxon in the resulting trees (data not shown). Maximum Likelihood (ML) phylogenetic trees were estimated employing RAxML (Stamatkias, 2010), available on the Cipres Web Portal ( RAxML rapid bootstrapping with 100 addition replicates was performed to assess support for branches (Stamatkias et al., 2008). Branches that received bootstrap support 50% were collapsed. ESTIMATION OF GENETIC DIVERGENCE AND TIME TO MOST RECENT COMMON ANCESTOR (TMRCA) Genetic divergences for clades were estimated using DNASP 4.5 (Rozas et al., 2003). Date estimates for the origin of major clades were obtained employing a Bayesian relaxed molecular clock model, which accounts for lineage-specific rate heterogeneity (Drummond et al., 2006). Time to Most Recent Common Ancestor estimates for clades were generated in BEAST v1.6.1 (Drummond and Rambaut, 2007) employing the general time reversible (GTR) substitution model and a birth-death speciation tree prior. Because there are no estimates of Labeobarbus-specific fossil dates, no calibration points were used to root the tree. A generalized teleost cyt b substitution rate of % per million years was used as a uniform prior (Berendzen et al., 2008). Three independent simulations each with 30,000,000 generations were 12

28 run sampling every 1,000 th generation and discarding the first 25% of the samples as burn-in. Results from the three runs were combined using LOGCOMBINER v1.6.1 (Drummond and Rambaut, 2007). To confirm stationarity and determine the mean and 95% highest posterior density (HPD) for divergence times, outputs of the runs were viewed using TRACER v1.5 (Drummond and Rambaut, 2004). RESULTS PHYLOGENTIC RELATIONSHIPS ML analysis recovered three main lineages corresponding to Euro-mediteranean tetraploids, African diploids and tetraploids, and large hexaploid minnows (Fig. 2. 2). This analysis provided strong support for the monophyly of hexaploid minnows (100% bootstrap support), which comprise taxa from Africa and the Middle East. Labeobarbus and Varicorhinus were recovered as non-monophyletic taxa. Two major clades were recovered within the hexaploid minnow lineage: (1) an entirely Sub-Saharan clade (Clade I, 92% bss) whose distribution spans all of Africa south of the Sahara; and (2) a clade containing Saharan-Levant taxa (i.e., taxa originating from Morocco and the Middle East, Clade II 79% bss). These two clades were resolved as part of a large polytomy of hexaploid taxa. Within Clade I seven clades were recovered: (1) clade A ( Varicorhinus from Lower Guinea, 97%) included V. axelrodi, V. marie, V. staindcheneri, and Labeobarbus sp. 13. (2) clade B- L. wurzi and L. gruveli (100%); (3) East-West African clade (clade C) roughly corresponding to the Nilo-Sudan + Upper Guinea Ichthyological provinces (bss 88%), which according to Roberts (1975) and Leveque (1997) includes the major drainage basins of the Nile, 13

29 Chad, Niger, Volta and Senegal; (4) clade D (100%), large-scale South African yellow fishes (i.e., L. marequensis plus L. johnstoni); (5) Congo-Zambezi clade (clade E, 51%) comprising samples originating from Mozambique, Democratic Republic of Congo (DRC) and Central African Republic (CAR); (6) clade F (61%) representing small-scaled South African yellow fishes (i.e. L. aeneus, L. capensis, and L.polylepis and V. nelspruitensis); (7) clade G corresponding to V. besso (100%); (7). Clade A was recovered basal to V. besso (92%) while V. besso was recovered as a sister group (57%) of the clade comprising all taxa from Sub-Saharan Africa except those in clade A. Relationships among the remaining five clades were unresolved. Within clade C singular branches corresponding to L. ethiopicus and L. oxyrhynchus were always recovered at basal positions with that corresponding to L. ethiopicus occupying the basalmost position. The placements of these branches were supported in 88% and 91% of the bootstrap replicates, respectively. The clade containing L. gananensis (Vinciguera, 1895) and V. jubae (Banister, 1984), sympatric species from Genale River in South Eastern Ethiopia, was sister to the clade containing L. sacratus, L. bynni (two subspecies), L. petitjeanii, and L. intermedius (two subspecies). L. intermedius was consistently recovered as a monophyletic group (98% bootstrap). L. intermedius consisted of all Ethiopian (including the Lake Tana Labeobarbus species) and two Kenyan (AF and AF112406) L. intermedius specimens. The L. bynni plus L. petitjeanii clade was sister to L. intermedius (99%). Clade II cotained all taxa originating from Morocco (except V. moroccanus and B. reinii) and some species from the Middle East (except B. grypus). Two geographically distinct groups were identified within this clade; one comprised northwestern African taxa ( B. fristchii plus B. harterti, and B. paytoni) and the other included taxa from the Levant ( B. canis, B. 14

30 luteus, K. kosswigi, C. chanteri). Monophyly of each of these groups was highly supported (100%). The present analyses recovered at least two additional lineages of large hexaploid minnows: clade E containing specimens collected from the Democratic Republic of Congo (DRC), Central African Republic (CAR), and Mozambique (51%); L. gananensis plus V. jubae clade was subsumed within clade C (Fig. 2. 2). Within clade E all Labeobarbus specimens from Mozambique were resolved monophyletic (88%). A clade consisting of Labeobarbus sp. 1 plus Labeobarbus sp. 2 (both from CAR) and Labeobarbus sp. 3 from the DCR were recovered basal to a clade of specimens from Mozambique (80%). TIME TO MOST RECENT COMMON ANCESTOR According to TMRCA estimates inferred in the present study based on mitochondrial cyt b data (Figure 2), the origin of the Sub-Saharan clade may be traced back to 12.9 MYA. Subsequent cladogenetic events responsible for generating the current diversity within Labebarbus seem to have occurred during the Plio-Pleistocene (Fig and Table 2. 2) with the earliest split resulting in Clades I (Sub-Sahran Africa) and II (Saharan Africa + Levant) around 4.8 MYA (95% HPD CI = ). Within Clade I a divergence event at around 3.5 MYA (CI: ) separated Clade C (Nilo-Sudan -upper Guinea) from clade E (Congo-Zambezi) plus clade F (Limpopo basin). A split within Clade C (i.e East-West African clade) probably started around 2.2 MYA (CI: MYA) completely separating the Eastern and Western parts of the Nilo-Sudanic province at around 0.9 MYA (CI: MYA). The latest events in the evolution of the large hexaploid minnow clade were the emergence and subsequent diversification of L. intermedius in East Africa during the Late Pleistocene. 15

31 DISCUSSION PHYLOGENETIC RELATIONSHIPS RAxML phylogenetic hypothesis was in general concordance with previous phylogenetic analysis of large barbine minnows (Tsigenopoulos et al., 2010) with some notable differences. This analysis recovered at least two novel clades and relationships within the hexaploid minnow lineage not revealed by Tsigenopoulos et al. (2010), suggesting that species diversity within this hexaploid minnow lineage is more complex than previously recognized. The two clades, Clades E and L. gananensis + V. jubae, were represented by specimens collected from geographic areas not covered in previous studies (i.e., Congo and Zambezi River systems; Genale River, southeastern Ethiopia). The recovery of clade E suggests a historic connection between Congo and Zambezi drainages (Stankiewicz and de Wit, 2006). Based on analysis of morphological characters Banister (1984) concluded that the two sympatric species, L. gananensis and V. jubae, resemble each other more closely than either does its respective congeners, a conclusion in agreement with findings of the present RAxML analysis. Detection of these novel evolutionary lineages may be attributed to increased taxon and geographic sampling of large barbine minnows. Additional work involving more through sampling is needed to delimit evolutionary lineages and further obtain better insight into the diversity and taxonomy of African hexaploid minnows. Although the overall tree topology was largely congruent with Tsigenopoulos et al. (2010) this analysis recovered a tree with much stronger bootstrap support for some major clades (i.e hexaploid clade 100%, clade I 92%) compared to <50%, 61%, respectively, obtained by Tsigenopoulos et al. (2010). RAxML analysis performed on Tsigenopoulos et al. s (2010) 33- taxon dataset also improved the nodal support for these clades (100% and 80%, respectively). 16

32 The 33-taxon dataset of large hexaploid barbs analyzed in the current study differed from the hypothesis of Tsigenopoulos et al. (2010) by excluding N. heterostomus because according to Robert and Shaffer (2010) the presence of phylogenetically unstable taxa in a dataset represents one of the major impediments to accurate phylogenetic inference. RAxML analysis recovered taxa originating from morocco and the Middle East as a monphyletic group (Saharan African-Levant 79%). This phylogenetic hypothesis is concordant with results from earlier studies on freshwater fishes (Roberts, 1975; Leveque, 1997), mussels (Graf and Cummings, 2007), and gastropods (Heller, 2007), which suggested that species inhabiting Northern Africa are more closely related to palearctic species than to those originating from the Sub-Saharan Africa. PHYLOGENETIC STATUS OF BANISTER S (1973) SPECIES GROUPS These results also advance our knowledge of Banister s (1973) species groups of largesized African barbine minnows. Banister (1973) recognized two species groups, Labeobarbus intermedius group (L. intermedius, L. altianalis, Barbus acuticeps, and B rusae) and Labeobarbus bynni groups (L. bynni, L. gananensis, L. oxyrhynchus, and B longifilis). To assess whether the present dataset supports the monophyly of Banister s (1973) species groups, the phylogenetic placements of proposed member species of each group were evaluated. Consistent with results from Chapter 3 all L. intermedius specimens collected from Ethiopia (including the Lake Tana Labeobarbus species), along with two Kenyan samples, formed strongly supported a monophyletic group (99%), which was further differentiated into two sub-clades. The clustering of L. intermedius from Lake Kamnarok (Kenya) with the Southern Ethiopian populations was consistent with hypothesis presented in Chapter 3 and suggests common phylogeographic history 17

33 between populations located in Southern Ethiopia and the Turkana basin in Northern Kenya. On the other hand L. intermedius australis (from Lake Baringo, Kenya) grouped with populations from the northwestern Highlands of Ethiopia probably due to recent (Pleistocene) connection between the Lake Baringo drainage and Nile system (Beadle, 1974). This hypothesis is in agreement with the placement of populations of African catfishes (Clarias gariepinus) from Lakes Victoria (part of the Nile system) and Baringo within the same clade (Giddelo et al., 2002). Taxa of the putative L. bynni species group were represented by three independent clades. One clade comprising L. bynni bynni, L.bynni occidentalis, and L. petijeani (not included in Banister s study) was consistently placed sister to L. intermedius. The remaining species, L. gananensis (allied to V. jubae ) and L. oxyrhinchus (represented by a singular branch), were recovered outside the L. bynni plus L. petijeani clade suggesting that the later two species are more distantly related to L. bynni than originally hypothesized by Banister (1973). Although results of the RAxML analysis support the monophyly of L. intermedius species group, it is difficult to test its monophyly because three other species, namely L. altianalis, B. acuticeps, and B. rusae, assigned by Banister (1973) to L. intermedius group were not included in the analysis. Obviously, studies incorporating the missing species would be required to further evaluate the phylogenetic status of the species group. In contrast, the L. bynni species group is recovered as a non-monophyletic group. Barbus longifilis, the only species of the L. bynni group missing from this study, is not likely to affect this conclusion given its restricted geographic distribution in the DRC ( as of December, 2011) and the large geographic gap of this species and other members of the species group. 18

34 STATUS OF VARICORHINUS Results of the present analysis shed doubt on the taxonomic status of Varicorhinus Ruppel 1836 (type species V. beso from Lake Tana) consistent with Tsigenopoulos et al. (2010). Because its species are scattered throughout the phylogeny (Fig 2. 2), the hexaploid genus Varicorhinus, as it is currently recognized throughout Africa is a polyphyletic taxon. Varicorhinus is delineated from Labeobarbus based on limited number of morphological characters (e.g., razer-lipped mouth). This genus has been synonimzed with either Barbus (Golubstov and Krysanov, 1993) or Labeobarbus (Tsigenopoulos et al., 2010). Other lines of evidence including karyological (Krysanov and Golubstov, 1996; Ollerman and Skelton, 1990; Golbstov and Krysanov, 1993; Guegan et al., 1995; Skelton et al., 2007) and genetic data (Berrebi, 1995; Durand et al., 2002) have failed to separate Labeobarbus and Varicorhinus. Consistent with these observations results from the present analysis were unable to delineate Varicorhinus from Labeobarbus suggesting that the taxonomic status of Varicorhinus requires further evaluation using additional data. In this paper the taxonomic recommendation of Skelton (2001; 2002) that placed all large African hexaploid Barbus in the genus Labeobarbus was employed. TEMPORAL PATERN OF LABEOBARBUS ORIGIN AND DIVERSIFICATION Bayesian inference phylogeny suggested that the main cladogenetic events that structured the diversity within the Labeobarbus hexaploid clade occurred during the late Miocene to Pleistocene, 13-0 MYA (Fig. 2. 3). This date is concordant with Tsigenopoulos et al. (2010), which suggested the invasion of Africa by hexaploids occurred in Mid Miocene (about 13 MYA) through a landbridge between Asia and Africa. The earliest radiation in this clade gave rise to 19

35 Clades I (Sub-Saharan Africa) and II (Saharan Africa + Levant) at 4.8 MYA (95% CI: ). The timing of this split corresponds to the onset of desert conditions in Saharan Africa during the Miocene-Pliocene (Schuster et al., 2002), suggesting the Sahara Desert as a potential geographic barrier to gene flow between members of the two clades. The earliest split in Clade II (4.1 MYA) probably took place at the same time as the isolation of North African and Euro-Mediteranean Luciobarbus (4.5 MYA; Machordom and Doadrio, 2001). Recovery of Clade D comprising species from the Ethiopian Highlands and Rift Valley, Nile and Niger River basins, Turkana basin and River basins in Guinea and Seirra Leone suggests a recent faunal connection across the Nilo-Sudan and Upper Guinea Ichthyological provinces. These findings are in agreement with earlier hypotheses that united haplotypes of tigerfish (Hydrocinus brevis) from the Gambia, Niger and Nile River systems (Goodier et al., 2011) and suggested the presence of a higher proportion of shared species between Eastern and Western African drainages (Roberts, 1975). According to the reconstruction of divergence times inferred in this study the earliest split within the Nilo-Sudan Ichthyological province occurred around 2.2 MYA (95% CI: MYA). At 0.9 MYA (95% CI: ) the eastern and western parts of the Nilo-Sudanic province were completely separated. However, both divergence date estimates are younger than hypothesis proposed by Otero et al. (2009), which suggested a split between the Chadian and Eastern areas of the Nilo-Sudanic province ca 7 MYA. More recent (Plio-Pleistocene) divergence events within Labeobarbus appear to be associated with drainage rearrangements in Central and East Africa. One of these events (2.2 MYA, CI: MYA) is represented by the divergence of Clade E (congo plus Zambezi Rivers) from Clade F (L. aeneus, L. capensis, L. polylepis, and V. nelspruitensis). A clade of 20

36 tigerfishes corresponding to Clade E was reported by Goodier et al. (2011) strongly suggesting evolutionary affinities linking the fish faunas of Congo and Zambezi River systems. A subsequent cladogenetic event at 1.3 MYA (CI: ) seems to have isolated the Congo River basin from the Mussapa Grande and Buzi Rivers (Zambezi River basin). Following these events the L. intermedius clade (98%) emerged around 0.9 MYA (95% CI: MYA) and subsequently diversified into northern and southern subclades at 0.6 MYA (CI: MYA). All these recent radiations within Labeobarbus seem to have been associated with the extensive Plio-Pleistocene tectonic activities of East and Central Africa, which are believed to have considerably modified the more or less uniform Miocene Paleo-hydrology and ichthyofauna of Africa (Cotteril and Wit, 2011; Mohr, 1966; Stewart, 2001). TAXONOMIC IMPLICATIONS The taxonomic limits of Labeobarbus have never been satiafactorily resolved since its description by Rupell (1836). Recovery of a monophyletic clade of hexaploid minnows as (100%) plus a non-monophyletic Varicorhinus plus Middle Eastern taxa ( B. canis, B. luteus, B. fristchi, B. harterti, B. paytoni, Carrassobarbus chanteri, and Kosswigobarbus kosswigi ) embedded within Labeobarbus have significant taxonomic implications for the classification of these taxa. Results herein suggest two different scenarios regarding the taxonomy of Labeobarbus: either recognize all taxa within the hexaploid minnow clade as Labeobarbus or refrain from making taxonomic recommendations until the status of Varicorhinus is resolved by a more robust phylogeny incorporating additional taxa of Varicorhinus and Labeobarbus and the hexaploid karyotype is confirmed in taxa currently unexamined. 21

37 Sampling in the present study included 14 Labeobarbus specimens from Central and Southern Africa, which were morphologically identified as Labeobarbus but for which species status is not known. This analysis clearly revealed a closer affinity between the Labeobarbus specimen originating from Gabon (Labeobarbus sp. 13) and Lower Guinea Varicorhinus species. A possible explanation for this observation would be that Labeobarbus sp. 13 probably belonged to Varicorhinus but may have been misidentified as Labeobarbus. Labeboarbus samples originating from the Congo (DRC and CAR) and Zambezi (Mozambique) River basins, areas not covered by previous phylogenetic studies, formed a distinct clade (Clade E) suggesting that taxa corresponding to these specimens are limited to these geographic regions making it unlikely that these specimens belong to any other Labeobarbus species examined herein. At least two evolutionary lineages were recovered within Clade E; a clade containing specimens originating from Mozambique and the Bora River (DRC); a second clade consisting of specimens from the Mbourou River (CAR). Divergence values within Clade E ( %), are comparable to those found between some currently valid Labeobarbus species pairs (L. aeneus and L. polylepis 2.5% ; L. aeneus and L. capensis 2.6%; L. capensis and L. polylepis 2.8%) suggesting that each lineage could constitute undescribed species. However, a more comprehensive analysis integrating morphological and molecular data will be required to further elucidate the composition of, and limits to, evolutionary lineages within Clade E to resolve their taxonomic status. 22

38 REFERENCES Agnese, J. F., Berrebi, P., Leveque O., Guegan, J. F. (1990). Two lineages, diploid and tetraploid, demonstrated in African species of Barbus (Osteichthyes, Cyprinidae). Aquatic Living Resources 3, Banister, K. E. (1973). A revision of the large Barbus (pisces: Cyprinidae) of East and Central Africa. Studies on Afrcan Cyprinidae Part II. Bulletin of the British Museum of NauralHistory (Zoology) 26, Banister, K. E. (1984). Three new species of Varicorhicus (Pisces, Cyprinidae) from Africa. Bulletin of the British Museum of Natural History (Zoology) 47(5), Beadle, L. C. (1974). The Inland Waters of Tropical Africa: an Introduction to Tropical Limnology. London: Longman. Beadle, L. C. (1981). The inland waters of tropical Africa; an introduction to tropical limnology. Second edition, pp London and New York: Longman. Berendzen, P. B., Gamble, T., and Simons, A. M. (2008) Phylogeography of the bigeye chub Hybopsis amblops (Teleostei: Cypriniformis): Early Pleistocene diversification and postglacial range expansion. Journal of Fish Biology 73, Berrebi, P., Lévêque, C., Cattaneo-Berrebi, G., Agnèse, J. F., Guégan, J. F., and Machordom, A. (1990). Diploid and tetraploid African Barbus (Osteichthyes, Cyprinidae): on the coding of differential gene expression. Aquatic Living Resources 3, Berrebi, P. (1995). Speciation of the genus Barbus in the North Mediterranean basin: recent advances from biochemical genetics. Biological Conservation 72, Berrebi, P. Kottelat, M., Skelton, P., and Rab, P. (1996). Systematics of Barbus: State of the art and heuristic comments. Folia Zoologica 45 (supplement 1), Briolay, J., Galtier, N., Britto, R. M., and Bouvet, Y., (1998). Molecular phylogeny of cyprinidae. Inferred from cytochrome b DNA sequences. Molecular phylogenetics and Evolution 9, Cotterril, E. P. D. and De Wit, M. J. (2011) Geodynamics and the Kalahari Epeirogeny linking its genomic record, Tree of Life and Palimpsest into a unified narrative of landscape evolution. South African Journal of Science 114(3-4),

39 Doadrio I. and Machordom, A. (2001). Evolutionary history and speciation modes in the Cyprinid genus Barbus. Proceedinghs of the Royal Society of London (Biology) Drummond, A. J. and Rambaut, A. (2007). BEAST: Bayesian evolutionary analysis sampling trees. BMC Evolutionary Biology 7, 214. Drummond, A. J., Ho S. Y. W., Phillips, M. J., and Rambaut, A. (2006). Relaxed phylogenetics and dating with confidence. PLoS Biology 4 (5), Durand, J. D., Tsigenopoulos, C. S., Ünlü, E., and Berrebi, P. (2002). Phylogeny and biogeography of the family Cyprinidae in the Middle East inferred from cytochrome b DNA evolutionary significance of this region. Molecular Phylogenetics and Evolution 22, Gidello, C. S., Arndt, A. D. and Volckaert, F. A. M. (2002). Impact of rifting and hydrography on the genetic structure of Clarias gariepinus in eastern Africa. Journal of Fish Biology 60, , doi: /jfbi Golubstov, A. S. and Krysanov, E.Yu. (1993). Karyological study of some cyprinid species from Ethiopia, The ploidy differences between large and small Barbus of Africa. Journal of Fish Biology 42, Goodier, S. A. M., Cotterill, F. P. D., O'Ryan, C., Skelton, P. H. and De Wit, M. J. (2011). Phylogeny of African tigerfish (Genus Hydrocynus) reveals palaeogeographic signatures of linked Neogene geotectonic events. Plos One, in review. 6(12):1-15. Gorshkova, G. and Gorshkov. S. (2002). Karyotypes of Barbus canis and Capoeta damascina (Pisces: Cyprinidae) from the Middle East. Italian Journal of Zoology 69, Graf, D. L. & K. S. Cummings Preliminary review of the freshwater mussels (Mollusca: Bivalvia: Unionoida) of northern Africa, with an emphasis on the Nile. Journal of the Egyptian German Society of Zoology 53D, Güegan, J. F., Rab, P., Machordom, A. and Doadrio, I. (1995). New evidence of hexaploidy in large African Barbus with some considerations on origin of hexaploidy. Journal of Fish Biology 47,

40 Hall, T. A. (1999). BioEdit; A user friendly biological sequence alignment editor and analysis program for Wndows 95/98/NT Nucleic Acids Symposium Series, 41, Howes, G. J. (1987). The phylogenetic position of the Yugoslavian cyprinid fish genus Aulopyge Heckel,1841, with an appraisal of the genus Barbus Cuvier & Cloquet,1816 and the subfamily Cyprininae. Bulletin of the British Museum (Natural History) 52 (5), Huelsenbeck, J. P., Crandall, K. A., (1997). Phylogeny estimation and hypothesis testing using maximum likelihood. Annual Review of Ecology and Systematics 28, Josef H. (2007). A historic biogeography of the aquatic fauna of the Levant. Biological Journal of the Linnean Society, 92, Krysanov, E.Y. (1999). Karyotypes of Varicorhinus, Capoeta and Barbus goktschaicus (Cypriniformis) in Lake Sevan, Armenia. Journal of Ichthyology 39(2), Krysanov, E.Y. and Golubtsov, A. S. (1996). Karyotypes of some ethiopian Barbus and Varicorhinus from the Nile basin including Lake Tana morphotypes. Folia Zoologica 45, Lévêque, C. (1997). Biodiversity Dynamics and Conservation: The Freshwater Fish of Tropical Africa. Cambridge University Press, Cambridge, United Kingdom. Lévêque C. and Daget, G. (1984). Cyprinidae, pp In: Check list of the freshwater fishes of Africa. Daget J., Gosse J. P., Thys van den Audenaerde eds., Mracorstom, 410p. Naran, D., Skelton, P. H., and Villet, M. H. (2007). Karyology of three evolutionarily hexaploid southern African species of yellowfish, Labeobarbus Rüppel, 1836 (Cyprinidae). African Zoology 42, (2), doi: / Ollerman, L. K. and Skelton, P. H. (1990). Hexaploidy in yellowfish species (Barbus, Pisces, Cyprinidae) from southern Africa. Journal of Fish Biology 37, Otero, O., Pinton, A., Mackaye, H. T., Likius, A., Vignaud. P., and Brunet, M. (2009) Fishes and palaeogeography of the African drainage basins: Relationships between Chad and neighbouring basins throughout the Mio-Pliocene. Palaeogeography, Palaeoclimatology, Palaeoecology 274, Robert, C. T. and Shaeffer, H. B. (2010). Sparse Supermatrices for Phylogenetic Inference: Taxonomy, Alignment, Rogue Taxa, andthe Phylogeny of Living Turtles. Systematic Biology 59(1),

41 Roberts, T. R. (1975). Geographical distribution of African freshwater fishes. Zoological Journal of the Linnean Society 57, Rozas, J., Sánchez-DelBarrio, J. C., Messeguer, X. and Rozas, R. (2003). DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19, Schuster, M., Duringer, P., Ghienne, J.F., and Vignaud, P., Mackaye, T. H., Likius, A., and Brunet, M. (2006). The Age of the Sahara Desert. Science, 311, 821. Skelton, P. H. (2001). A complete Guide to the Freshwater Fishes of Southern Africa. Struic Publishers, Capetown, South Africa.pp395. Skelton, P. H. (2002). Changes to the scientific and common names of southern African freshwater fishes. African Journal of Aquatic Science 27, Skelton, P. H., Tweddle, P., and Jackson, P. B. N. (1991). Cyprinds in Africa. In Cyprinid fishes. Systematics, Biology and Exploration. Winfield, I. and Nelson, J., eds, pp London: Chapman and Hall. Snoeks, J., Harrison, I. J. and Stiassny, M. L. J. (2011). The status and distribution of freshwater fishes. In: The Diversity of Life in African Freshwaters: Underwater, Under Threat. Edited by Willam Darwall, Kevin Smith, David Allen, Robert Holland, Ian Harrison, and Emma Brooks). Published by IUCN, Gland,. Switzerland and Cambridge, UK. Stamatakis, A., (2010). RAxML v Stamatakis, A., Hoover, P. and Rougemont, J. (2008). A Rapid Bootstrap Algorithm for the RAxML Web Servers. Systematic Biology 57 (5), Stankiewicz, J. and Wit, M.J.D. (2006). A proposed drainage evolution model for Central Africa Did the Congo flow east? Journal of African Earth Sciences, 44: Stewart, K. M. (2001). The freshwater fish of Neogene Africa (Miocene Pleistocene): systematics and biogeography. Fish and Fisheries 2, Tsigenopoulos C. S., Rab, P., Naran, D. and Berrebi, P. (2002). Multiple origins of polyploidy in the phylogeny of Southern African barbs (Cyprinidae) as inferred from mtdna markers. Heredity 88,

42 Tsigenopoulos C. S., Kasapidis, B., and Berrebi, P. (2010). Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus; Cyprinidae) based on mtdna data. Molecular Phylogenetics and Evolution 56(2), Vinciguerra, D. (1895). Esplorazione del Giuba e dei suoi affluenti compiuta dal Cap. V. Bottego durante gli anni sotto gli auspicii della Societa geo-graphica Italiana. III. Pesci. Annali del Museo Civico di Storia Naturale di Genova 15,

43 Table 2. 1 Species of large barbine minnows sampled, sampling localities and number of individuals used for each species in mtdna sequence analysis. Numbers in the last column correspond to GenBank accession numbers or collection catalogue numbers of voucher specimens. Sample Specimen Ichthyological Taxa Sampling locality and Country Accession/catalogue number size number Province Labeobarbus intermedius intermedius 15 Gojeb River, Ethiopia 1 3 JN Gilgel Bibe River, Ethiopia 2 3 JN Lake Awassa, Ethiopia 3 3 JN Sagoe River, Ethiopis 4 3 JN Kulfo River, Ethiopia 5 3 JN Arba Minch Spring, Ethiopia 6 3 JN Lake Chamo, Ethiopia 7 3 JN Lake Abaya, Ethiopia 8 3 JN Lake Langano, Ethiopia 9 3 JN Awash River, Ethiopia 10 3 JN Lake Tana, Ethiopia 11 3 JN Gumara River, Ethiopia 12 3 JN Lake Tana, Ethiopia 13 3 JN Darse River, Ethiopia 14 3 JN Gibe River, Ethiopia 15 3 JN887016

44 Table 2. 1 Continued. Sample Sampling locality and Specimen Ichthyological Accession/catalogue Taxa size Country number Province number Labeobarbus intermedius zaphiri 1 Dedessa R., Ethiopia 16 3 AF Labeobarbus intermedius intermedius 1 Lake Kamnarok, Kenya 17 2 AF L. intermedius australis 1 Lake Baringo, Kenya 18 2 AF Labeobarbus bynni occidentalis 2 Bafing R., Guinea 1 2 AF Niger R., Mali 2 2 AF Labeobarbus bynni bynni 1 Nile, Egypt 2 AF Labeobarbus ethiopicus 1 Meki R., Ethiopia 3 AF Labeobarbus aeneus 1 Great Fish R., South Africa 10 AF Labeobarbus capensis 1 Olifants R., South Africa 8 AF Labeobarbus polylepis 1 Incomati R., South Africa 8 AF Labeobarbus marequensis 2 Marico R., South Africa 1 8 AF L. Tzaneen, South Africa 2 Labeobarbus wurtzi 2 Kaba R., Guinea AF AF Morgo R., Seiraleone 2 4 AF Labeobarbus petitjeani 2 Bafing R., Guinea 1 2 AF Senegal 2 Labeobarbus johnstonii 2 Lake Malawi, Malawi AF AF Rukuru River, Malawi 2 8 SAIAB

45 Table 2. 1 Continued. Taxa Sample size Sampling locality and Country Specimen number Labeobarbus sacratus 2 Tangala R., Guinea 1 Rokel R., Seiraleone 2 Labeobarbus acutirostris 1 Lake Tana, Ethiopia Labeobarbus brevicephalus 1 Lake Tana, Ethiopia Labeobarbus crassibarbis 1 Lake Tana, Ethiopia Labeobarbus gorgorensis 1 Lake Tana, Ethiopia Labeobarbus gorguari 1 Lake Tana, Ethiopia Labeobarbus longissimus 1 Lake Tana, Ethiopia Labeobarbus macrophtalmus 1 Lake Tana, Ethiopia Labeobarbus megastoma 1 Lake Tana, Ethiopia Labeobarbus tsanensis 1 Lake Tana, Ethiopia Labeobarbus oxyrhynchus 1 Sagana R., Kenya Labeobarbus gananensis 2 Genale R., Ethiopia 1 Labeobarbus canis 2 Bet Shean, Israel 1 Labeobarbus sp. (unidentified) 2 Mbourou R., Central African Republic Ichthyological Province Accession/catalogue number AF AF JN JN UAIC JN JN JN JN JN JN AF JN JN AF AF SAIAB SAIAB Labeobarbus sp. (unidentified) 1 Bora R. (Luapula), DRC 3 6 SAIAB

46 Table 2. 1 Continued. Taxa Sample size Sampling locality and Country Specimen number Labeobarbus sp. (unidentified) 6 Mudzira R., Mozambique 4 Labeobarbus sp. (unidentified) 2 Nyamrhrre Stream, Mozambique Mussapa Grande R., Mozambique Mussapa Pequena R., Mozambique Labeobarbus sp. (unidentified) 1 Revue R., Mozambique 12 Labeobarbus sp. (Lucien) 1 Ivindo R., Gabon 13 Labeobarbus sp. (kongou) 1 Ivindo R., Gabon 14 Barbus reinii 2 Tensift, Morocco 1 Barbus grypus 1 Euphrates, Turkey Kosswigobarbus kosswigi 1 Tigris R., Turkey Carasobarbus chanteri 1 Orontes R., Turkey Barbus paytoni 1 Oum Erbia R., Morocco Barbus habereri 1 Mvi R., Cameroon 5 6 Ichthyological Province Accession/catalogue number SAIAB SIAIB SIAIB SIAIB SAIAB SAIAB SIAIB SAIAB SAIAB AF AF AF AF AF AF AF

47 Table 2. 1 Continued. Taxa Sample size Sampling locality and Country Specimen number Barbus fristchii 3 Zamarine R., Morocco 1 Kasab R., Morocco 2 Kasab R., Morocco 3 Barbus harterti 1 Sebou R., Morocco Barbus luteus 1 Tigris R., Turkey Barbus gruveli 1 Samou R. (Debele), Guinea Barbus caudovitatus 1 - Varicorhinus beso 4 L. Tana, Ethiopia Dedessa R., Ethiopia Varicorhinus steindachneri 1 Mvi R., Cameroon Varicorhinus maroccanus 1 Oum Er Rbia R., Morocco Varicorhinus mariae 1 Mvi R. Cameroon Varicorhinus nelspruitensis 1 Sabie R., S. Africa Varicorhinus axelrodi 1 - Varicorhinus jubae 1 Genale R., Ethiopia Ichthyological Province Accession/catalogue number AF AF AF AF AF AF CTOL 406 JQ JQ UAIC JQ AF AF AF AF CTOL 597 JN

48 TABLE 2. 2 Date estimates for the divergence of major lineages of Labeobarbus. Divergence between Lower 95% CI Estimate (in MY) Upper 95% CI Clade I Clade II Clade C Clade E + Clade F Clade E Clade F Labeobarbus sp Labeobarbus sp. 1-3 (Congo) (Zambezi) L. gananensis + V. jubae L. intermedius + L. bynni + L. petitjeani L. sacratus L. bynni + L. petitjeanii L. intermedius Northern L. intermedius Southern L. intermedius

49 Sub-Saharan Africa Saharan Africa Fig. 2.1 Map of Africa showing Ichthyological provinces and major River basins. Numbers represent Ichthyological provinces; 1 = Mahgreb, 2 = Nilo-Sudan, 3 = Abyssinian Highlands, Upper Guinea, 5 = Lower Guinea, 6 = Congo, 7 = Cunene, 8 = Zambezi, 9 = East coast, 10 = Cape. Base map was obtained from Snoeks et al. (2011). Nile R. Lake Turkana Senegal R. Niger R. Lake Victoria Lake Malawi Congo R. Lake Tanganyka Zambezi R. 34

50 Fig Phylogenetic relationships of Labeobarbus estimated by RAxML analysis of the complete cyt b gene. Topology depicted is the bootstrap tree. Values at branch nodes indicate RAxML bootstrap values. Numbers at tip labels represent number of samples per species (if in parenthesis) or correspond to sample codes in Table 2.1 (if not in parenthesis). Outgroup taxa are not included in the tree for clarity. %:: 7& 7- %:: 9) 9% 99 ;% 7% %:: -& -; %:: 9& ;- ;9 9: %:: 6% ;7 %:: ;9 -; %:: ;7 %::!"#$%#"&#'(!"#$!%& ')$((*$+,-./,$&+ ')$("0$1&%-+ ')2(3"&+"$!245'&*6+!)*!247&'8$1++!25'&*6+!)*!249$*+*:$",++!+),*!24%..+-$,*"1+(!%*!24#24#;,,+<!24%..+-$,*"1+(!)*!24+,*$&3$-+'(!+&-,*!24(".&"*'(!+),* ')$(!:'#"$!247",",$,(+(!+),!24%0;&/+,./'(.$/0123#245"*!243"&$='$,(+(4+),*!24:%/,(*%,++!+),!"#$%#"&#'(!"#$!%? < B G!"#$%#"&#'(!"#$!)!"#$%#"&#'(!"#$!&!"#$%#"&#'(!"#$!6!"#$%#"&#'(!"#$!7!"#$%#"&#'(!"#$!-!"#$%#"&#'(!"#$!8!"#$%#"&#'(!"#$!9!"#$%#"&#'(!"#$!%%!"#$%#"&#'(!"#$!%:!"#$%#"&#'(!"#$!;!"#$%#"&#'(!"#$!%) ')$(!,$1(9&'+*$,(+(<!4"$,$'(<!24."9$,(+(<!249%1;1$9+(<!"#$%#"&#'(!"#$!%8!24."'-%8+**"*'( ')$(!#$(%!+8,* '>$(!&+$,++!+), '<$(!1=>0/>02 '>$(!?&+*(./++!+&, '>$(!?&+*(./++!+%, '>$(!9";*%,++ '>$(!?&+*(./++!+), '@%((5+7%#"&#'(($!A%((5+7+ 'B"&&"(%#"&#'((!./",*$&+ '>$(!1'*$'( '>$(!.",+(!+), '>$(!7&;9'( '>$(!/"#$&$&+ ')$(!3"&%..",'( >241".$&*"!?@%87;&7 >243".$-%,+.'(!?A::8-78 B"9%$*"4-"3".+,"!?@%87;7%& >24($*+8+3$,(+(!?A:%7;;)!'.24#%."7+!?A::8-)-!! >24,"('(!?A::8-88 >243"(("$,(+(!?A::8-8: >243"7,+"*1",*+(!?A::8-8- >24A(+#+!?A::8-&9 >241"#+%("!?A::8-&&!'.24#&"./+.$9(!?A::8-); C'1%9;7$4/'$7$1++!?@)9-8%7 D',*+'(4.%,./%,+%,'(!?A::8-7% D',*+'(4*+.*%!?<)&9;6; >24*&+3".'1"*'(!?<)&;6:: >24*","9$1"7+'(!?A-8:-)- >24/'3'1+(!BCD.&-8; >"&#'(!"#$!?@%9:98) >4,;",6"$!?@%9:98% >24('#1+,$"*'(!?@%9:9&- >249"1'-+,%('(!BCD.&6)64 >2491$'&%7&"33"!?A-8:-%; >249"1'-+,%('(!?@)9-8&6 >243%*$#$,(+(!?@)9-8&7 >24",%91'(!?@)9-8%- >247'&,$;+!?@)9-8&) >24A$&(*$,++!?@%9:98: >243"**%6+!?@%9:9&9 >24."-$,"*+!?@%9:9&8 >24#%7&,$+!?A::8-7) >243".&%9(!?@%9:9&) <$!=EF=E/"!?@%9:9&7 >247'+,+$,(+(!?@%9:9&& D#24#'&7+!?@%9:98; D#24#'&./$1+!?@%9:989 D#24"?$&!?@%9:97% D#249/1$7$*/%,!?@)9-87) D#24*$,'+(!?@)9-87& D#24"(9$&!?@%9:97: >24*&$8$1;",+!?@%9:98- >24",-&$5+!?@%9:98& >24($&&"!?@)9-886 >24$&'#$(.$,(!?@%9:987 >24."1+-'(!?@)9-8)) >"&#%+-$(47%,+%,%*'(!?<)&9;66 >"&#%+-$(4(./5",$?$1-+!?@%9:9)& I J JJ H5>3#/=N 0/0>=#F32M"?Q>24=N!M2#F32M"!=NM!0/0>=#F32M".=>K/!1/L=#F32M!E=>E2N/!O2NN3P" 35

51 Fig Dated cyt b phylogeny of Labeobarbus reconstructed in Beast employing the GTR model. Numbers at nodes correspond to divergence date estimates (MYA). Error bars indicate 95% highest posterior density intervals (HPD) associated with node dates. Numbers at tip labels correspond to sample codes in Table

52 CHAPTER 3 MITOCHONDRIAL DNA PHYLOGEOGRAPHY OF LABEOBARBUS INTERMEDIUS IN ETHIOPIA, EAST AFRICA ABSTRACT MtDNA phylogeography of the hexaploid minnow, Labeobarbus intermedius, was investigated using the complete cytochrome b (cyt b) sequences of 43 haplotypes originating from 16 populations in four major drainages in Ethiopia, plus an additional 10 outgroup haplotype sequences. Samples included 14 of 15 species of Labeobarbus described from Lake Tana. Phylogenetic analyses based on Maximum Likelihood and Parsimony methods recovered two mitochondrial lineages, corresponding to a north-south geographic split among drainages. Results from Analysis of Molecular Variance (AMOVA) indicate the largest proportion (70.4%) of overall genetic variance observed was attributed to differences among lineages. Significant genetic differentiation was observed between northern and southern lineages (Ф ST = 0.70, p<0.01). Divergence dating employing coalescent simulations suggested that the north-south geographic split in L. intermedius occurred around 970,000 years ago consistent with the timing of geologic events postulated to have shaped the current landscape of East Africa. 37

53 INTRODUCTION Labeobarbus intermedius Rüppell 1836 is a large hexaploid minnow from East Africa well known for its extensive morphological diversity (Banister, 1973) best illustrated by the extensive phenotypic radiations found within the Labeobarbus species flock of Lake Tana, Ethiopia. Since its description in 1836, the taxonomy of L. intermedius has not been well established and there have been few attempts to examine geographic variation within this species. For most of its taxonomic history this species was assigned to the genus Barbus. Recently, Skelton (2001, 2002) reclassified the large hexaploid minnows of Africa (including L. intermedius) into Labeobarbus based on karyological (Golubstov and Krysanov, 1993) and phylogenetic (Machordom and Doadrio, 2001) evidence. Throughout this paper the taxonomic recommendation of Skelton (2001, 2002) is followed. The taxonomy of L. intermedius remains in flux because of a combination of extensive intraspecific variation and poor geographic sampling by earlier studies. The species was described by Rüppell (1836) from Lake Tana in the Northwestern Highlands of Ethiopia. The existence of several morphologically distinct forms of L. intermedius in Lake Tana led to the description of six species by Rüppell (1836), ten species by Boulengar (1902, 1907, 1911) and ten species and 23 subspecies by Bini (1940). Until the early 1970 s, L. intermedius received little taxonomic attention and no studies have been conducted to address its taxonomy and biogeography. The earliest comprehensive taxonomic account of the species was Banister s (1973) revision of the large barbs of East and Central Africa. In his revision, Banister (1973) synonymyzed more than fifty nominal species and subspecies of East Africa, including those from Lake Tana into L. intermedius (Golubstov et al., 2002). Banister (1973) also identified two subspecies of L. intermedius; L. intermedius intermedius (Rüppell, 1836) and L. intermedius 38

54 australis (Banister, 1973). L. i. intermedius is widely distributed throughout Ethiopia being found in all the major basins including the Rift Valley lakes, the Omo, Genale, Wabishebelle, Awash, and Abay (including Lake Tana) River basins (Banister, 1973; Roberts, 1975). This subspecies was also reported from the Baro River, a tributary of the White Nile River, within the boundaries of Ethiopia (Krysanov and Golubstov, 1996). In Northern Kenya L.i intermedius was reported from the Uasso Nyiro River and Lake Turkana basins (Skorepa, 1992). In contrast, L. i. australis subspecies was limited to Lake Baringo, Kenya (Baniaster, 1973). Later several authors regarded Banister s taxonomic conclusions as putative, at best, based on analysis of morphological characters. Skorepa (1992) described Banister s (1973) sub-specific separation of L. intermedius australis as unreal although he maintained Banister s (1973) synonomy of several large barb species and subspecies with L. intermedius. Nagelkerke et al. (1997) and Nagelkerke and Sibbing (2000) recently questioned Banister s (1973) hypothesis of a single species of large barbs in Lake Tana and introduced new names for 14 separate species distinct from L. intermedius. In addition, Golubstov et al. (2002) argued that the diversity of large barbs occurring in the Ethiopian Rift Valley could not be represented by a single species. Although L. intermedius represents a significant component of Ethiopia s freshwater fauna (Abebe and Stiassney, 1998), there is a paucity of information on the phylogenetic relationships and distribution of haplotypes within the species. Banister s (1973) taxonomic revision of East African large barbs provides the only detailed geographically encompassing taxonomic account of the species. A phylogeny documenting evolutionary relationships among haplotypes of L. intermedius is required to gain better understanding of evolutionary lineages within this species and their concomitant phylogeographic structure. Herein, the phylogeography 39

55 of L. intermedius from 16 populations covering four major drainages within Ethiopia is examined based on mtdna cyt b gene sequences. HYDROGRAPHIC FEATURES OF ETHIOPIA The combined effects of faulting, uplifting and volcanism during the Tertiary period were the primary geologic forces shaping the current hydrographic features within Ethiopia (Mohr, 1966). These tectonic processes formed the Ethiopian Rift Valley, the northernmost branch of the East African Rift System, creating a division between the highlands of the northwest and southeast (Fig. 1). Three distinct drainage patterns occur in the river basins of the Northwestern Highlands. Most rivers lying on the northern and western escarpment of these highlands (Abay, Barbo, and Tekeze River basins) flow to the west and form part of the Blue Nile River drainage. Rivers originating on the eastern or northeastern escarpment of the highlands flow east into either the endoreic basins of the Rift Valley or Awash River. The headwaters of the Awash River are on the southeastern side of the escarpment; this river flows northeast through the Danakil Depression into Lake Abe. Rivers on the southern side of the escarpment flow south into Lake Turkana via the Omo River system. Rivers originating in the Southeastern Highlands flow southeast (Genale, Dawa, Shebelle, and Fafan Rivers) into Somalia. The major hydrographic features of the Rift Valley are a chain of endoreic lakes. It has been hypothesized that in the late Tertiary these endoreic lakes formed a continuous system (Mohr, 1966) but during the pluvial period, which lasted from Late Glacial into early Holocene, only the four northern Rift lakes (Lakes Abiyata, Langano, Shala and Zeway) were unified into a larger lake, which drained to the north into the Awash River (Grove et al., 1975). 40

56 MATERIALS AND METHODS SAMPLING Tissue samples of L. intermedius including the species flock of Labeobarbus from Lake Tana were collected from 13 water bodies in four major drainages in Ethiopia between January and May 2006 (Fig. 3. 1). Additional L. intermedius tissue samples representing four water bodies were obtained from museum collections. All tissues were preserved in 95% EtOH. Specimens examined in this study, their sampling localities and GenBank accession numbers and number of samples examined per locality are summarized in Table 1. Seven taxa, L. bynni bynni Forskål 1775, L. bynni occidentalis Boulengar 1911, L. ethiopicus Zolezzi 1939, L. gananensis Vinciguerra 1895, L. oxyrhynchus Pfeffer 1889, L. petitjeani Daget 1962, L. sacratus Daget 1963 were chosen as outgroups on the basis of relationships generated by a preliminary phylogenetic analysis of a larger sample of Labeobarbus. DNA EXTRACTION AND SEQUENCING Total genomic DNA was extracted using the DNeasy tissue extraction kit (QIAGEN). The mitochondrial cyt b gene (1141 base pairs) was amplified using primers and PCR protocols developed by Briolay et al. (1998). Sequences were generated via dye terminator reactions and read on an ABI 3100 prism sequencer. Sequences were aligned independently by eye using BIOEDIT (Hall, 1999). Complete sequences (1141 bp) of 47 unique mtdna haplotypes were deposited in GenBank and assigned accession numbers JN JN (Table 3. 1). 41

57 PHYLOGENETIC ANALYSIS To estimate phylogenies the cyt b dataset comprising 43 unique haplotypes of L. intermedius and 10 outgroup haplotypes was used. Maximum likelihood (ML) analyses were performed using RAxML (Stamatakis, 2010) via The Cipress Science Gateway ( with a GTR + Γ model. RAxML rapid bootstrapping (Stamatkias et al., 2008) with 100 addition replicates was performed to assess support for branches. Branches with less than 50% bootstrap values were collapsed into a polytomy. Parsimony analyses were also performed in PAUP* (Swofford, 2002) on the same data matrix. Analyses were run implementing one hundred replicates of random addition sequences and TBR branch swapping. Bootstrap support was calculated from 100 replicates using the normal bootstrapping option. POPULATION GENETIC ANALYSIS AND GENETIC DIVERGENCES The number of unique haplotypes and haplotype diversity (h ± standard deviation) were calculated in DNASP version 4.5 (Rozas et al., 2003). Distribution of genetic variance among and within lineages was assessed with Analysis of Molecular Variance (AMOVA) implemented in ARLEQUIN (Excoffier et al., 1992). Genetic differentiation between lineages was evaluated with the Ф ST statistic. Significance of variance components among and within lineages was examined with permutations. Haplotypes were assigned to northern and southern lineages based on the maximum likelihood phylogeney. A matrix of pair-wise sequence differences between haplotypes was generated using PAUP* based on maximum likelihood settings generated in Model test (Posada 42

58 and Crandall, 1998). Between and within lineage genetic distances were calculated based on this matrix. ESTIMATING TIME TO MOST RECENT COMMON ANCESTOR (tmrca) Time to most recent common ancestor (tmrca) of each clade was estimated in BEAST v1.6.1 (Drummond et al., 2006) based on the cyt b dataset of 42 unique haplotypes of L. intermedius and ten outgroup haplotypes (L. bynni bynni, L. bynni occidentalis, L. petitjeani, L. gananensis, L. sacratus, L. ethiopicus, L. oxyrhinchus and V. jubae) employing the GTR + I model. A relaxed uncorrected lognormal clock model was used to estimate timing of divergence among lineages. A coalescent tree prior with population expansion growth model was employed because F s (Fu, 1997) and R2 (Ramos-Onsins and Rozas, 2002) statistics implemented in DNASP 4.5 (Rozas et al., 2003) detected departures from constant population size or neutrality in the L. intermedius clade. The analysis employed three simulations each of which were run for 30 million generations, sampling every 1000 trees with a discarded burn-in of 7,500 trees. RESULTS PHYLOGENETIC ANALYSIS ML and MP analyses of cyt b sequences yielded similar topologies. The best tree from the ML analysis is presented in Fig 3.2. Both ML and MP analyses found strong support (ML/MP bootstrap support = 98%) for a monophyletic L. intermedius lineage (Figs and 3. 3). Samples of L. intermedius fall into two distinct haplotype lineages corresponding to a northsouth geographic split. Hereafter these two lineages are referred to as the northern and southern lineages. The northern lineage consisted of haplotypes 1-22 and 38-43; this clade was 43

59 geographically restricted to the Abay River (localities 1-6), Awash River (locality 7) and Northern Rift Valley (localities 8 and 9) basins (Fig. 3.1). The southern lineage contained haplotypes that originated from the Omo River (localities 10-12) and Southern Ethiopian Rift Valley (localities 13-17). The northern and southern lineages were resolved with moderate ML bootstrap support 84% and 73%, respectively; each lineage received weak support from MP analysis (60% and 54%). Intralineage relationships were largely unresolved. Nevertheless, a number of clades were recovered within the northern and southern lineages. Of three clades recovered in the northern lineage two were well supported and concordant with geography. The first clade (88% and 83%) consisted of haplotypes 17-22, whose distribution coincides with the Awash River Basin and Central Rift Valley (localities 7-9). All haplotypes representing the species flock of Labeobarbus from Lake Tana (localities 1-3) were placed within the northern lineage but no genetic structure was observed among them. The second group (91% and 88%) contained haplotypes 7 and 10 both originating from Dedessa River (locality 6), which is part of the Abay River Basin. Within the southern lineage two monophyletic groups were resolved. These two groups correspond to separate geographic areas: Gilgel Gibe River (locality 11; 89% and 93%; haplotypes 30-32) and Lakes Abaya (locality 13) and Chamo (locality 16; 90% and 89%; haplotypes 35-37). GENETIC DIVERGENCE AND TIME TO THE MOST RECENT COMMON ANCESTOR (TMRCA) Mean sequence divergence between the northern and southern lineages was 1.31%. Within lineage sequence divergences were 0.6% (northern) and 0.3% (southern). Time to most recent common ancestor between the two lineages was estimated as 970,000 YA (95% credible interval (CI); 510,000-1,550,000 YA). 44

60 ANALYSIS OF MOLECULAR VARIANCE A substantial level of intraspecific cyt b diversity was detected among L. intermedius lineages. In 87 specimens of L. intermedius examined 43 unique mtdna haplotypes were identified (28 haplotypes, northern lineage; 15 haplotypes, southern lineage). There was no overlap in the distribution of haplotypes between the two lineages. Haplotype diversity within both the northern and southern lineages was very high (h=1 ± 0.01 and 1± 0.02, respectively). Among-lineage variation accounted for 70.4% of overall genetic variance observed, while within-lineage variation accounted for 29.6%. Ф ST estimates revealed significant genetic differentiation between the northern and southern lineages (Ф ST = 0.70, p<0.01). DISCUSSION PHYLOGEOGRAPHY OF L. INTERMEDIUS IN ETHIOPIA Phylogeographic analysis of mtdna sequence variation in L. intermedius recovered clades that correspond with a north-south geographic divergence among lineages within Ethiopia. These results contradict Paugy s (2010) findings, which revealed a dichotomy separating the Northern Ethiopian Rift Valley Basin from the southern Ethiopian Rift Valley lakes plus Nilo-Sudan province (Lake Turkana and Blue Nile system). In the present analysis mtdna diversity in L. intermedius was partitioned into northern and southern lineages. The northern lineage was represented by localities 1-6 (Abay River drainage) and 7-9 (Awash River and Northern Rift Valley lakes) while the southern lineage included localities (Omo River Basin) and (southern Ethiopian Rift Valley; Fig. 3. 1). This suggests that haplotypes from the Abay River drainage (Blue Nile system) are phylogenetically more closely related to those originating from the Awash River Basin and Northern Rift Valley Lakes than they are to 45

61 haplotypes from Southern Rift Valley Lakes. The same north-south phylogeographic split and pattern of relationships within L. intermedius are also supported by analyses of mitochondrial cytochrome oxidase I (COI) gene sequences (Beshera and Harris, unpublished data). Aspects of the current phylogeographic structure of L. intermedius can be understood by considering historical geologic and climatic events across Ethiopia. Africa experienced repeated episods of volcanic-tectonic activities during the Oligocene and the whole period following the Miocene (Ebinger, 2000; Bonnini et al., 2005). These volcanic events may have greatly altered the topography and drainage patterns of the region and may have significantly influenced genetic differentiation in L. intermedius. The timing of the phylogeographic split identified in L. intermedius probablt coincides with the latest phases of these volcano-tectonic activities. There were two especially active periods of volcanic activity at the beginning and end of the Pleistocene (Beadle, 1981). Divergence date estimates indicate that the northern and southern lineages of L. intermedius shared a most recent common ancestor roughly around 970,000 YA suggesting that the observed phylogeographic split within L. intermedius began in the late Pleistocene. The distinctness of the northern and southern lineages of L. intermedius, and their mutually exclusive haplotypes, strongly suggest the existence of long-term physical barriers to genetic exchange between drainages harboring the two lineages. Vicariant events associated with the formation the Addis Ababa-Nekemt (ANL) and Goba-Bonga (GBL) tectonic lineaments may have impacted genetic divergence in L. intermedius. Within the Rift Valley system haplotypes from localities north of the GBL fall within the northern lineage while those originating from south of the GBL fall within the southern lineage. Similarly, haplotypes residing in localities on opposite sides of the ANL fall within different lineages. According to Abebe et al. (1998) 46

62 volcanism accompanying the formation of Addis Ababa-Nekemt Line (ANL) started at about Ma and developed through three main phases: 12-7, 6-2, and < 1 MA. Of the three phases characterizing the evolution of the ANL, the latest phase, which falls within the Pleistocene, appears to match the timing of lineage divergence in L. intermedius. In contrast, the timing of inception of the GBL, which was hypothesized by Bonini et al. (2005) as the Oligocene, long predates the estimated time of lineage divergence suggesting reconfiguration or later formation of the GBL. Mitochondrial haplotype variation in L. intermedius shows that haplotypes from localities (Omo River drainage) are more closely related to those from localities l3-17 (Chamo- Abaya basin) presumably because of past genetic contact between the two drainages. Seismic and quaternary volcanic data indicate that the Omo-Turkana basin and Chamo-Abaya basin in Southern Rift Valley drainage system are currently linked across a 200-km-wide zone (Ebinger et al., 2000). In the late Pleistocene-early Holocene Southern Ethiopian Rift Valley lakes overflowed into Lake Turkana (Golubstov and Redeat, 2010), suggesting recent faunal exchange between Omo-Turkana and Chamo-Abaya basins. Within the northern lineage, genetic differentiation of L. intermedius haplotypes of localities 7-9 (Awash River and Northern Rift Valley lakes) from those of localities 1-6 (Abay River drainage) was probably driven by the uplifting of the Northwestern highlands and down faulting of the Ethiopian Rift. The Abay River, along with the Awash River, once drained to the east into the Red Sea (Goudie, 2005). During the mid-pleistocene tilting in the Ethiopian Highlands reversed its direction leading to its ultimate confluence with the White Nile. Similarly, the clustering of haplotypes from the Awash River and Lakes Langano and Awassa (Northern Rift Valley Basin) into a well-supported monophyletic group (88% and 83%) suggests recent 47

63 faunal contact among these water systems. Mohr (1966) hypothesized that in the late Tertiary the four most northerly lakes of the Rift Valley (Lakes Abiyata, Langano, Shalla, and Zeway) were continuous with the Awassa and Abaya basins to the south and with the Awash River drainage to the north. Later the southern Rift lakes (Lakes Abaya and Chamo) became isolated and until the late pluvial period ( years BP) only the four northern Rift lakes (Lakes Abiyata, Langano, Shala and Zeway) were unified into a larger lake, which drained into the Awash River. These connections have been confirmed by the distribution of similar lacustrine deposits across the entire watershed (Grove et al., 1975). TAXONOMIC IMPLICATIONS FOR LABEOBARBUS INTERMEDIUS The finding that L. intermedius constitutes two divergent lineages has new implications with regard to the taxonomy of the species. Banister (1973) established a single polytypic species, L. intermedius, with two subspecies, L. intermedius australis and L. intermedius intermedius; the taxon distributed throughout Ethiopia and Northern Kenya belonged to the former subspecies while the later was known only from Lake Baringo. A subsequent study based on morphological analysis of samples from Northern Kenya supported Banister s (1973) proposed synonomy of several East African barbs species and subspecies into L. intermedius, but rejected the subspecific separation of L. intermedius australis (Skorepa, 1992). However, these taxonomic suggestions have never been tested phylogenetically. Recovery of a well-supported (98%) monophyletic L. intermedius (including haplotypes of the species flock of Labeobabrus from Lake Tana) within Ethiopia supports Banister s (1973) taxonomic conclusion synonomyzing several species and subspecies into a single species, L. intermedius. However, there was no correspondence between the north-south phylogeographic split of L. intermedius 48

64 and sub-species of L. intermedius proposed by Banister (1973) suggesting the rejection of Banister s (1975) hypothesis of sub-specific designation within L. intermedius. The relatively lower genetic divergence observed between the two (i.e. northern and southern) lineages of L. intermedius (1.31%) suggests that the two lineages may have been recently isolated. But the clear geographic isolation, significant genetic differentiation, substantial level of genetic divergence, and the mutually exclusive haplotypes of the two lineages are evidence that these lineages have independent histories with no gene flow between them. These results also suggest that the northern and southern lineages could be distinguished as separate species. Comparable levels of cytochrome b sequence divergences have been used to recognize species among Euro- Mediteranean minnows (Zardoya and Doadrio, 1998; Doadrio et al., 2001). Because phylogenetic evidence based on a single mitochondrial marker would be insufficient to make taxonomic inferences, the question of whether the northern and southern lineages of L. intermedius merit status as different species deserves further study. Detailed morphological analyses aimed at establishing diagnostic morphological characters are needed. In addition, in the present study sampling did not cover the entire geographic range of the species because samples from the Baro-Akobo River basin in western Ethiopia and the Turkana basin in northern Kenya were unavailable. Given the close association between the Rift Valley of southern Ethiopia and the Kenyan Rift system (Ebinger et al., 2000; Bonnini et al., 2005) and the current connection between the Omo River system and the Lake Turkana Basin, the north Kenyan L. intermedius populations may share phylogenetic affinities with the southern lineage. 49

65 TAXONOMIC IMPLICATIONS FOR THE LAKE TANA LABEOBARBUS SPECIES FLOCK The taxonomic placement and phylogenetic relationships of Lake Tana large Labeobarbus species has been the subject of much debate. In the past, some of the Labeobarbus of Lake Tana were considered as species by Rüppell (1836) and Boulengar (1902) but described as species and subspecies by Binni (1940). These former species and subspecies were later lumped with other East African barbs into a single species, L. intermedius, by Banister (1973). The latest revision described at least 15 species of Labeobarbus in the Lake. These Labeobarbus species diverge in terms of head morphology, feeding structures and body shape (Nagelkerke et al. 1994; Nagelkerke and Sibbing 2000) and also have different spatial and temporal breeding (spawning) patterns within the lake (Sibbing et al., 1998). The placement of all the Lake Tana Labeobarbus species nested within the northern lineage of L. intermedius in the present analysis is consistent with their inclusion by Banister (1973) within L. intermedius. Although the earliest genetic studies involving class II MHC (Dixon et al., 1996) and Allozyme (Berrebi and Valiushock, 1998) markers revealed some differences among the putative Labeobarbus species of Lake Tana, neither marker was found to be convincingly diagnostic. These species were also recently found to be genetically indistinct based on phylogenetic analysis of cyt b gene sequences (Graff et al., 2010). Consistent with Graff et al. (2010) the present study did not reveal any genetic differentiation among the Labeobarbus species flock of Lake Tana. Presumably recent radiation may account for the very shallow genetic divergences (results not shown) observed among Lake Tana species and lack of phylogenetic resolution. A similar radiation characterized by strikingly inconsistent morphological and molecular variation has been reported in cichlids in Lake Victoria (Nagl et al., 2000, Verheyen et al., 2003). The present phylogeographic analysis suggests that the Lake Tana species probably diverged over a relatively 50

66 shallow time scale rendering cyt b gene an inappropriate marker for resolving evolutionary relationships and population structure in these species. The use of faster evolving markers (e.g. microsatellite DNA loci) would, therefore, be imperative in future efforts aimed at conclusively resolving evolutionary relationships, population structure and taxonomy of the Lake Tana Labeobarbus. REFERENCES Abebe, G. and M.L.J., Stiassny. (1998). The freshwater biodiversity crisis: The case of the Ethiopian fish fauna. SINET: Ethiopian Journal of Science 21 (2), Abebe, T., Mazzarini, F., Innocenti, F., and Panetti, P. (1998). The Yerer-Tullu Wellel Volcanotectonic lineament: a transtensional structure in Central Ethiopia and the associated magmatic activity. Journal of African Earth Sciences 26 (1), Banister, K. E. (1973). A revision of the large Barbus (pisces: Cyprinidae) of East and Central Africa. Studies on African Cyprinidae Part II. Bulletin of the British Museum of Natural History (Zoology) 26, Beadle, L.C. (1981). The inland waters of tropical Africa; an introduction to tropical limnology. Second edition, pp London and New York: Longman. Berrebi, P., Valiushok, D., (1998). Genetic divergence among morphotypes of Lake Tana (Ethiopia) barbs. Biological Journal of Linnean Society 64, Binni, G. (1940). I Pesci de lago Tana. Missione di Studio al Lago Tana 3 (2), pp Bonnini, M., Corti, G., Innocenti, F., Manetti, P., Mazzarini, F., Abebe T., and Pecskay, Z. (2005). Evolution of the Main Ethiopian Rift in the frame of Afar and Kenya rifts propagation. Tectonics 24, pp21. TC 1007, doi: /2004tc Boulengar, G.A. (1902). Descriptions of new fishes from the collection made by Mr. E. Degen in Abyssinia. Annals and Magazine of Natural History 10 (7), Boulenger, G.A., (1907). Zoology of Egypt: the. shes of the Nile: H. Rees, London. Boulenger, G.A., Freshwater Fishes of Africa. Vol. II: British Museum (Natural History), London. 51

67 Briolay, J., Galtier, N., Britto, R. M., and Bouvet, Y. (1998). Molecular phylogeny of cyprinidae. Inferred from cytochrome b DNA sequences. Molecular phylogenetics and Evolution 9, Dixon, B., Nagelkerke, L. A. J., Sibbing, F. A., Egberts, E., and Stet, R. J. M. (1996). Evolution of MHC class II βchain-encoding genes in the Lake Tana barbel species flock (Barbus intermedius complex). Immunogenetics 44, Doadrio, I., Carmona, J. A., and Machordom, A. (2001). Haplotype diversity and phylogenetic relationships among the Iberian Barbels (Barbus, Cyprinidae) reveal two evolutionary lineages. The American Genetic Association 93, Drummond, A.J., Ho, S.Y.W., Phillips, M. J., Rambaut, A. (2006) Relaxed phylogenetics and dating with confidence. PLoS Biology 4 (5):e88, Ebinger, C. J., Yemane, T., Harding, D. J., Tesfaye, S., Kelley, S. and Rex, D. C. (2000). Rift deflection, migration, and propagation: Linkage of the Ethiopian and Eastern rifts, Africa. GSA Bulletin 112, Excoffier, L., Smouse, P. E., Quattro, J. M. (1992). Analysis of molecular variance inferred from metric distance among DNA haplotypes : Applications to human mitochondrial DNA restriction data. Genetics 131, Fu, Y. X. (1997). Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics 147: Golubstov, A. S. and Krysanov, E.Yu. (1993). Karyological study of some cyprinid species from Ethiopia, The ploidy differences between large and small Barbus of Africa. Journal of Fish Biology 42, Golubstov, A.S., Dgebuadze, Yu., Yu., and Mina, M.V. (2002). Fishes of the Ethiopian Rift Valley; In Tuderancea, C. and Tayler, W. D. (eds.), Ethiopian Rift Valley Lakes. Backhuys Publishers, Leiden: Golubstov, A.S. and Redeat, H. (2010). Fish faunas of the Chamo-Abaya and Chew Bahir basins in southern portion of the Ethiopian Rift Valley: origin and prospects for survival. Aquatic Ecosystem Health & Management 13 (1), DOI: / Graff, M.D., Megens, H.J., Samallo, J., and Sibbing, F. A. (2010). Preliminary insight into the age and origin of the Labeobarbus fish species flock from Lake Tana (Ethiopia) using the mtdna cytochrome b gene. Molecular Phylogenetics and Evolution 54 (2), Grove, A. T., Street, F. A., Goudie, A. S. (1975). Former lake levels and climatic changes in the rift valley of southern Ethiopia. The Geographical Journal 141,

68 Goudie, A. S. (2005). The drainage of Africa since the Cretaceous. Geomorphology 67, Hall, T. A. (1999). BioEdit; A user friendly biological sequence alignment editor and analysis program for Wndows 95/98/NT Nucleic Acids Symposium Series 41, Krysanov, E.Y., Golubtsov, A.S. (1996). Karyotypes of some Ethiopian Barbus and Varicorhinus from the Nile basin including Lake Tana morphotypes. Folia Zoologica 45, Machordom, A. and Doadrio, I. (2001). Evolutionary history and speciation modes in the cyprinid genus Barbus. Proceedings of the Royal Society of London (Biological Sciences) Mohr, P. (1966). The Geology of Ethiopia. University College Addis Ababa Press, Addis Ababa, Ethiopia, pp Nagl, S., Tichy, H., Mayer, W., Takezaki, N., Takahata, N., and Klein, J. (2000). The origin and age of haplochromine fishes in Lake Victoria, East Africa. Proceedings of The Royal Society of London (Biological Sciences) 267, Nagelkerke, L. A. J. & Sibbing, F. A. (1997). A revision of the large barbs (Barbus spp., Cyprinidae, Teleostei) of Lake Tana, Ethiopia, with a description of seven new species. In: Nagelkerke, L. A. J. (ed), The barbs of Lake Tana, Ethiopia; morphological diversity and its implications for taxonomy, trophic resource partitioning, and fisheries. Doctoral Dissertation. Wageningen Agricultural University, Wageningen, Netherlands. Nagelkerke, L. A. J. & Sibbing, F. A. (2000). The large barbs (Barbus spp., Cyprinidae, Teleostei) of Lake Tana (Ethiopia), with a description of a new species, Barbus osseensis. Netherlands Journal of Zoology 50, Nagelkerke L. A. J., Sibbing, F. A., Boogaart, J. G. M., Lammens, E. H. R. R., Osse, J. W. M. (1994). The barbs (Barbus spp.) of Lake Tana; a forgotten species flock? Environmental Biology of Fishes 39, Paugy, D. (2010). An historical review of African freshwater ichthyology. Freshwater Reviews 3(1), Posada, D. and Crandall, K. A., (1998). Model test; testing models of DNA substitution. Bioinformatics 14, Ramos-Onsins, S., and Rozas, J. (2002). Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution 19, Roberts, T. R. (1975). Geographical distribution of African freshwater fishes. Zoological Journal of the Linnean Society 57,

69 Rozas, J., Sánchez-DelBarrio, J. C., Messeguer, X. and Rozas, R. (2003). DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19, Rüppell, W. P. E. S. (1836). Neuer Nachtrag von Beschreibungen und Abbildungen neuer Fische, im Nil entdeckt. Museum Senckenbergianum: Abhandlungen aus dem Gebiete der beschreibenden Naturgeschichte, van Mitgliedern der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt, Main Frankfort. 2 (1), Sibbing, F. A., Nagelkerke, L. A. J., Stet, R. J. M., and Osse, J. W. M. (1998). Speciation of endemic Lake Tana barbs (Cyprinidae, Ethiopia) Adaptive radiation of Lake Tana s Labeobarbus driven by trophic resource partitioning; a molecular and ecomorphological approach. Aquatic Ecology 32, doi: / A: Skelton, P. H. (2001). A complete guide to the Freshwater fishes of Southern Africa. Struik Publishers, Cape Town, South Africa.pp395. Skelton, P.H. (2002). Changes to the Scientific and common names of Southern African freshwater fishes. African Journal of Aquatic science 27: Skorepa, V. (1992). Note on the East African Barbel, Barbus intermedius, (Cyprinidae, Osteichthyes) from Kito Pass, Northern Kenya. Acta Societatis Zoologicae Bohemoslovenicae 56, Stamatakis, A., (2010). RAxML v Available from: Stamatakis, A., Hoover, P. and Rougemont, J. (2008). A Rapid Bootstrap Algorithm for the RAxML Web Servers. Systematic Biology 57 (5), Swofford, D. L. (2002). PAUP* 4.0: phylogenetic analysis using parsimony (and other methods). Beta version 4.0b4a. Sinauer Associates, Sunderland, MA. Verheyen, E., Salzburger, W., Snoeks, J., Meyer, A., (2003). Origin of the superflock of cichlid fishes from Lake Victoria, East Africa. Science 300, Zardoya, R. and Doadrio, I. (1998). Phylogenetic relationships of Iberian cyprinids: systematic and biogeographical implications. Proceedings of the Royal Society of London 265,

70 Sagoe R. 5.72N, 37.41E 5 27 JN TABLE 3. 1 List of haplotypes examined in this study with Basin and water body sampled; SLC = Sampling locality coordinates; NS = number of specimens; HN = haplotype number; GBN = GenBank Accession number; Numbers in map column correspond to sampling localities in Figure 1. Species/Basin Water body SLC NS HN GBN map L. intermedius Abay Abay R N, 37.60E JN JN Dedessa R. 8.04N, 36.47E JN JN Gumara R N, 37.64E 4 2, JN886993, JN JN L. Tana 11.64N, 37.34E 21 a 12-16, JN JN887007, 1-3 JN JN Awash Awash R. 8.52N, 39.28E 5 17, 18 JN887008, JN Rift Valley Lakes L. Awassa 7.05N, 38.43E 5 17 and 19 JN887008, JN L. Langano 7.71N, 38.71E 5 20, 21 and 22 JN JN L. Abaya 6.50N, 37.78E 2 35, 37 JN887026, JN L. Chamo 5.94N, 37.58E 4 35, 36 JN887026, JN Kulfo R. 5.94N, 37.58E 6 27 and 28 JN887018, JN Arba Minch Springs 6.01N, 37.57E JN JN

71 TABLE 3. 1 continued Species/Basin Water body SLC NS HN GBN map Darse R. 6.11N, 37.56E 2 26, 27 JN887017, JN Omo Gibe R. 8.23N, 37.57E 4 25, 26, 29 JN887016, JN887017, JN GilgelGibe R. 7.79N, 37.27E JN JN Gojeb R. 7.56N, 36.39E 5 33 and 34 JN887024, JN Outgroup taxa L. gananensis Genale R. 5.70N, 39.54E JN JN L. yinni bynni Nile R., Egypt AF28742 L. bynni occidentalis Bafing R., Guinea AF28742 L. ethiopicus L. Tana, Ethiopia AF L. oxyrhynchus Sagana R., Kenya AF L. petitjeanii Bafing R., Guinea AF L. sacratus Tangala R., Guinea AF a includes 15 specimens of the species flock of Labeobarbus from Lake Tana. 56

72 FIG Map showing sampling localities of L. intermedius (with some points offset for clari and the distribution of the northern and southern lineages; Black circles = northern lineage, red circles = southern lineage, ANL = Addis Ababa-Nekemt tectonic lineament, GBL = Goba-Bon tectonic lineament lineament. The base map was obtained from ANL 6 = GBL GBL q y we r t 57

73 FIG Phylogram for RAxML analysis of cyt b gene with maximum likelihhod bootstrap values shown at nodes.!"!" '( "$ Hap 25 Hap 29 Hap 31 Hap 30 Hap 32 Hap 34 Hap 36 Hap 35 Hap 37 Hap 33 Hap 26 Hap 28 Hap 24 Hap 27 Hap 23 Hap 6 Hap 2 Hap 41 Hap 7 Hap 10 Hap 14 Hap 1 Hap 42 Hap 39 Hap 13 Hap 43 Hap 40 Hap 15 Hap 4 Hap 19 "! ")!)!#!"!& ""!" Hap 20 Hap 18 Hap 17 Hap 22 Hap 38 Hap 16 Hap 11 Hap 12 Hap 8 Hap 5 Hap 9 Hap 3!! #$ %# "#!"#$%&'()*+(&,-& Hap 21."'$%&'()*+(&,-&!"#$%&&'#$%&&'!"#$%&&'#())'*+&,-.'/!"#0+,'1+-&''!"#/-)2-,3/ L. gananensis [4]!"#(5%24'&)43/!"#+,4'(0')3/ /#$-'"#0 1,2,

74 !"#'&,+27+*'3/':;97"<7 FIG Phylogeny of 43 haplotypes of Labeobarbus intermedius recovered from Maximum Likelihood analysis of mitochondrial cytochrome b sequence data. OTUs are identified by unique haplotypes. Numbers in parenthesis correspond to sampling localities (see Fig 3.1) while the number in bracket represents number of L. gananensis haplotypes. Numbers above branches correspond to ML/MP bootstrap values. MP score for best trees = E20 DA>?C7@9':;97"<7 0-E12 /1EF 00E0& /,E*- 0,E/- BA@?C7@9 ':;97"<7 20EF 1&E*, 2/E2% 22E20 02E2& 2-E02 /2E*1 2)E00 /)EF 20E2/ 0/E)--!"#$%&'()*+!"#$%,()*+!"#$%*'()-.')*+!"#$%/'()-.')*.')0+!"#$%1'(),.')1.')0+!"#$%0'(),+!"#$%2'()-+!"#$&-'())+!"#$&)'())+!"#$&%'())+!"#$&&'()%+!"#$&,'()%+!"#$&*'()&.')/+!"#$&/'()/+!"#$&1'()&+!"#$/'(/+!"#$%'(,.'*+!"#$&'(*+!"#$,'(*+!"#$)'(*+!"#$)&'(%.',+!"#$&2'()+!"#$,%'()+!"#$,&'(&+!"#$),'(%+!"#$,-'()+!"#$)%'().'%.',+!"#$)*'(%+!"#$)/'(%+!"#$&0'(%+!"#$,)'(&+!"#$))'(,+!"#$*'(/+!"#$0'(/+!"#$2'(/+!"#$1'(/+!"#$)-'(/+!"#$)1'(1.'0.'2+!"#$)0'(1+!"#$%%'(0+!"#$%-'(0+!"#$)2'(2+!"#$%)'(0+!"#$%&&'#$%&&'!"#$%&&'#())'*+&,-.'/!"#0+,',1+-&''!"#/-)2-,3/!"#+,4'(0')3/!"#(5%24%&)43/!"#6-&-&+&/'/'3,4 5"67'8"9"' 59

75 CHAPTER 4 ISOLATION AND CHARACTERIZATION OF SIX NOVEL MICROSATELLITE LOCI IN LABEOBARBUS INTERMEDIUS (CYPRINIDAE) AND THEIR CROSS-SPECIES UTILITY IN THE LAKE TANA LABEOBARBUS SPECIES FLOCK ABSTRACT SEQMAN NGEN v3 (DNASTAR, Madison, WI) was used to assemble 624,218 DNA fragment sequences generated by next generation 454 sequencing. This produced 320,357 assembled sequence reads from which 79,900 contigs were extracted. From the assembled contig sequences, 72 microsatellite loci with di-, tri- and tetra-nucleotide motifs were screened and tested on five Labeobarbus intermedius for amplification success and potential allelic variation. Forty-one loci produced clear PCR products but allelic variation was observed in only 10 loci (19%). Six of ten loci were characterized in 35 individuals of L. intermedius from19 sampling localities and also assessed for cross-species applicability. Overall 99 alleles were identified in L. intermedius across all loci with a mean of 16.5 alleles per locus. Observed heterozygosity was high among loci ranging from 0.8 to 1.0. High levels of observed allelic variation among these loci, and their amplification in other species, indicate these loci have potential utility for assessing population genetic structure in L. intermedius and the Labeobarbus species flock of Lake Tana. 60

76 INTRODUCTION Labeobarbus intermedius Rüppell 1836 is widespread throughout the major drainage basins of Ethiopia and Northern Kenya via the Rift Valley lakes (Banister, 1973; Chapter 3). The taxonomy of this species has traditionally been difficult to resolve because of the existence of extensive intraspecific morphological variation (Ruppel, 1836; Boulenger, 1902, 1907, 1911; 1940; Banister, 1973; Nagelkerke et al, 1994; Nagelkerke and Sibbing, 1997, 2000). Although progress has been made advancing our knowledge on the phylogeny and taxonomy of Labeobarbus (Doadrio and Machordom, 2001; Golubstov and Krysanov, 1993; Güegan et al., 1995; Krysanov and Golubstov, 1996; Ollerman and Skelton, 1990; Tsigenopouls et al., 2002; Tsigenopoulos et al., 2010) the lack of available genetic markers has impeded our understanding of patterns of population-genetic structure and evolutionary relationships and testing specieslevel taxonomic hypothesis within many evolutionary lineages of this genus, including L. intermedius. A recent phylogeographic analysis of populations based on mtdna cyt b gene elucidated a north-south phylogeographic split within L. intermedius in Ethiopia (Chapter 3). This study revealed little genetic differentiation within the two lineages, however, highlighting the need for additional molecular markers to examine fine-scale population-genetic structure within L. intermedius. In addition, the Lake Tana Labeobarbus species flock is currently of high conservation concern because a longstanding commercial fishery targets spawning aggregations, with more than 50% of the catch being obtained in river mouths during spawning seasons (Nagelkerke et al., 1995), resulting in population decline over the past two decades (De Graaf et al., 2004). Given the significant decline in harvest (i.e. a decrease in catch per unit effort, CPUE, from 63 kg/trip in to 28 kg/trip in 2001) from the lake since the early 1990 s (De 61

77 Graaf et al., 2004) and the fact that several similar African cyprinid fish stocks have collapsed in the twenty first century because of fisheries with modern harvesting methods targeting spawning aggregations (Gordon, 2003; Ogutu Ohwayo, 1990; Ochumba and Manyala, 1992; Skelton, et al., 1991), there is an urgent need to identify stocks and design conservation strategies for Labeobarbus species within Lake Tana. The focus of Chapter 4 was to develop microsatellite DNA markers useful in examining patterns of genetic structure among the Labeobarbus species from Lake Tana. Six new microsatellite DNA loci for L. intermedius were developed and characterized herein, as well as documenting their potential utility in other species of Labeobarbus and Varicorhinus beso. MATERIALS AND METHODS 454 SEQUENCING, DATA ASSEMBLY AND PRIMER DEVELOPMENT Microsatellite DNA primers were developed from DNA fragment sequences derived from a genomic library prepared from a single specimen of L. intermedius from Lake Tana, Ethiopia (Voucher specimen stored at The University of Alabama Ichthyological Collection, UAIC ). Total DNA was extracted using the DNeasy tissue kit protocol (Qiagen, Valencia, CA) following the manufacturer s instructions. Four separate DNA extractions were pooled to obtain sufficient amount of DNA followed by RNAse treatment. A microsatelliteenriched L. intermedius genomic library was constructed from half plate samples at Hudson- Alpha Genome Sequencing Center employing 454 (shotgun) sequencing method according to the manufacturer s instructions. A total of 624,218 sequence reads generated by 454 sequencing platform were processed using a sequence assembly software called SEQMAN NGEN v3 (DNASTAR, Madison, WI) employing a 21 base pair match size that required a minimum of 62

78 85% similarity. This produced 79,900 contigs from 320,357 assembled sequence reads and left 303, 861 sequence reads unassembled. The 79, 900 contig sequences generated (mean read length of 537) were later scanned with PHOBOS version (Mayer, ) to detect sequence reads containing microsatellite tandom repeats. Seventy-two microsatellite loci with di-, tri- and tetra-nucleotide motifs and sufficient flanking sequences were selected and amplification primers (forward and reverse) were designed for these loci based on flanking sequence information employing GENEOUS version 4.8 (Drummond et al., 2009). DNA AMPLIFICATION Microsatellite loci were tested initially on five specimens of L. intermedius for amplification success and polymorphism. PCR amplifications were performed in 12.5 µl reactions, containing ng DNA template, 6.25µL Failesafe premix buffer, and 0.2 µl of 10 µm each primer. DNA was amplified employing a PCR protocol that involved 2 min 95 C initial denaturation step followed by 30 cycles (91 C denaturation for 35 sec, annealing at C for 35 sec, and extension at 72 C for 45 sec) and a final 72 C extension step. Amplifications were considered successful if the loci showed clear banding patterns or produced weak but identifiable bands on gels, the amplicons were of expected sizes and PCR products were specific (no more than two bands). Ten of 72 microsatellite loci exhibited allelic variation among the five L. intermedius specimens. These ten loci were selected for subsequent characterization and cross-species amplification. But because of the difficulties associated with genotyping four loci (i.e. Di4610, Tri1710, Tri2474, Tetra4847) these loci were excluded from subsequent analysis. The remaining six loci (Di870, Tetra2477, Di4111, Tetra5057, Tri5513, and Tri6230) were characterized in 35 63

79 specimens of L. intermedius from 19 sampling localities representing 16 water bodies (two or three individuals per locality) using singleplex PCR reactions. The forward primer of each microsatellite marker was labeled at the 5 -end with one of four fluorescent dyes (either 6- FAM TM, TET TM, HEX TM, or TAMRA TM ). For genotyping, PCR products were mixed with 9µl HiDi formamide and 0.5µl GeneScan-500 TAMRA size standard and run on an ABI 310 Genetic Analyzer (Applied Biosystems, Perkin-Elmer Corp.). Allele sizes were scored against the size standard and genotypes were determined employing GENE SCAN Analysis Software (Applied Biosystems, Perkin-Elmer Corp.). Flexibin version 2.0 (Amos et al., 2007) was used to automate binning of microsatellite alleles. Nei s (1987) genetic diversity measures, which include number of alleles (N A ) per locus, observed heterozygosity (H O ) and Fixation Index (F IS ) were estimated in GENODIVE version 2.0b22 (Meirman and Van Tienderen, 2004). Locus designations, repeat motif, primer sequences and some population genetic parameters of the microsatellite loci are presented in Table 1. The ability of these six microsatellite markers to cross-amplify in other species was tested in thirteen putative Labeobarbus species from Lake Tana as well as L. gananensis and Varicorhinus besso. Two individuals per species were examined. Genotypes were determined as previously described. RESULTS Fifty-three of 72 loci tested produced successful amplifications. The remaining 17 loci failed to amplify. Of the 53 Forty-one loci produced clear amplification products; weak but discernible bands in gels were apparent in an additional seven loci. Thirty-one of forty-one loci (75.6%) were monomorphic. Ten loci (24.4%) exhibited allelic variation (i.e varying 64

80 amplification product size among tested specimens). Five loci exhibited multiple amplification products (i.e. more than three bands). Six loci (for which genotyping was successful) were tested on 35 specimens of L. intermedius obtained from 19 sampling localities in Ethiopia. Labeobarbus intermedius exhibited one to five alleles per individual in six loci examined suggesting polysomic inheritance in L. intermedius. Ninety-nine alleles were identified among the six loci, with a mean of 16.5 alleles per locus. Loci Di870 and Tri5513 showed the highest and lowest levels of genetic diversity displaying 27 and 5 alleles, respectively, per locus among 35 specimens of L. intermedius (Table 1). Observed heterozygosity values ranged from 0.8 (Tri5513) to 1.0 (Tri6230). All six loci examined significantly deviated from Hardy-Weinberg expectations (P<0.05). All F-values were negative, indicating an excess of hetrozygotes. In cross-species amplification these six loci of L. intermedius amplified successfully in all individuals of the 15 species tested. Amplicon size ranges were similar to those allele sizes in L. intermedius for which the primers were developed. Results of the cross-species amplification (Table 2) showed that the total number of alleles displayed was highest for L. gorguari (28 alleles across all loci) and lowest for V. besso (16 alleles). Across all taxa (including V. beso) the number of alleles per locus ranged from one to eight. DISCUSSION Because L. intermedius is hexaploid (Golubstov and Krysanov, 1993; Krysanov and Golubstov, 1996), observed levels of allelic diversity and heterozygocity in this species are considerably higher than those previously reported for freshwater fishes. In an extensive survey of microsatellite DNA variation among 78 species of freshwater fishes displayed lower levels of 65

81 population genetic variation; mean heterozygocity (h) = 0.46 and mean number of alleles (a) per locus = 7.5 (Dewoody and Avise, 2000). High levels of heterozygocity found in L. intermedius may be attributed to the presence of multiple alleles per locus resulting from polysomic inheritance that combines divergent parental genomes in polyploid organisms (Moody et al., 1993). Multiple alleles per locus and high levels of heterozygosity are believed to have contributed to the evolutionary success of polyploids (Levy and Feldman, 2002) and the high morphological plasticity observed in L. intermedius may also be attributed to these factors. An important caveat associated with the use of traditional population genetic diversity measures in L. intermedius, however, is that the exact allele copy number is difficult to know in partially heterozygous genotypes (Clark and Asieniuk, 2011). Such allele copy number ambiguity, as well as the complex pattern of inheritance associated with polyploids, could impact the interpretation and reliability of diversity estimates reported herein for L. intermedius. High level of allelic variation coupled with the ability of the six L. intemedius microsatellite loci to amplify in other species of Labeobarbus as well as V. beso, indicates the microsatellite DNA loci developed herein may have potential utility as molecular markers for assessing genetic diversity and population structure in L. intermedius and other closely related taxa, such as the Lake Tana Labeobarbus species flock (Chapter 5). 66

82 REFERENCES Amos, W., Hoffman, J. I., Frodsham, A., Zhang, L., Best, S. and Hill, A. V. S. (2007). Automated binning of microsatellite alleles: problems and solutions. Molecular Ecology Notes 7, Banister, K. E. (1973). A revision of the large Barbus (pisces: Cyprinidae) of East and Central Africa. Studies on African Cyprinidae Part II. Bulletin of the British Museum of Natural History (Zoology) 26, Binni, G. (1940). I Pesci de lago Tana. Missione di Studio al Lago Tana 3 (2), Boulengar, G. A. (1902). Descriptions of new fishes from the collection made by Mr. E. Degen in Abyssinia. Annals and Magazine of Natural History 10 (7), Boulenger, G. A. (1907). Zoology of Egypt: the fishes of the Nile: H. Rees, London. Boulenger, G. A. (1911). Freshwater Fishes of Africa. Vol. II: British Museum (Natural History), London. Clark, L. V. and Jasieniuk, M. (2011). POLYSAT: an R package for polyploid microsatellite analysis. Molecular Ecology Resources 11, De Graaf, M., Machiels, M. A. M., Wudneh, T., and Sibbing, F. A. (2004). Declining stocks of Lake Tana s endemic Barbus species flock (Pisces, Cyprinidae): natural variation or human impact? Biological Conservation 116, DeWoody, J. A. and Avise, J. C. (2000). Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. Journal of Fish Biology 56, Doadrio I. and Machordom, A. (2001). Evolutionary history and speciation modes in the Cyprinid genus Barbus. Pros. R, Soc. London (Biology) 268, Drummond. A., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir, R., Stones-Havas, S., Thierer, T. and Wilson, A. (2009). Geneious v4.7 Golubstov, A. S. and Krysanov, E.Yu. (1993). Karyological study of some cyprinid species from Ethiopia, The ploidy differences between large and small Barbus of Africa. Journal of Fish Biology 42, Gordon, D. M. (2003). Technological change and economics of scale in the history of Mweru- Luapula s fishery (Zambia and Democratic Republic of Congo), management, comanegement or non-management? Major dilemas in southern African freshwater fisheries, In: Jul-Larsen, E,. Kolding, J., Overa, R., Rackjaer Nielson, J., Van Zwieten, P. A. M., FAO, Fisheries Technical Paper, 426/2., Rome, FAO. 67

83 Güegan, J. F., Rab, P., Machordom, A. and Doadrio, I. (1995). New evidence of hexaploidy in large African Barbus with some considerations on origin of hexaploidy. Journal of Fish Biology 47, Krysanov, E. Y. and Golubtsov, A. S., (1996). Karyotypes of some Ethiopian Barbus and Varicorhinus from the Nile basin including Lake Tana morphotypes. Folia Zoologica 45, Levy, A. A. and Feldman, M. (2002). The impact of polyploidy on grass genome evolution. Plant Physiology 130, Mayer, C. ( ). Phobos Meirmans, P. G. and Van Tienderen, P. H. (2004). GENOTYPE and GENODIVE: Two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4, Moody, M., E. Mueller, L. D. and Soltis, D. E. (1993). Genetics 134, Nagelkerke, L. A. J., Mina, M. V., Wudneh, T., Sibbing, F. A., and Osse, J. W. M. (1995). In Lake Tana, a unique fish fauna needs protection. Bioscience 45, Nagelkerke, L. A. J. and Sibbing, F. A. (1997). A revision of the large barbs (Barbus spp., Cyprinidae, Teleostei) of Lake Tana, Ethiopia, with a description of seven new species. In: Nagelkerke, L. A. J. (ed), The barbs of Lake Tana, Ethiopia; morphological diversity and its implications for taxonomy, trophic resource partitioning, and fisheries. Doctoral Dissertation. Wageningen Agricultural University, Wageningen, Netherlands. Nagelkerke, L. A. J. and Sibbing, F. A. (2000). The large barbs (Barbus spp., Cyprinidae, Teleostei) of Lake Tana (Ethiopia), with a description of a new species, Barbus osseensis. Netherlands Journal of Zoology 50, Nagelkerke L. A. J., Sibbing, F. A., Boogaart, J. G. M., Lammens, E. H. R. R. and Osse, J. W. M. (1994). The barbs (Barbus spp.) of Lake Tana; a forgotten species flock? Environmental Biology of Fishes 39, Nei, M. (1987). Estimation of average heterozygocity and genetic distance from small number of individuals. Genetics 89, Ochumba, P. B. O. and Manyala, J. O. (1992). Distribution of fishes along the Sondu-Miriu River of Lake Victoria, Kenya with special reference to upstream migration, biology and yield. Aquaculture and Fisheries Management 23,

84 Ogutu-Ohwayo, R. (1990). The decline of the native fishes of Lakes Victoria and Kyoga (East Africa) and the impact of introduced species, especially the Nile Perch, Lates niloticus and Nile tilapia, Oreochromis niloticus. Environmental Biology of Fishes 27, Ollerman, L. K. and Skelton, P. H. (1990). Hexaploidy in yellowfish species (Barbus, Pisces, Cyprinidae) from southern Africa. Journal of Fish Biology 37, Rüppell, W. P. E. S. (1836). Neuer Nachtrag von Beschreibungen und Abbildungen neuer Fische, im Nil entdeckt. Museum Senckenbergianum: Abhandlungen aus dem Gebiete der beschreibenden Naturgeschichte, van Mitgliedern der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt, Main Frankfort. 2 (1), Tsigenopoulos, C. S., Rab, P., Naran, D. and Berrebi, P. (2002). Multiple origins of polyploidy in the phylogeny of Southern African barbs (Cyprinidae) as inferred from mtdna markers. Heredity 88, Tsigenopoulos, C. S., Kasapidis, P. and Berrebi, P. (2010). Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtdna data. Molecular Phylogenetics and Evolution 56(2),

85 TABLE 4. 1 Six microsatellite markers developed for L. intermedius. Annealing temperatures T m, allele size range (S A), total number of alleles (N A ), Number of individuals with locus successfully amplified (N), observed homozygosity (H O ), fixation index (F IS ). Locus Repeat motif Primer sequence Tm S A (bp) N A N H O F IS Di870 (GT) 9 Tetra2477 (TCTA) 3 (TCTG)(TCTA)(TCTC )(TATC) 2 (ATCT) 2 Di4111 (CA) 6 CG (CA) 10 TA(CA) 3 Tetra5057 (CTTT) 7 T(CTTT) 2 T(CTTT) 3 Tri5513F Tri6230 (CAA) 8 (CCT) 5 (CTT) 2 (CCT) 2 CACGAG CTGA (AG) 2 G (TGG) 3 F: AGCCACCTTGGCTACGATGC R: TCGGGACTGAAGACACAAATGAAGTTT F: TGTCAAACGAGTCACCTGTCCGA R: ACAGAGAGGCTGCGAGCGAT F: GCTGGACTGCCTGTGTGGGC R: TGTTGGGGTCGTGTTGTGTGTGG F: TGCTGAACATGTCAGGCTGGTTGC R: TGCTGTGTGCACGGCAACTGA F: GTGCACCATCCCCAGCACCC R: AGGCGAGTCCTCCAGTGGGC F: GGTGTTTGAAGCTGGGTTGGGAGG R: GCCATGCTGGCTACTGCTGCT

86 TABLE 4. 2 Cross-species amplification results (size-range/number of alleles per locus) for six microsatellite loci in Lake Tana Labeobarbus species, L. gananensis, and Varicorhinus beso. The numbers in the last column show the total number of alleles for all loci in each species. Locus Species Di 870 Tetra 2477 Di 4111 Tetra 5057 Tri 5513 Tetra6230 # of alleles L. acutirostris / / / /4 181/ /3 21 L. brevicephalus / / / /7 181/ /5 22 L. crassibarbus / / / /2 181/ /5 20 L. gogoriensis / / / / / /3 24 L. gorguari / / / / / /4 28 L. longismus / / / /6 181/ /3 21 L. macrophthalmus / / / / / /4 24 L. megastoma / / / / / /3 22 L. nedgia / / / /5 181/ /5 24 L. platydorsus / / / / / /5 24 L. surkis / / / /6 181/ /5 27 L. truttiformis / / / /5 181/ /4 22 L. tsanensis / / / /7 181/ /4 24 L. gananensis / / / / / /3 20 V. beso / / / / / /

87 CHAPTER 5 NUCLEAR MICROSATELLITE AND MITOCHONDRIAL DNA MARKERS REV EXTREMELY LOW GENETIC DIFFERENTIATION IN LAKE TANA (ETHIOP LABEOABARBUS (CYPRINIDAE) ABSTRACT Mitochondrial cytochrome oxidase I and cytochrome b gene sequences and 10 nucle microsatellite markers were analyzed to investigate evolutionary relationships and populatio structure in the Labeobarbus of Lake Tana. Phylogenetic analysis employing maximum parsimony, maximum likelihood, and Bayesian methods rejected the monophyly of Lake Ta Labeobarbus species flock. All Lake Tana Labeobarbus were recovered nested in a clade containing L. intermedius from drainages throughout Ethiopia. Bayesian STRUCTURE ana of microsatellite data identified two population groups: one corresponding to Lake Tana dra (including Labeobarbus intermedius) and the other to L. intermedius (outside of Lake Tana Varicorhinus besso. Morphotypes were not differentiated in Lake Tana suggesting ongoin gene flow between them. There was not any unique or distinct group corresponding to hypothesized ecological subdivisions. These results may be attributed to an extremely recen radiation or poor signal in molecular markers examined in this study. Additional studies employing genome-wide analysis and molecular markers applicable to fine-scale resolution be needed to investigate relationships and population differentiation in Lake Tana Labeobar 72

88 INTRODUCTION The large African barbs (Cyprinidae) are part of a distinct evolutionary lineage of hexaploid minnows distributed widely throughout Africa (Chapter 2; Berrebi, 1995; Machordom and Doadrio, 2001; Tsigenopoulos et al., 2002; Tsigenopoulos et al., 2010). Historically, African large barbine minnows were classified as Barbus, a large non-monophyletic genus (Doadrio and Machordom, 2001; Tsigenopoulos et al., 2002). Based on their hexaploid karyotype (Golubstov and Krysanov, 1993, Güegan et al., 1996; Krysanov and Golubstov, 1996; Ollerman and Skelton, 1990) and recent phylogenetic results demonstrating the non-monophyly of Barbus s.l. (Doadrio and Machordom, 2001) these large hexaplopid minnows were reclassified as Labeobabrus (Skelton, 2001; Skelton 2002). Included within this recently elevated genus is the Labeobarbus species flock of Lake Tana, the only known extant species flock among cyprinids (De Graaf et al., 2008, De Graaf et al., 2010). The Labeobarbus species flock of Lake Tana has been the subject of studies examining morphological diversity (Nagelkerke et al., 1994, 1995; Nagelkerke and Sibbing, 2000), karyology (Golubstov and Krysanov, 1993), Krysanov and Golubstov, 1996), reproduction (Alekseyev et al., 1996; Mina et al., 19996; Nagelkerke and Sibbing, 1997, Degraaf et al, 2005; Dzerzhenskii et al., 2007; Palstra et al., 2004), ecology (De Graaf et al., 2008) and genetics (Dixon et al., 1996, Berrebi and Valiushok, 1998; Kruiswijk et al., 2005; De Graaf et al., 2010). Studies examining phenotypic variation within this species flock concluded that at least 15 distinct morphotypes exist within Lake Tana (Nagelkerke et al., 1994, 1995). Subsequently, these morphotypes were recognized as distinct species (Sibbing and Nagelkerke, 2000). Recent examinations of mitochondrial DNA variation, however, have not supported either the 73

89 monophyly of the species flock or recognition of these putative species as independent evolutionary lineages (De Graaf et al., 2010; Chapters 2 and 3). De Graaf et. al. (2008) proposed an ecological model of sequential radiation and speciation in the evolution of Lake Tana Labeobarbus based on observations of trophic and reproductive ecology. The model predicts that the radiation of Lake Tana s Labeobarbus might have occurred through a two-stage process involving a sequence of habitat divergence followed by trophic diversification. This model differs from the three-stage model (i.e., habitat divergence, trophic specialization, and sexual selection) of sequential evolution suggested for the radiation of East African Cichlidae (Streelman and Danley, 2003) in the absence of sexual selection, which is believed to be a driving force for reproductive isolation of sympatric species and which is not a well-documented characteristic among the Cyprinidae. Among morphotypes of Lake Tana Labeobarbus macro-spatial (e.g. lacustrine vs riverine) and size-assortative mating were implicated as important limitations to gene flow (De Graaf et al., 2008). Other studies suggest that segregation is incomplete, however, and cannot ensure reproductive isolation among the morphotypes (Alekseyev et al., 1996; Dzerzhinskii et al., 2007). These contradictory observations raise questions on the validity of the species hypothesized by Nagelkerke and Sibbing (2000). According to the evolutionary scenario hypothesized by De Graff et al. (2008) the Labeobarbus of Lake Tana constitute two distinct ecological clades: a lacustrine spawning inshore clade (L. nedgia, L. crassibarbus, L. dainelli, L. gorguari, L. longismus, L. surkis, L. gorgoriensis, L. itermedius) and a riverine spawning offshore clade (L. tsanensis, L. truttiformis, L. megastoma, L. acrophthalmous, L. brevicephalous, L. platydorsus, L. acutirostris). In this evolutionary model piscivory is hypothesized to have evolved independently within the two 74

90 clades (L. dainellii, L. gorguari, L. longismus, inshore clade; L. truttiformis, L. macrophtalmus, L. megastoma, offshore clade). However, these hypothesized clades have not been assessed in a phylogenetic framework. Previous molecular studies on Lake Tana Labeobarbus have generally failed to support both hypothesized species (Nagelkerke et al., 1996; Nagelkerke and Sibbing, 2000) and trophic/ecological lineages (De Graaf et al., 2008) of Labeobarbus in Lake Tana due to low phylogenetic signal in the markers examined. The earliest of these studies suggested some degree of partitioning of the class II MHC alleles (Dixon et al., 1996) and differences in allozyme allele frequencies were noted (Berrebi and Valiushock, 1998) among some of the hypothesized Labeobarbus species or morphotypes. However, genetic divergence among these morphotypes was weak with both allozyme and MHC markers. Results from a recent mtdna study have also shown low levels of genetic variation among the Lake Tana large barbs (De Graff et al., 2010). During the last twenty years, the Labeobarbus species flock of Lake Tana has been impacted by commercial gillnet fisheries targeting spawning aggregations (De Graaf et al., 2004). In recent years some of the Lake Tana Labeobarbus populations have been listed by the IUCN either as threatened or endangered (Snoeks et al., 2011) highlighting the importance of identifying stocks at risk and implementing effective conservation plans. In addition, the Lake Tana Labeobarbus are ideal model systems for evolutionary studies, especially those involving the early stages of speciation. Thus far, it has been difficult to analyze the diversification of these morphotypes into a well-defined evolutionary framework mainly due to the lack of information on their phylogeny and population structure. Resolving the phylogeny and population structure of Lake Tana Labeobarbus is fundamental to undestanding their taxonomy and diversification so as to inform conservation efforts aimed at preserving their diversity and evolutionary legacy. In 75

91 this chapter variation in mitochondrial Cytochrome oxidase I (COI) and cytochrome b (cyt b) gene sequences and nuclear microsatellite DNA loci were analyzed to resolve the phylogeny and population differentiation among morphotypes and ecological groups of Lake Tana s Labeobarbus species flock. The goal was to test the validity of historically hypothesized species (Nagelkerke and Sibbing, 2000) and population subdivisions (habitat groups, trophic groups, and spawning groups; Graaf et al., 2008) of Lake Tana Labeobarbus. MATERIALS AND METHODS TAXON SAMPLING A total of 121 fish representing 14 putative Labeobarbus species (plus L. intermedius) and Varicorhinus besso were collected using gillnets from four sites (Fig. 5. 1) in the Southern part of Lake Tana (Bahir Dar, Ethiopia) in spring The putative species were identified based on Nagelkerke and Sibbing (1997, 2000). The number of samples per species varied between three and twelve. For each fish, muscle tissues were obtained in the field and preserved in 95% ethanol. To put the work in a broader geographic context tissue samples from 22 L. intermedius collected from other drainages in Ethiopia and four Labeobarbus gananensis and one Varicorhinus jubae from Genale River were included. After tissue collection carcasses of fish were preserved in formalin. Both carcasses and corresponding tissue samples were catalogued into The University of Alabama Ichthyological Collection (UAIC). Sampling was further supplemented with 11 tissue samples of L. intermedius provided by Kansas University Fish Collection. Total genomic DNA was isolated from ethanol preserved tissues using either (i) the DNeasy Tissue Kit (Qiagen) following the instructions of the supplier or (ii) standard phenol/chloroform extraction protocol. Table 1 lists specimens and haplotypes, collection 76

92 voucher, catalogue number, and GenBank accession numbers for samples examined in the present study. MITOCHONDRIAL DNA SEQUENCING Complete cyt b (1141 bp) and partial COI (651 bp) gene sequences were amplified via the Polymerase Chain Reaction (PCR). For cyt b, primers developed by Briolay et al. (1998) i.e. L15267 (5 -AATGACTTGAAGAACCACCGT-3 ), H16461 (5 -CTTCGGATTACAAGACC- 3 ) and H15891 (5 -GTTTGATCCCGTTTCGTGTA-3 ) were used where as for COI, Fish-F 1 (5 -TTCTCAACTAACCAYAAAGAYATYGG-3 ) and Fish-R 1 (5 - TAGACTTCTGGGTGGCCRAARAAYCA-3 ) (Ward et al., 2005) were employed. PCR reaction mixes were prepared in 25 µl volumes with 1 µl DNA template (30-50ng/µL), 2mM dntps, 5x Green Go Taq PCR buffer, 25mM MgCl 2, 10 µm each primer, and Go Taq Flexi DNA Polymerase (1 unit/ µl). Cyt b was amplified following the protocol of Briolay et al. (1998). For COI PCR thermocycling protocol employed an initial denaturation step at 94 C for 2 min, 35 amplification cycles at 94 C for 30 sec, 58 C for 30 sec and 68 C for 90 sec followed by a final five-minute extension step at 68 C. PCR products were prepared for sequencing using the polyethylene glycol (PEG) precipitation method. Purified PCR products were then amplified in the 5 and 3 directions with the ABI Prism Big Dye Terminator cycle sequencing package following the manufacturer s protocols. Sequences were generated on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems). For cyt b analysis, 81 sequences of Labeobarbus (56 Lake Tana Labeobarbus plus 25 L. intermedius sequences from other water bodies) were used. An additional 30 cyt b sequences 77

93 representing 15 other Labeobarbus species and species of Varicorhinus, two European tetraploid Barbus, four African tetraploid and three African diploid barb species retrieved from GenBank were analyzed. Three sequences of Labeo (L. cylindericus and L. forskalii) were used as outgroups. For COI 84 sequences (54 Lake Tana Labeobarbus plus 30 L. intermedius sequences from other water bodies) were analyzed. Additional 12 sequences (four L. gananensis; L. johnstoni; Cyprinus carpio (outgroup); three V. besso; one V. jubae) were also included. Sequences were aligned manually employing the computer software BIOEDIT version (Hall, 1999). GenBank accession numbers for samples used in COI and cyt b analysis are given in Table 1. PHYLOGENETIC ANALYSIS Unique haplotypes, haplotype and nucleotide diversities were determined in DNASP software version 4.5 (Rozas et al., 2003). Phylogenies were estimated under Maximum Parsimony, Maximum Likelihood and Bayesian Inference criteria using COI and cyt b datasets separately. MP analysis employed full heuristic search option with 500 random addition sequence replicates, and tree-bisection reconnection (TBR). Support for branches were assessed based on bootstrap values calculated in PAUP* (Swofford, 2002) using heuristic search option, 500 stepwise addition replicates and TBR. Phylogenetic trees based on ML and Bayesian approaches were estimated online employing RAxML provided by The CIPRES Science Gateway and MrBayes version (Ronquist nad Huelsenbeck, 2003), respectively. RAxML rapid bootstrapping (Stamatkias et al., 2008) with 500 replicates was performed to assess support for branches based on GTR model. The same model (i.e. GTR model) was used for Bayesian analysis employing MCMC for 10, 000, 000 generations and sampling trees every 1,

94 generations with 25% of sampled values discarded as burnin. Posterior probabilities (the percentage of samples recovering any particular clade) were used to assess support for recovered clades. COI and cyt b haplotype parsimony networks were constructed in TCS (Clement et al., 2005) employing statistical parsimony, a genetic algorithm introduced by Templeton et al. (1992). The method estimates cladograms from nucleotide sequence data and calculates a set of alternative confidence values associated with the cladograms. Maximum numbers of mutational steps that make parsimonious connections between haplotype sequences were calculated with 95% confidence. MICROSATELLITE GENOTYPING Genotype data (based on ten microsatellite loci) were obtained from a total of 159 fish (116 Lake Tana Labeobarbus and 45 L. intermedius individuals from other drainages in Ethiopia) for population analyses. For six of the microsatellite loci (Di870, Di 4111, Tri5513, Tri6230, Tetra2477, and Tetra5057), primers were designed based on L. intermedius genomic library developed in Chapter 4. The remaining four loci (Barb37, Barb59, Barb62, and Barb79) were from Chenuil et al. (1997). Loci were amplified individually in 25µL reaction volumes containing ng/µl DNA template, forward (flourescent labled) and reverse primers (2.5µM each), 5x Green Promega buffer, MgCl 2 (25 mm), 2 mm dntps, Polymerase Taq (1 unit/µl). PCR amplifications were carried out on an ABI 310 Genetic Analyzer (Applied Biosystems) under the following condition; initial denaturation at 94 C for two minutes, 30 cycles at 91 C for 35 sec, C for 35 sec, and 72 C for 45 sec followed by a final extension step at 72 C for 5 min. 79

95 Microsatellite PCR products were mixed with 9µL HiDi formamide and 0.5µL GeneScan-500 TAMRA size standard and run on an ABI 310 Genetic Analyzer (Applied Biosystems). Allele sizes were scored against the size standard employing GENE SCAN Analysis Soft ware (Applied Biosystems). Prior to downstream analysis the excel-based FLEXIBIN program version 2.0 (Amos et al., 2007) was used for binning allele. GENETIC DIVERSITY AND POPULATION STRUCTURE To create and organize hexaploid microsatellite genotype data for downsream analysis the R package POLYSAT (Clark and Jasieniuk, 2011) was employed. Genetic differentiation was assessed with STRUCTURE version (Pritchard et al., 2000), which employs a bayesian clustering algorithm to assign genotypes to clusters without any prior information on sampling localities. STRUCTURE was run under the admixture ancestry model with allele frequencies correlated among populations (Falush et al. 2003). In STRUCTURE three different analyses were carried out: the first assessed the overall genetic differentiation using all samples while the two subsequent analyses investigated fine scale structuring within inferred first order genetic clusters using subsamples. At each K value (1-16 for the first analysis; 1-15 and 1-3 for subsequent analyses), ten independent iterations each involving 30,000 burnin and 300,000 post burn-in cycles were run. STRUCTURE HARVESTER v0.6.8 ( was used to summarize/combine STRUCTURE results. Log likelihood scores and ΔK (Evanno et al., 2005) values were assessed to select the best model/k-value for the dataset. DISTRUCT (Rosenberg, 2004) was used to generate graphical figures of population structure. 80

96 For each locus Nei s genetic diversity indices were estimated (the number of alleles, observed heterozygocity H O, total heterozygocity H t, and inbreeding coefficient G IS ) within the Labeobarbus of Lake Tana employing GENODIVE version 2.0b22 (Meriams and Tienderen, 2004). Conformity to Hardy-Weinberg expectations was evaluated using Wright s F IS. Because genetic differentiation was not demonstrated in the Lake Tana Labeobarbus, AMOVA and significance tests of F ST were not carried out to compare the morphotypes. RESULTS GENETIC VARIATION Under the parsimony criterion the COI dataset contained 627 constant and 24 (3.7%) variable characters out of the total 651 characters with only 10 (1.5%) being potentially parsimony-informative. Of the 1141 characters of cyt b, 1072 characters were constant and 69 (6%) variable, with 29 (2.54%) of the later being parsimony informative. Within the L. intermedius lineage there were 24 COI and 43 cyt b unique haplotypes. Haplotype diversity was high for both COI (H d = 1.0) and cyt b ((H d = 1.0) whereas there was low nucleotide diversity for both genes (COI = ; cyt b = ). The Lake Tana Labeobarbus were represented by nine COI and 27 cyt b haplotypes indicating a relatively lower degree of variation within the COI gene. Two COI haplotypes (haplotypes 1 and 2) were found in 46 of 53 Lake Tana Labeobarbus specimens (87%). Haplotype 1 was the most common haplotype and contained 37 individuals (including three L. intermedius individuals originating from the Abay and Gumara Rivers). Four Lake Tana Labeobarbus individuals were represented by unique haplotypes. The total allele count ranged from 5 (locus Barb79) to 36 (locus Di870) and average number of alleles was 17.6 per locus. Five microsatellite loci (Di870, Di4111, Tri6230, 81

97 Tetra5057, Barb59) had highest heterozygosity (H O = ; Table 5. 2) whereas hetrozygosity was relatively low in loci Tri5513 (H O =0.41) and Barb 37 (H O =0.6). Significant departures from Hardy Weinberg expectations were observed for all loci. All Wright s F IS values were significantly negative (p = 0.001) indicating that deviations were due to excess of heterozygote genotypes (Table 5. 2). PHYLOGENETIC ANALYSIS Phylogenies resulting from all phylogenetic methods (including statistical Parsimony) employing both COI and cyt b datasets were congruent. The morphotypes (putative species) of Labeobarbus in Lake Tana were recovered as part of a larger lineage that included L. intermedius originating from the Blue Nile drainage (Lake Tana, Abay, Gumara and Dedessa Rivers) as well as other independent basins throughout Ethiopia. This clade further split into two distinct sub-clades (Figs. 5.2 and 5.3) with the Lake Tana populations falling exclusively within the northern sub-clade. The COI phylogeny recovered one sub-clade comprising haplotypes originating from the Southern Rift Valley and the Omo-Gibe drainage and the remaining haplotypes (including those from Lake Tana) in polytomies. In both COI and cyt b datasets evolutionary relationships among the Labeobarbus morphotypes of Lake Tana were unresolved. When groupings occur, as in cyt b phylogeny, they do not correspond with previous hypothesis of morphological species (Nagelkerke et al., 1994, 1995) or the spatial, trophic and breeding groups suggested by Graaf et al. (2007). In the haplotype network (Fig 5. 3B) there were 11 mutational steps between the most distant haplotypes, while only three steps between the most closely related haplotypes of the two clusters. 82

98 Phylogenetic analysis of COI and cyt b datasets yielded a strongly supported monophyletic V. beso (100% bootstrap and Posterior Probability). Both data sets suggested a non-sister relationship between V. beso and the L. intermedius lineages. Total number of nucleotide substitution between Lake Tana Labeobarbus and V. besso populations at COI and Cyt b loci were 37.2 (5.7%) and 69.9 (6.1%), respectively. POPULATION DIFFERENTIATION For microsatellite DNA dataset STRUCTURE generated distribution of estimated likelihood values of K showed that the values did not level off as K increased and therefore, did not allow selection of the best model. However, the distribution based on alpha-k showed a very high peak at K=2 suggesting the existence of two genetically distinct groups. Individual assignment probabilities grouped all Labeobarbus individuals from Lake Tana, Abay and Gumara Rivers in cluster 1 whereas L. intermedius of other drainages and V. beso fall within cluster 2. The probability of assignment of predefined populations (i.e. morphotypes) to clusters 1 and 2 ranged from 71-98% and 66-97%, respectively. Only 17 of 156 individuals (10.9%) examined could not be assigned with confidence (probability of assignment < 75%) to any of the two clusters identified. The two clusters showed some degree of genetic admixture, which is indicative of mixed ancestry. No clusters grouping individuals of any of the morphotypes were detected. Subsequent Bayesian clustering analysis of all samples originating from the Lake Tana basin (K=2 and K=6) revealed no differentiation among hypothesized species or ecological groups (Figs. 5. 4B and 5. 4C). The distribution of samples of different species and ecological groups in the two clusters recovered based on analysis of 10 microsatellite loci is presented in 83

99 Table There was, however, clear genetic differentiation between L. intermedius and V. besso (Fig. 5.4D) within cluster 2. The groupings of the microsatellite DNA based Labeobarbus clusters and recovered mtdna lineages were not concordant. In the mtdna dataset L. intermedius samples from the Dedessa and Awash Rivers and Central Rift Valley drainage (Lakes Awassa and Langano) grouped with samples from the Lake Tana drainage, whereas in the microsatellite dataset they clustered with samples from the Southern Rift Valley and Omo-Gibe River drainages. For major Rivers and Lakes in Ethiopia refer Fig DISCUSSION PHYLOGENETIC RELATIONSHIPS AND POPULATION STRUCTURE Phylogenetic methods consistently rejected the monophly of Lake Tana Labeobarbus and recovered all haplotypes originating from the Lake as part of a larger clade that included L. intermedius haplotypes from drainages throughout Ethiopia. Data from cyt b and COI identified two distinct sub-clades (northern and southern) within this L. intermedius clade and placed the Lake Tana populations within the northern sub-clade. These results are in agreement with previous findings of a broadly based phylogeographic analysis of L. intermedius using mtdna (Chapter 3). The clustering pattern observed in the microsatellite data (Figures 4B and C) seem to be driven by the presence or absence of private alleles in some samples rather than shared alleles. All detected private alleles were shared among individuals of different species and ecological groups. None of them were diagnostic of a species, spawning, habitat, or trophic group, suggesting either the present data set does not provide support for previously hypothesized 84

100 species (Nagelkerke and Sibbing, 2000) or speciation scenario proposed by De Graaf et al. (2008), or there is insufficient signal in this data to detect a recent, or ongoing speciation event. Lake Tana shares some mitochondrial DNA haplotypes (COI haplotypes 1 and 2, cyt b haplotypes 4 and 6) with the Abay and Gumara Rivers (both currently connected to Lake Tana). None of the haplotypes occurring external to the Lake Tana basin were found in Lake Tana. Microsatellite DNA variation also supports this pattern. The geographic distribution of the microstellite DNA clusters and mtdna clades were not concordant. The main discordance was associated with the placement of populations originating from Dedessa (part of the lower Abay River drainage) and Awash Rivers and Central Rift Valley lakes. Microsatellite DNA data clustered these populations with those obtained from Southern Rift Valley and Omo-Gibe basins, as well as V. beso. In contrast, the mitochondrial DNA phylogeny grouped these specimens with the Lake Tana drainage populations. The observed discrepancy between mitochondrial and nuclear markers with respect to our interpretations of contemporary genetic structure of Labeobarbus may be attributed to differences in their responses to historic demographic and evolutionary processes. Banister (1973) synonymized previously recognized species of Labeobarbus from Lake Tana with other East African large barbine minnows into L. intermedius. Nagelkerke and Sibbing (2000) recovered fourteen distinct species of Labeobarbus in Lake Tana based on analysis of morphological characters. However, both hypotheses of species were not derived from explicit genetic analyses. The earliest publication suggesting genetic isolation among the Labeobarbus morphotypes of Lake Tana was based on the analysis of Major Histocompatibility Complex genes (Dixon et al., 1996). Later based on Dimick s unpublished microsatellite data (i.e. from a personal communication) De Graaf et al. (2000) asserted that the morphotypes did 85

101 not constitute a single interbreeding population and that some were genetically distinct from others. Contrary to these conclusions, the salient feature of the present cyt b and COI data was that haplotypes were extensively shared among the morphotypes. In addition, microsatellite DNA variation did not indicate genetic differentiation among the morphotypes of Labeobarbus in Lake Tana. These results are consistent with previous findings from mtdna survey (De Graaf et al., 2010) and are indicative of either an ongoing gene flow or lack of signal in both mitochondrial (COI and cyt b) and microsatellite DNA markers. Labeobarbus morphotypes have been shown to breed with each other successfully in laboratory conditions producing offspring that are as viable as those produced by parents belonging to the same morphotype (Dzerzhinskii, et al., 2007, Degebuadze et al., 1999) and putative hybrids among morphotypes in Lake Tana also have been reported (Alekseyev et al., 1996; Dzerzhinskii, et al., 2007). Although representatives of 14 of 15 Labeobarbus morphotypes (except L. danielli) were included in this analysis, caution is taken not to make taxonomic recommendations because sampling in the present study encompassed a limited number of individuals for some morphotypes and markers used covered a small portion of the Labeobarbus genome. Hopefully future studies investigating genetic differentiation in Lake Tana Labeobarbus will employ genome-wide analysis using larger sample sizes and molecular markers more applicable to fine scale resolution among individuals or populations (eg. Single nucleotide polymorphisms; Salzburger and Meyer, 2004). EVOLUTIONARY DIVERSIFICATION OF LABEOBARBUS IN LAKE TANA The age of Lake Tana is estimated as ranging from the Late Pliocene (Dixon et al., 1996) to Early Pleistocene (Mohr, 1966). If diversification of Labeobarbus in Lake Tana began following the formation of the lake, then such long history of isolation should have generated 86

102 observable genetic differentiation among the hypothesized species (Nagelkerke and Sibbing, 2000). Similar cladogenetic events that occurred during this time range were responsible for generating several extant species within European Leuciscine cyprinids (Zardoya and Doadrio, 1999). In Lake Tana Labeobarbus the observed shallow genetic divergences between haplotypes ( %, Chapter 3), shared haplotypes among the putative species and absence of speciesspecific alleles suggest recent evolution of the multiple phenotypes within the lake. Divergence date estimation using BEAST placed initial diversification within the northern L. intermedius lineage (comprising the Lake Tana Labeobarbus) at 300,000 MYA (Chapter 2). Additional diversification within the Lake Tana Labeobarbus probably took place following the desiccation of Lake Tana 12,000-25,000 years ago, as suggested by several authors (Berrebi, 1998; Graaf et al., 2007; Graaf et al., 2008). The lack of genetic differentiation revealed herein supports a relatively recent Labeobarbus radiation while the discrepancy between morphological and molecular divergence is evidence that selection can drive morphological change at a rate faster than drift at neutral loci. Similar patterns of divergences have been reported in African cichlids (Meyer et al., 1990; Kocher et al., 1993; Moran et al., 1994; Nagl et al., 2000; Verheyen et al., 2003). The cichlids of African lakes (e.g., Lake Victoria) have long been the subjects of several surveys including molecular studies (Salzburger and Meyer, 2004) and hence can provide an evolutionary framework in which to compare the adaptive radiation of Lake Tana Labeobarbus. According to Greenwood (1984) and Sturmbauer (1998) the age of lakes correlates with species numbers and complexity of their species flocks. For instance, the cichlid species flock in the much older Lake Tanganyka (9-12 million years old; Cohen et al., 1993) exhibit much higher levels of diversity compared to the species flock of the much younger Lake Victoria, which is 12, 87

103 400 (Johnson et al., 1996) to 200, 000 (Meyer et al., 1990) years old. In Lake Victoria, which experienced a desiccation event between 18, ,000 years ago (Elmer et al., 2009, Johnson et al., 1996), the cichlids have evolved remarkable morphological, ecological and sexual diversity comprising over 300 described species (Johnson et al., 1996). Adaptive radiations are believed to been driven by intrinsic factors (i.e., potential for behavioral innovation and communication and favorable genetic combinations) of organisms and extrinsic physical factors (Sturmbauer, 1998). Extrinsic factors provide the opportunity and intrinsic factors the potential for radiation. According to Sturmbauer (1998) different groups of organisms would be affected differently by the same set of environmental conditions (e.g., habitats) because it is the intrinsic biological characteristics that will decide ultimately to what extent each group will be affected by the environment. Likewise, differences in the levels of trophic specializations, species and genetic diversity between Lake Victoria cichlids and Labeobarbus of Lake Tana might be, in part, the outcome of differences in their potential for diversification. One interesting issue related to Lake Tana is that whereas the Labeobarbus cyprinids had enough time to evolve fifteen well-differentiated morphotypes (Nagelkerke et al., 1994; Nagelkerke and Sibbing, 2000), a population of the widely distributed African cichlid, Oreochromis niloticus L., occurring in Lake Tana has not undergone such diversification. In contrast, its congeners in Lake Victoria have undergone remarkable radiations (Johnson et al., 1996). This difference is likely to be due to the smaller size and depth (e.g., maximum depth = 14 meters) of Lake Tana, which in turn has limited room for spatial segregation and adaptive radiation. In addition, available niches are occupied by the different forms of Labeobarbus and other species such as V. beso further limiting the opportunity for the diversification of O. 88

104 niloticus. The Lake Tana Labeobarbus are hypothesized to have undergone adaptive radiation via the general model of vertebrate evolutionary radiation (De Graaf et al., 2008) proposed by Streelman and Danley (2003). According to this model of vertebrate evolution groups diverge along three lines: habitat, food, and communication (usually in that order), the first two being driven by ecological selection while communication is driven by sexual selection. This model of sequential radiation seems to apply, with little modification, to the adaptive radiation of cichlids in African Lakes (Nagl et al., 2000; Danley and Kocher 2001; Sturmbauer 1998). In contrast, according to De Graaf et al. (2008), the adaptive radiation of Lake Tana s Labeobarbs might have occurred through a two-stage process involving habitat radiation followed by trophic specialization. However, results herein do not support this model of sequential diversification (habitat followed by trophic specialization) in Lake Tanan Labeobarbus. If the molecular analysis herein supports hypothesized ecological groups (De Graaf et al., 2008), then we would expect the analysis to recovere clades (cyt b and COI) or clusters (microsatellite DNA) corresponding to these groups. The results herein probably suggest an early stage of an ongoing adaptive radiation in Lake Tana Labeobarbus or lack of signal in molecular markers examined. THE STATUS OF VARICORHINUS BESO According to the findings of the present study (Figs. 2 and 3A) populations of Varicorhinus beso originating from Lake Tana and Dedessa River constituted a strongly supported clade (MP and ML bootstrap support = 100%). The close phylogenetic affinity between these two populations suggests that the Lake Tana V. beso are more closely related to their allopatric congeners than they are to their sympatric counterparts, the Labeobarbus of Lake 89

105 Tana. This in turn suggests that the timing of isolation of V. beso from Lake Tana Labeobarbus long predates the formation of the Blue Nile Falls, which isolates Lake Tana from the lower Blue Nile drainage including Dedessa River. The formation of the Blue Nile falls is estimated to be around 10,000 years ago (Grabham and Black, 1925) whereas the estimated tmrca of the V. beso lineage is 174,000 years ago (95% HPD = 3.2E ; Chapter 2). On the other hand, V. jubae originating from Genale River in Southeastern Ethiopia is more closely related to its sympatric species, L. gananensis, than it is to V. beso. Earlier Mina et al. (2001) questioned why V. jubae was taxonomically separated from V. beso because characters discriminating it from V. beso were not indicated in Banister s (1984) original description. The phylogenetic distinctness of V. beso from V. jubae revealed in the present study suggests that the two species may have independent origins thereby supporting their taxonomic separation. However, the question of whether the two species belong to a common genus (i.e., Varicorhinus ) still needs further clarification. Varicorhinus has been previously characterized as a polyphyletic assemblage rather than a monophyletic taxon (Tweddle and Skelton, 1998; Chapter 2). REFERENCES Alekseyev, S. S., Dgebuadze, Yu. Yu., Mina, M. V. and Mironovsky, A. N. (1996). Small large barbs spawning in tributaries of Lake Tana: what are they? Folia Zoologica 45 (Suppl. 1), Amos, W., Hoffman, J. I., Frodsham, A., Zhang, L., Best, S. and Hill, A. V. S. (2007). Automated binning of microsatellite alleles: problems and solutions. Molecular Ecology Notes 7, Banister, K. E. (1973). A revision of the large Barbus (pisces: Cyprinidae) of East and Central Africa. Studies on African Cyprinidae Part II. Bulletin of the British Museum of Natural History (Zoology) 26, Banister, K. E. (1984). Three new species of Varicorhinus (Pisces, Cyprinidae) from Africa. Bulletin of the British Natural History (Zoology) 47(5),

106 Berrebi, P. (1998). Genetic Divergence among morphotypes of Lake Tana (Ethiopia) barbs. Biological Journal of the Linnean Society 64, Berrebi, P. and Valiushok, D. (1998) Genetic divergence among morphotypes of Lake Tana (Ethiopia) barbs. Biological Journal of Linnean Society 64, Binni, G. (1940). I Pesci de lago Tana. Missione di Studio al Lago Tana 3 (2), Boulengar, G. A. (1902). Descriptions of new fishes from the collection made by Mr. E. Degen in Abyssinia. Annals and Magazine of Natural History 10 (7), Boulenger, G. A. (1907). Zoology of Egypt: the fishes of the Nile: H. Rees, London. Boulenger, G. A. (1911). Freshwater Fishes of Africa. Vol. II: British Museum (Natural History), London. Briolay, J., Galtier, N., Britto, R. M. and Bouvet, Y. (1998). Molecular phylogeny of Cyprinidae: Inferred from cytochrome b DNA sequences. Molecular phylogenetics and Evolution 9, Chenuil, A., Desmarias E., Pouyaud, L., and Berrebi, P. (1997). Does polyploidy lead to fewer and shorter microsatellites in Barbus (Teleostei: Cyprinidae)? Molecular Ecology 6, Clark, L. V. and Jasieniuk, M. (2011). POLYSAT: an R package for polyploid microsatellite analysis. Molecular Ecology Resources 11, Clement, M., Derington, J., Woolley, S., and Posada, D. (2005). TCS pp. Cohen, A. S., Soregham, M. J., and Scholz, C. A. (1993). Estimating the age of formation of lakes: an example from Lake Tanganyka, East African Rift systema. Geology 21, Danley, P. D., and Kocher, T. D. (2001). Speciation in rapidly diverging systems: lessons from Lake Malawi. Molecular Ecology 10, , doi: /j x x. Degebuadze, YU. YU. (1999). Observations on reproduction of Lake Tana barbs. Journal of Fish Biology 54, De Graf, M., Michiels, M., Wudineh, T., and Sibbing, F. A. (2003). Length at maturity and gillnet selectivity of Lake Tana Labeobarbus species (Ethiopia): implications for management and conservation. Aquatic Ecosystem Health Management 6(3), Doi: /S (03)

107 De Graaf, M., Nentwich, E. D., Osse, J. W. M. and Sibbing, F. A. (2005). Lacustrine spawning, a new reproductive strategy among large African cyprinid fishes? Journal of Fish Biology 66, , Doi: /J X. De Graaf, M., Dejen, E., Osse, W. J. M., and Sibbing, F. A. (2008). Adaptive radiation of Lake Tana s Labeobarbus species flock (Pisces, Cyprinidae). Marine Fresh water Resources 59, De Graaf, M., Megens, H. J., Samallo, J., and Sibbing, F. A. (2010). Preliminary insight into the age and origin of the Labeobarbus species flock from Lake Tana (Ethiopia) using the mtdna cytochrome b gene. Molecular phylogenetics and evolution 55, Dixon, B., Nagelkerke, L. A. J., Sibbing, F. A., Egberts, E., and Stet, R. J. M. (1996). Evolution of MHC class II βchain-encoding genes in the Lake Tana barbel species flock (Barbus intermedius complex). Immunogenetics 44, Doadrio, I., Carmona, J. A., and Machordom, A. (2002). Haplotype Diversity and Phylogenetic Relationships Among the Iberian Barbels (Barbus, Cyprinidae) Reveal Two Evolutionary Lineages. Journal of Heredity 93(2), Dzerzhinskii, F. N., Shkil, F. N., Abdissa, B., Zelalem, W., and Mina, M. V. (2007). Spawning of Large Barbus (Barbus intermedins Complex) in a Small River of the Lake Tana Basin (Ethiopia) and Relationships of Some Putative Species. Journal of Ichthyology 47, Elmer, K. R., Reggio, C., Wirth, T., Verheyen, E., Salzburger, W. and Meyer, A. (2009). Pleistocene desiccation in East Africa bottlenecked but did not extirpate the adaptive radiation of Lake Victoria haplochromine cichlid fishes. Proceedings of the National Academy of Sciences USA, 106, Evano, G., Regnaut, S., and Goudet, J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Molecular Ecology 14, Falush, D., Stephens, M., and PritcharD, J. K. (2003). Inference of population structure using multilocus geneotype data: linked loci and correlated allele frequencies. Genetics 164, Golubstov, A. S. and Krysanov, E. Y. (1993). Karyological study of some cyprinid species from Ethiopia, The ploidy differences between large and small Barbus of Africa. Journal of Fish Biology 42, Grabham G. W. and Black, R. P. (1925) Report of the Mission to Lake Tana Government Press, Cairo. 92

108 Greenwood, P. H. (1984). The species flock of cichlid fishes in Lake Victoria and those of other African Great Lakes. Archiv fur Hydrobiologie, Beiheft, ergebnisse der Limnologie 44, Güegan, J. F., Rab, P., Machordom, A. and Doadrio, I. (1995). New evidence of hexaploidy in large African Barbus with some considerations on origin of hexaploidy. Journal of Fish Biology 47, Hall, T. A. (1999). BioEdit: A user friendly biological sequence alignment editor and analysis program for Wndows 95/98/NT Nucleic Acids Symposium Series 41, Johnson, T. C., Scholz, C. A., Talbot, M. R., Kelts, K., Ricketts, R. D., Ngobi, G. Beuning, K., Ssemmanda, I., and McGill, A. W. (1996). Late Pleistocene desiccation of Lake Victoria and rapid evolution of cichlid fishes. Science 273, Johnson, T. C., Kelts, K., and Odada, E. (2000). The Holocene history of Lake Victoria. Ambio 29, Kocher, T. D., Conroy, J. A., Mckaye, K. R., and Stauffer, J. R. (1993). Similar morphologies of cichlid fish in Lakes Tnaganyka and Malawi are due to convergence. Molecular Phylogenetics and evolution 2(2), Krysanov, E. Y., and Golubtsov, A. S. (1996). Karyotypes of some Ethiopian Barbus and Varicorhinus from the Nile basin including Lake Tana morphotypes. Folia Zoologica 45, Kruiswijk, C. P., Hermsen, T., Heerwaarden, J. V., Dixon, B., Savelkoul, H. F. J., and Stet, R. J. M. (2005). Major histocompatibility genes in Lake Tana African large barb species flock; evidence for complete partitioning of class II B, but not class I, genes among different species. Immunogenetics 56, Lamb, H. F., Bates, C. R., Coombes, P. V., Marshall, M. H., Umer, M., and Davies, S. J. (2007) Late Pleistocene desiccation of Lake Tana, source of the Blue Nile. Quaternary Science Reviews 26, , doi: /j.quascirev Machordom, A., and Doadrio, I. (2001). Evolutionary history and speciation modes in the cyprinid genus Barbus. Proceedings of the Royal Society of London (Biological Sciences) 268, Meriams, P. G. and Tienderen, P. H. V. (2004). GENOTYPE and GENODIVE : two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4,

109 Meyer, A., Kocher, T. D., Basasibwaki, P. and Wilson, A. C. (1990) Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature 347, Mina, M. V., Mironovsky, A. N., and Dgebuadze, Yu. Yu. (1996). Lake Tana large barbs: phenetics, growth and diversification. Journal of Fish Biology 48, Mina, M. V., Mironovsky, A. N., and Golani, D. (2001). Consequences and modes of morphological diversification of east African and Eurasian barbines (genera Barbus, varicorhinus and Capoeta) with particular reference to Barbus intermedius complex. Environmental Biology of Fishes 61, Mohr, P. (1966). The Geology of Ethiopia. University College Addis Ababa Press, Addis Ababa, Ethiopia, pp Moran, P., Kornfield, I., and Reinthal, P. N. (1994). Molecular systematics and radiation of haplochromine cichlids (Teleostei:Perciforms) of Lake Lake Malawi. Copeia Nagl, S., Tichy, H., Mayer, W., Takezaki, N., Takahata, N., and Klein, J. (2000). The origin and age of haplochromine fishes in Lake Victoria, East Africa. Proceedings of Royal Society of London (B) 267, Nagelkerk, L. A. J., Mina, M. V., Tesfaye, W., Sibbing, F. A., and Osse, J. W. M. (1995). In Lake Tana, a unique fish fauna needs protection. BioScience 45 (11), Nagelkerke, L. A. J. and Sibbing, F. A. (1997). A revision of the large barbs (Barbus spp., Cyprinidae, Teleostei) of Lake Tana, Ethiopia, with a description of seven new species. In: Nagelkerke, L. A. J. (ed), The barbs of Lake Tana, Ethiopia; morphological diversity and its implications for taxonomy, trophic resource partitioning, and fisheries. Doctoral Dissertation. Wageningen Agricultural University, Wageningen, Netherlands. Nagelkerke, L. A. J. and Sibbing, F. A. (1996). Reproductive segregation among the large barbs (Barbus intermedius complex) of Lake Tana, Ethiopia. An example of lacustrine speciation? Journal of Fish Biology 49, Nagelkerke, L.A.J. and F.A. Sibbing (1997). A revision of the large barbs (Barbus spp., Cyprinidae, Teleostei) of Lake Tana, Ethiopia, with a description of seven new species. In: Nagelkerke, L.A.J.: The barbs of Lake Tana, Ethiopia: morphological diversity and its implications for taxonomy, trophic resource partitioning, and fisheries: Ph.D. thesis, Experimental Animal Morphology and Cell Biology, Wageningen Agricultural University, Wageningen, The Netherlands. Nagelkerke, L. A. J. and Sibbing, F. A. (2000). The large barbs (Barbus spp., Cyprinidae, Teleostei) of Lake Tana (Ethiopia), with a description of a new species, Barbus osseensis. Netherlands Journal of Zoology 50,

110 Nagelkerke, L. A. J., Sibbing, F. A., Boogaart, J. G. M., Lammens, E. H. R. R. and Osse, J. W. M. (1994) The barbs (Barbus spp.) of Lake Tana: a forgotten species flock? Environmental Biology of Fishes 39, Nagelkerk, L. A. J., Sibbing, F. A. and Osse, J. W. M. (1995). Morphological divergence during growth in the large barbs (Barbus spp.) of Lake Tana, Ethiopia. Netherlands Journal of Zoology 45, Ollerman, L. K. and Skelton, P. H. (1990). Hexaploidy in yellowfish species (Barbus, Pisces, Cyprinidae) from southern Africa. Journal of Fish Biology 37, Palstra, A. P., De Graaf M. and Sibbing, F. A. (2004). Riverine spawning and reproductive segregation in a lacustrine cyprinid species flock, facilitated by homing? Animal Biology 54(4), Posada, D. and Crandall, K. A. (1998). Model test: testing model of DNA substitution. Bioinformatics 14, Pritchard, J. K., Stephens, M. and Donnely, P. (2000). Inference of population structure using multilocus genotype data. Genetics 155, Ronquist, F. and Huelsenbeck, J. P. (2003). Bayesian phylogenetic inference under mixed models. Bioinformatics 19, Rosenberg, N. A. (2004). DISTRUCT: a program for the graphical display of population structure. Molecular Ecology 4, Rozas, J., Sánchez-DelBarrio, J. C., Messeguer, X. and Rozas, R. (2003). DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19, Rüppell, W. P. E. S. (1836). Neuer Nachtrag von Beschreibungen und Abbildungen neuer Fische, im Nil entdeckt. Museum Senckenbergianum: Abhandlungen aus dem Gebiete der beschreibenden Naturgeschichte, van Mitgliedern der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt, Main Frankfort 2 (1):1-28. Salzburger, W. and Meyer, A. (2004). The species flock of east Africa cichlid fishes: recent advances in molecular phylogenetics and population genetics. Naturwissenschaften 91, , Doi: /s Sibbing, F. A., Nagelkerke, L. A. J., Ste, R. J. M. and Osse, J. W. M. (1998). Speciation of endemic Lake Tana barbs (Cyprinidae, Ethiopia) driven by trophic resource partitioning; a molecular and ecomorphological approach. Aquatic Ecology 32, Skelton, P. H. (2001). A complete guide to the Freshwater fishes of Southern Africa. Struik Publishers, Cape Town, South Africa.pp

111 Skelton, P. H. (2002). Changes to the Scientific and common names of Southern African freshwater fishes. African Journal of Aquatic science 27, Snoeks, J., Harrison, I. J. and Stiassny, M. L. J. (2011). The status and distribution of freshwater fishes. In: The Diversity of Life in African Freshwaters: Underwater, Under Threat. Edited by Willam Darwall, Kevin Smith, David Allen, Robert Holland, Ian Harrison, and Emma Brooks). Published by IUCN, Gland,. Switzerland and Cambridge, UK. Stamatakis, A., Hoover, P., and Rougemont, J. (2008). A Rapid Bootstrap Algorithm for the RAxML Web Servers. Systematic Biology 57(5), Streelman, J. T. and Danley, P. D. (2003). The stages of Vertebrate evolutionary radiation. Trends in Ecology and Evolution 18, Sturmbauer, C. (1998). Explosive speciation in cichlid fishes of the African Great Lakes: a dynamic model of adaptive radiation. Journal of Fish Biology 53(A), Swofford, D. L. (2002). PAUP* 4.0: phylogenetic analysis using parsimony (*and other methods). Beta version 4.0b4a. Sinauer Associates, Sunderland, MA. Templeton, A. R., Crandall, K. A. and Sing, C. F. (1992). A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA sequence data. III. Cladogram estimation. Genetics 132, Tsigenopoulos, C. S., Rab, P., Naran, D., and Barrebi, P. (2010) Multiple origins of polyploidy in the phylogeny of southern African barbs (Cyprinidae) as inferred from mtdna markers. Heredity 88, Tsigenopoulos, C. S., Kasapidis, P. and Berrebi, P. (2010). Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtdna data. Molecular Phylogenetics and Evolution 56(2), Twedle, D. and Skelton, P. H. (1998). Two new species of Varicorhinus (Teleostei: Cyprinidae) from the Ruo River, Malawi, Africa, with a review of other Southern African Varicorhinus species. Ichthyological Exploration of Freshwaters 8(4), Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R. and Hebert, P. D. N. (2005). DNA barcoding Australia s fish species. Philosophical Transactions of Royal Society 359, Verheyen, E., Salzburger, W., Snoeks, J., and Meyer, A. (2003). Origin of the superflock of cichlid fishes from Lake Victoria, East Africa. Science 300, Zardoya, R. and Doadrio, I. (1999). Molecular evidence on the evolutionary and biogeographical patterns of European Cyprinids. Journal of Molecular Evolution 49,

112 TABLE 5. 1 List of species and haplotypes and number of individuals of samples examined for mitochondrial COI and Cyt b and nuclear microsatellite analysis. COI and Cyt b haplotype numbers do not correspond to each other. For COI and cyt b sequences GenBank accession numbers are included; For samples used in microsatellite DNA analysis collection accession numbers are given. No = number of samples. Numbers in parenthesis indicate number of samples per haplotype (COI and Cyt b) or accession (microsatellite); for the latter no number is indicated when sample size is 1. Cytochrome oxydase 1 Cytochrome b Microsatellite No Haplotype GenBank accession No Haplotype GenBank Accession No Collection catalogue numbers number numbers number numbers L. acutirostris 3 1 (2), 2 JQ677092, JQ , 2, 3 (2) JN887003, JQ716371, 10 UAIC (3), (3), JQ (3), L. brevicephalus 4 1 (3), 2 JQ677092, JQ (2), 6 (2) JN887003, JN UAIC , (5), (4) L. crassibarbus 4 1 (2), 2 (2) JQ677092, JQ , 6 (2), 7, 8 JN886993, JN887003, JN887004, JQ UAIC , , (5), (3) L. gorgoriensis 4 1, 3, 4 JQ677092, JQ677094, JQ (2), 9, 10 JN887034, JQ716374, JQ UAIC , , (2) L. gorguari 3 1 (2), 2 JQ677092, JQ , 5, 6 JN886993, JN887003, JN UAIC , , L. longismus 3 1 (2), 5 JQ677092, JQ677093, JQ (2), 15 JN886993, JN UAIC , , L. macrophthalmus 3 3 JQ (2), 16 JN887031, JQ UAIC , (3) L. megastoma 5 1 (3), 2 (2) JQ677092, JQ , 18 (2) JN887033, JQ716380, UAIC (2), ,

113 TABLE 5. 1 continued Cytochrome oxydase 1 Cytochrome b Microsatellite No Haplotype number GenBank accession numbers No Haplotype number GenBank Accession numbers No Collection catalogue numbers L. nedgia 4 1, 2 (2), 4 JQ677092, JQ677093, JQ , 11, 12, 13, 14 41, JN887031, JQ716376, JQ716377, JQ UAIC (6), (5), L. platydorsus 5 1 (4), 5 JQ677092, JQ , 19, 20, 21 JN886993, JN887031, JN887032, JQ UAIC (2), , (3), (5) L. surkis 3 1 (2), 6 JQ677092, JQ (2), 6 (2), 11, 22 JN886993, JN887003, JN887031, JQ UAIC (3), (2), (5) L. truttiformis 3 1 (2), 2 JQ677092, JQ , 26 (2) JN887031, JQ UAIC , , , (4), (3) L. tsanensis 3 1 (3) JQ (2), 23, 24, 25 L. intermedius JN887003, JQ716383, JQ716384, JQ UAIC (8), , Lake Tana 7 1 (3), 2, 7, 10, 12 JQ677092, JQ677093, JQ677098, JQ677101, JQ (3), 15, 27 AF145948, JN887005, JN887006, JN UAIC (6), KU6102, KU6105, KU6129 Abay River 5 1 (2), 2, 10, 14 JQ677092, JQ677093, JQ677101, JQ , 28 (2), 30, 31 JN886992, JN886993, JN886994, JN KU6323, KU

114 TABLE 5. 1 continued Cytochrome oxydase 1 Cytochrome b Microsatellite No Haplotype GenBank accession No Haplotype GenBank Accession No Collection catalogue numbers number numbers number numbers Gumara River 5 1, 10, 11, 12, 13 JQ677092, JQ677101, 4 4, 6, 28, 29 JN887004, JN887003, 2 KU6313, KU6314 JQ677102JQ677103, JN886993, JN JQ Dedessa River 2 9 JQ , 33, 34, 35 JN886998, JQ716387, JN886999, JN887000, 4 UAIC , (2), JN Awash River 1 8 JQ JN UAIC (2) Lake Awassa 1 8 JQ JN UAIC , UAIC Lake Langano 1 8 JQ JN UAIC (2) Darse River 1 15 JQ JN KU6395, KU6396 Gibe River 2 16, 17 JQ677107, JQ JN KU6432, KU6434 Gilgel Gibe R. 2 19, 20 JQ677110, JQ JN UAIC (2) Gojeb River 1 18 JQ JN UAIC (2) Kulfo River 2 15, 22 JQ677106, JQ JN UAIC (2) Sagoe River 1 21 JQ JN UAIC (2) Arba Minch 2 15, 22 JQ677106, JQ JN UAIC (2) Springs 99

115 TABLE 5. 1 continued Cytochrome oxydase 1 Cytochrome b Microsatellite No Haplotype GenBank accession No Haplotype GenBank Accession No Collection catalogue numbers number numbers number numbers Lake Abaya JN UAIC (2) Lake Chamo 4 23 (3), 24 JQ677114, JQ JN UAIC (2) L. gananensis 4 - JQ677116, JQ677117, JQ677118, JQ V. jubae 1 - JQ V. besso Lake Tana 5 - JQ JQ716388, JQ UAIC (3), (2) JQ Dedessa River 4 - JQ677122, JQ677123, JQ677124, JQ JQ JQ UAIC (2), ,

116 TABLE 5. 2 Summary of genetic diversity in Lake Tana Labeobarbus (Ethiopia) at ten microsatellite loci. Comparisons involving morphotypes were excluded because no genetic differentiation was detected between the morphotypes. N = number of samples, Na = numb alleles, H O = observed herozygosity, Ht = total heterozygosity, F IS = fixation index. Locus N N a Size range H O H t F IS Di Di Tri Tri Tetra Tetra Barb Barb Barb Barb

117 TABLE 5. 3 the distribution of samples corresponding to previously hypothesized species and ecological groups in the two Bayesian clusters (K=2) recovered based on Structure analysis of 10 microsatellite DNA loci. N = sample size. Criteria for grouping Hypothesized groups N Number of samples in clusters I II Species (morphology) L. acutirostris L. brevicephalus L. crassibarbus L. gorgoriensis L. gorguari L. intermedius L. longismus L. macrophthalmus L. megastoma L. nedgia L. platydorsus L. surkis L. truttiformis L. tsanensis Spawning Lacustrine Riverine Habitat I Inshore Offshore Habitat II Benthic Littoral Pelagic Sub-littoral-Littoral Sub-littoral-Benthic Sub-littoral-Pelagic Trophic (diet) specialization Detrivore Insectivore Macrophytivore Molluscivore Piscivore Zooplanctivore

118 FIG Map of Lake Tana. All samples of Lake Tana were drawn from sites (lying within the red rectangle) located in the Bahir Dar Gulf. Dirma R. Road Rivers Towns Gorgora Rib R. Gumara R. Gilgel Abay R. To Addis Ababa Bahir Dar Gelda R. Abay (Blue Nile) R. BN water falls 103

119 FIG Phylogenetic relationships of Labeobarbus haplotypes based on Bayesian Analysis of complete cyt b sequences (1141 bp) from 58 samples of Lake Tana Labeobarbus and 25 L. intermedius from adjacent water bodies. Numbers on the tree correspond to MP bootstrap/posterior Probability values. OTUs correspond to haplotypes and numbers in parenthesis indicate number of samples represented by each haplotype. Some taxa are pruned for simplicity and clarity. CRV = Central Rift Valley, DDR = Dedessa River, LTD, Lake Tana Drainage, OGR = Omo-Gibe River, SRV = Southern Rift Valley, SSC = Southern sub-clade. MP score for best trees =

120 FIG Evolutionary relationship of Labeobarbus haplotypes based on mitochondrial CO1 data. A: Cladogram based on MP analysis; Numbers indicate MP bootstrap/bayesian Posterior Probability values. Numbers in parenthesis indicate the frequency of each haplotype. MP score for best trees = 31 B: Statistical Parsimony network of CO1 haplotype sequences (651 bp) from 51 samples of Lake Tana Labeobarbus and 30 L. intermedius from adjacent water bodies. OTUs (circles) correspond to haplotypes and haplotypes are connected into a network with 95% confidence. Haplotype circle size reflects the frequency of each haplotype. Morphotypes of Lake Tana Labeobarbus are color coded to show their proportions in each of the haplotypes. 77/- 70/- 94/- A L. intermedius lineage 94/ /100 74/100 75/100 96/100 Hap1 (37) Hap2 (12) Hap3 (1) Hap4 (2) Hap5 (1) Hap6 (1) Hap7 (1) Hap8 (5) Hap9 (2) Hap10 (3) Hap11 (1) Hap12 (2) Hap13 (1) Hap14 (1) Hap15 (4) Hap16 (1) Hap17 (1) Hap18 (1) Hap19 (1) Hap20 (1) Hap21 (1) Hap22 (2) Hap23 (3) Hap24 (1) L gananensis1 L gananensis2 L gananensis3 L gananensis4 V jubae L johnstoni V besso1 V besso2 V besso3 V besso4 V besso5 C carpio B 105