Supplementary information for: Reversing excitatory GABA A R signaling restores synaptic plasticity and memory in a mouse model of Down Syndrome

Transcription

1 Supplementary information for: Reversing excitatory GABA A R signaling restores synaptic plasticity and memory in a mouse model of Down Syndrome Gabriele Deidda 1,#, Martina Parrini 1,#, Shovan Naskar 1#, Ignacio F. Bozarth 1, Andrea Contestabile 1 *, Laura Cancedda 1 * Affiliations: 1 Neuroscience and Brain Technologies, Istituto Italiano di Tecnologia (IIT), via Morego, 3, Genova, Italy. # These authors contributed equally to this work. * These authors jointly directed the study. Correspondence to: laura.cancedda@iit.it; andrea.contestabile@iit.it Conflict of interest: A.C. and L.C. are named as co-inventors on International Patent Application PCT/EP214/78561, filed on December 18, 214, claiming priority over US Provisional Application US 61/919,195, priority date December 2, 213. Supplementary figures and legends Nature Medicine: doi:1.138/nm.3827

2 a 2 b 8 Spike Frequency (Hz) Spontaneous Firing (Hz) 4 *** Baseline GABA 1 µm GABA 5 µm GABA 5 µm GABA 1 µm GABA 2 µm Baseline GABA 2 μm GABA 2 μm + bicuculline 1 μm c Spike frequency (Hz) Vehicle CGP55845 Vehicle CGP Vehicle - CGP Vehicle - CGP55845 * d MQAE Fluorescence Intensity high low MQAE - Fluorescence intensity * e 2 * * Spike Frequency (Hz) Baseline GABA GABA+Bumetanide Suppl. Fig. 1 Nature Medicine: doi:1.138/nm.3827

3 Supplementary Figure 1 GABA A -receptor signaling is excitatory in adult hippocampal neurons. (a) Spiking frequency of single cells recorded in cell-attached patch-clamp configuration during bath application of GABA at different concentrations (1, 5, 5, 1, 2 µm) showed in principal Figure 1b. (b) Quantification of average spiking frequency ± SEM recorded in cell-attached patch-clamp configuration from CA1 pyramidal neurons revealed an increased activity upon GABA application (2 µm; post Student-Newman-Keuls Method One- Way ANOVA repeated measures on ranks, P <.5), which was abolished by bicuculline (1 µm, P <.5). Number in parenthesis: number of recorded cells. Inset, Example traces of spontaneous spiking before and during bath application of GABA, and GABA together with bicuculline in a neuron. Scale bar: vertical 5 pa, horizontal 5 s. (c) Average spike frequency in CA1 pyramidal neurons recorded by cell-attached patch-clamp configuration in acute brain slices before (, orange;, blue) and after (, pink;, light blue) bath application of CGP55845 (1 µm). In neurons, CGP55845 application increased spike frequency in comparison to baseline (Wilcoxon Signed Rank Test, P =.31). Statistical significance: * P <.5. Inset, Example traces of spiking activity before and after CGP55845 application in a or a neuron. Scale bar: vertical 2 pa, horizontal 5 s. (d) Left, Representative pseudo-color images of CA1 pyramidal neurons during intracellular Cl - imaging with the fluorescent chloride-sensitive dye MQAE. Fluorescent intensity (color coded on the left) of the dye is inversely proportional to the intracellular Cl - concentration. Dotted circles highlight regions of interest (ROI) for quantification. Scale bar, 25 µm. Right, quantification revealed a lower fluorescence intensity in (orange) compared to mice (blue, Student s t-test, P =.42), mirror of an higher intracellular Cl- concentration. Bar charts represent average ± SEM, whereas circles indicate data from single cells. (e) Spiking frequency of single cells recorded in cell-attached patch-clamp configuration before and during bath application of either GABA (1 µm) or GABA with bumetanide (1 µm) showed in principal Figure 2e. Nature Medicine: doi:1.138/nm.3827

4 a NKCC1 KO mice b KO mice +/+ -/- NKCC1 +/+ +/- -/- c d Mouse - Hippocampus Mouse CA3-CA1 Human Hippocampus Control DS e /actin (% of ) /actin (% of Control) Control DS f Mouse - Synaptosomes g Human - Synaptosomes Control DS h Mouse - CA1 Total (input) Surface (pull down) NaK-ATPase NaK-ATPase /NaK-ATPase (% of ) /NaK-ATPase (% of Control) Control DS expression (% of ) Total Surface Suppl. Fig. 2 Nature Medicine: doi:1.138/nm.3827

5 Supplementary Figure 2 expression is not significantly altered in the hippocampus of mice and DS patients. (a,b) Immunoblot analysis revealed that NKCC1 (a) and (b) bands were absent in samples obtained from brains of NKCC1 and knockout mice, respectively, indicating the specificity of the antibodies used. (c-e) Top, representative immunoblots for on protein extracts from samples of mouse whole hippocampus (c), mouse CA3-CA1 hippocampal sub-region (d), and human post-mortem whole hippocampus (e). Bottom, average ± SEM and single cases (circles) showing similar expressions of (expressed as percentage of or Control) in mice and DS patients (mouse: orange; human: white) in comparison to mice or age/sex matched non-trisomic controls, respectively (mouse: blue; human: black; Student s t-test, P =.634,.434,.288 respectively). was used as an internal standard. (f-g) Top, representative immunoblots for on protein extracts from mouse (f) or human (g) synaptosomal fraction of whole hippocampus. Bottom, quantification revealed similar expressions of (expressed as percentage of or Control) in mice and DS patients (mouse: orange; human: white) in comparison to or non-trisomic controls (mouse: blue; human: black; Student s t-test, P =.797,.466, respectively). The membrane protein Na + /K + -ATPase was used as an internal standard. (h) Top, representative immunoblots for on protein extracts from biotinylation experiments from total (left) or surface (right) CA1 hippocampal region of (orange) or (blue) mice. Bottom, quantification revealed similar expressions of (expressed as percentage of ) in in comparison to mice (Student s t-test, P =.152,.67 respectively). or Na + /K + -ATPase were used as internal standards for total or surface quantification, respectively. For all panels, bar charts represent average ± SEM, whereas circles indicate data from single samples. Statistical significance: *P <.5, **P <.1. Nature Medicine: doi:1.138/nm.3827

6 a Mouse Hippocampus b Human Hippocampus mrna expression (% of ) NKCC1 NKCC1 (alternative primers) *** APP mrna expression (% of Control) ** NKCC1 Control Ds ** APP c Mouse CA3-CA1 d APP mrna expression (% ) NKCC1 NKCC1 (alternative primers) *** APP APP/actin (% of ) *** Suppl. Fig. 3 Nature Medicine: doi:1.138/nm.3827

7 Supplementary figure 3 NKCC1 and mrna quantification in mice and DS patients. (a) Quantification of NKCC1, and APP mrna expression in whole hippocampus from (orange) and (blue) mice by RT-qPCR revealed increased expression only of the triplicated gene App (expressed as percentage of ) in mice (Student s t-test, P <.1). NKCC1 mrna was quantified with two alternative primer pairs targeting different transcript regions. NKCC1 mrna was similarly expressed in and whole hippocampus with both primer pairs. (b) Quantification of NKCC1, and APP mrna expression in hippocampi from DS patients and non-trisomic controls by RT-qPCR. Average ± SEM (bar charts) and data from single cases (circles) showed increased expression of the mrna for NKCC1 and the triplicated gene APP (expressed as percentage of controls, black) in DS patients (white; Student s t-test, P =.9). (c) Quantification of NKCC1, and APP mrna expression in samples of CA3-CA1 hippocampal sub-region from (orange) and (blue) mice by RT-qPCR revealed increased expression only of the triplicated gene APP (expressed as percentage of ) in mice (Student s t-test, P <.1). NKCC1 mrna expression was quantified with two alternative primer pairs targeting different transcript regions (as in panel a). NKCC1 mrna was similarly expressed in and hippocampal CA3- CA1 sub-region with both primer pairs. (d) Top, representative immunoblots for APP on protein extracts from samples of mouse CA3-CA1 hippocampal sub-region. Bottom, average ± SEM (bar chart) and single cases (circles) showing a higher expression of APP protein (expressed as percentage of ) in in comparison to mice (Student s t-test, P <.1). was used as an internal standard. Nature Medicine: doi:1.138/nm.3827

8 a Baseline GABA 1 M Baseline GABA 1 M Spike Frequency(% of baseline) Baseline * GABA b Mouse - Cortex c Mouse Cortex NKCC1 NKCC1/actin (% of ) * /actin (% of ) d Mouse Cortex mrna expression (% of ) *** NKCC1 NKCC1 APP (alternative primers) Suppl. Fig. 4 Nature Medicine: doi:1.138/nm.3827

9 Supplementary Figure 4 mice show excitatory GABAergic transmission and increased NKCC1 expression in the neocortex (a) Left, example traces of spontaneous spiking activity from layer II/III cortical pyramidal neurons in cell-attached patch-clamp configuration in acute brain slices derived from (bottom) and (top) mice before (baseline) and during bath application of GABA (1 µm). Scale bars: vertical 1 pa, horizontal 1 s. Right, quantification of spike frequency revealed a significant increase upon GABA application in (orange) mice, but not in mice (blue; Student s t-test, P =.12). (b,c) Top, representative immunoblots for NKCC1 and on protein extracts from mouse cortical samples. Bottom, Quantification showing increased expression of NKCC1 (b) and similar expression of (c, expressed as percentage of ) in (orange) in comparison to mice (blue; Student s t-test, P =.16 and P =.465, respectively). (d) Quantification of NKCC1, and APP mrna expression in cortical samples from and mice by RT-qPCR, revealed an increased expression only of the triplicated gene APP (expressed as percentage of, blue) in mice (orange; Student s t-test, P <.1). NKCC1 mrna was quantified with two alternative primer pairs targeting different transcript regions (as in Supplementary Figure 3). NKCC1 mrna was similarly expressed in and cortices with both primer pairs. For all panels, bar charts represent average ± SEM, whereas circles indicate data from single animals/cells. Statistical significance: *P <.5, **P <.1. Nature Medicine: doi:1.138/nm.3827

10 a Recording Electrode Stimulating Electrode (CA1 Stratum Radiatum) (CA3 Schaffer Collateral) Theta Burst Stimulation Protocol b c fepsp slope (% of baseline) Vehicle (17) Vehicle (11) VU24551 (5) VU24551 (5) fepsp slope (% of baseline) Time (min) d e Vehicle Vehicle GABA GABA fepsp slope (% of baseline) TBS Vehicle (17) Vehicle (11) GABA (9) GABA (6) fepsp slope (% of baseline) * * Time (min) Suppl. Fig. 5 Nature Medicine: doi:1.138/nm.3827

11 Supplementary Figure 5 Bath application of -inhibitor VU24551 or GABA does not affect hippocampal CA3-CA1 LTP in and mice. (a) Sketch of the recording configuration (left) and stimulation protocol (right). (b) Average time course of the increase in the slope of the fepsp in hippocampal slices during bath application of either vehicle (, orange;, blue) or VU24551 (5 μm;, pink;, light blue). Numbers in parentheses: number of processed slices. Insets: Average of 1 traces recorded for each experimental group before (continuous line) and 6 min after TBS (dashed line). Stimulus artifacts have been deleted from traces for clarity. Scale bars: vertical, 1 mv; horizontal, 1 ms. (c) Average level of plasticity (calculated as the slope of fepsp response normalized to the average baseline) from the experiments in b during the last 5 minutes of recording. VU24551 application did not affect LTP in (pink) and mice (light blue, post Two-Way ANOVA Tukey test P >.5). The bar chart represents average ± SEM, whereas circles indicate data from single slices. (d) Average time course of the increase in the slope of fepsp in hippocampal slices during bath application of either vehicle (, orange;, blue) or GABA (1 μm;, pink;, light blue). Numbers in parentheses: number of processed slices. Inset: Average of 1 fepsp traces recorded for each experimental group before (continuous line) and 6 min after TBS (dashed line). Stimulus artifacts have been deleted from traces for clarity. Scale bars: vertical, 1 mv; horizontal, 1 ms. (e) Average LTP ± SEM (bar charts) and single slice cases (circles) of the last 5 min of recordings in d. slices (orange) showed lower LTP in comparison to (blue; P =.3), and GABA application did not affect LTP neither (pink) or in mice (light blue; post hoc Tukey test following Two-Way ANOVA, P >.5). Statistical significance: *P <.5. Nature Medicine: doi:1.138/nm.3827

12 Contextual Fear Conditioning Task a 3-4 month-old and mice Bumetanide.2 mg/kg/day (i.p.) Weeks of treatment 4 Behavioral Testing Vehicle Vehicle Bumetanide Bumetanide b 1 Pre-shock Shock Post-shock Time freezing (%) 5 Veh Bum 1W Bum 4W Veh Bum 1W Bum 4W c 3-4 month-old and mice Acute Behavioral Testing Bumetanide.2 mg/kg/day (i.p.) Washout Weeks of treatment Washout Behavioral Testing Vehicle Vehicle Bumetanide Bumetanide d Chronic treatment - Washout e Acute treatment Untrained Context Untrained Context 5 New context 5 New context Vehicle Bumetanide Vehicle Bumetanide Suppl. Fig. 6 Nature Medicine: doi:1.138/nm.3827

13 Supplementary Figure 6 Effect of systemic treatment with bumetanide in the contextual fear conditioning task. (a) Schematic cartoon of the experimental protocol (left) for the different experimental groups (right). (b) One week (Bum -1W) and 4 weeks (Bum - 4W) chronic bumetanide treatments had no effect on the freezing time before (left, ANOVA on ranks, P >..5) and immediately after (right, ANOVA on ranks P >.5) the electric foot shock during conditioning in and mice. Bar charts represent average ± SEM, whereas circles indicate data from single animals. (c) Schematic cartoon of the different experimental protocols (left) for the experimental groups (right). (d, e) All experimental groups showed negligible non-associative freezing when exposed to an untrained context both after 1 week of drug washout following chronic bumetanide treatment (d) or after acute bumetanide treatment (e, Two-Way ANOVA, P >.5). Nature Medicine: doi:1.138/nm.3827

14 Object Location Task a 3-4 month-old and mice Bumetanide.2 mg/kg/day (i.p.) Weeks of treatment 4 Behavioral Testing Vehicle Vehicle Bumetanide Bumetanide 24 h b Total exploration (acquisition) c Total exploration (trial) 2 2 Exploration time (sec) 1 Exploration time (sec) 1 Veh Bum -1W Bum -4W Veh Bum -1W Bum -4W d 1 % Object preference (acquisition) Exploration time (%) 5 / Veh / Veh / Bum-1W / Bum-1W / Bum-4W / Bum-4W Suppl. Fig. 7 Nature Medicine: doi:1.138/nm.3827

15 Supplementary Figure 7 Total exploration time and object preference in the object location task. (a) Schematic cartoon of the experimental protocol (left) for the different experimental groups (right). The picture on the bottom depicts the 2 identical objects used for the test. (b) mice showed no difference in object exploration during the acquisition phase of the object location task (ANOVA on ranks P >.5), and this behavior was not significantly altered by bumetanide treatment (P >.5, Dunn's post hoc test). (c) mice showed increased object exploration in the trial phase. Object exploration was slightly decreased only after 1 week of systemic bumetanide treatment: Two-way ANOVA genotype [F 1,91 = 15.97, P <.1], treatment [F 1,91 = 5.524, P =.5], genotype x treatment [F 1,91 =.594, P =.554]; *P <.5, **P <.1, Tukey post hoc test. (d) The percentage of time spent exploring the two objects during the acquisition phase was similar across groups and it was not altered by bumetanide treatment (ANOVA on ranks, P >.5). All bar charts represent average ± SEM, whereas circles indicate data from single animals. Nature Medicine: doi:1.138/nm.3827

16 Novel Object Recognition Task a 3-4 month-old and mice Bumetanide.2 mg/kg/day (i.p.) Weeks of treatment 4 Behavioral Testing Vehicle Vehicle Bumetanide Bumetanide 24 h b Total exploration (acquisition) c Total exploration (trial) 24 2 Exploration time (sec) 12 Exploration time (sec) 1 Veh Bum -1W Bum -4W Veh Bum -1W Bum -4W d 8 % Object preference (acquisition) Exploration time (%) 4 / Veh / Veh / Bum-1W / Bum-1W / Bum-4W / Bum-4W Suppl. Fig. 8 Nature Medicine: doi:1.138/nm.3827

17 Supplementary Figure 8 Total exploration time and object preference in the novel object recognition task. (a) Schematic cartoon of the experimental protocol (left) for the different experimental groups (right). The picture on the bottom depicts the 4 different objects used for the test that were shuffled among the sessions. (b) mice showed increased object exploration in the acquisition phases of the novel object recognition task only after 1 week of bumetanide systemic treatment. Two-way ANOVA genotype [F 1,83 = 9.628, P =.3], treatment [F 1,83 = 3.439, P =.37], genotype x treatment [F 1,83 =.569, P =.568] *P <.5 Tukey post hoc test. (c) mice showed increased object exploration in the trial phase, which was not altered by one week of bumetanide treatment: Two-way ANOVA genotype [F 1,83 = , P <.1], treatment [F 1,83 =.382, P =.684], genotype x treatment [F 1,83 =.539, P =.585]; **P <.1, *** P <.1 Tukey post hoc test. (d) The percentage of time spent exploring the three objects during the acquisition phase was similar across groups and it was not altered by bumetanide treatment (ANOVA on ranks, P >.5). All bar charts represent average ± SEM, whereas circles indicate data from single animals. Nature Medicine: doi:1.138/nm.3827

18 a 3-4 month-old and mice Bumetanide.2 mg/kg/day (i.p.) Weeks of treatment Vehicle Vehicle Bumetanide Bumetanide Behavioral Test b 8 * * Locomotor activity Horizontal activity Photobeam counts c Photobeam counts Vehicle Bumetanide Vehicle Bumetanide DARK LIGHT * * Stereotypic activity Vehicle Bumetanide Vehicle Bumetanide DARK LIGHT d Audiogenic seizures % animals with AGS * * Mean AGS score 2 1 * * Vehicle Bumetanide Vehicle Bumetanide Suppl. Fig. 9 Nature Medicine: doi:1.138/nm.3827

19 Supplementary Figure 9 Systemic treatment with bumetanide does not rescue the spontaneous locomotor activity nor audiogenic seizures in the mice. (a) Schematic cartoon of the experimental protocols. (b, c) Spontaneous locomotor activity of and mice treated with bumetanide or vehicle was continuously automatically monitored for a 24 hours period (12:12 hour dark/light cycle) with an array of photocell beams that count how many times the animal passes in front of the photocell (photobeam counts). Both vehicle- and bumetanide-treated mice exhibited increased horizontal locomotor activity (b, Two-Way ANOVA Tukey test, P =.46 and.27, respectively) and stereotypic activity (c, Two-Way ANOVA Tukey test, P =.33 and.12, respectively) in comparison to mice during the dark phase of the test. Bumetanide treatment did not alter locomotor activity in either or mice. Bar charts represent average ± SEM, whereas circles indicate data from single animals (d) Audiogenic seizure (AGS) susceptibility was assessed in and mice treated with bumetanide or vehicle. Both vehicle- and bumetanidetreated mice exhibited increased AGS susceptibility in comparison to mice as assessed by percentage of animals that exhibited AGS (left, Chi Square test with Sidak adjustment for multiple comparisons, P <.5 ) or mean AGS severity score (right, ANOVA on ranks, Student-Newman-Keuls Method, P <.5). Bumetanide treatment did not alter AGS susceptibility in either or mice. Bar charts represent the percentage of animals showing AGS (left) or average severity score ± SEM (right). Statistical significance: *P <.5. Nature Medicine: doi:1.138/nm.3827

20 a 3-4 month-old and mice Bumetanide.2 mg/kg/day (i.p.) Weeks of treatment 4 Western Blot Vehicle Vehicle Bumetanide Bumetanide b GABA A R- 1 - Veh - Veh - Bum - Bum GABA A R - 1/actin (% of ) c GABA A R- 3 - Veh - Veh - Bum - Bum GABA A R - 3/actin (% of ) d GABA A R- - Veh - Veh - Bum - Bum GABA A R - /actin (% of ) * Suppl. Fig. 1 Nature Medicine: doi:1.138/nm.3827

21 Supplementary Figure 1 Systemic treatment with bumetanide does not affect specific GABA A receptor subunit expression in in comparison to mice. (a) Schematic cartoon of the experimental protocol. Samples were collected after 4 weeks of bumetanide or vehicle treatment. (b-d) Top, representative immunoblots for GABA A R-α 1 (b), -α 3 (c) and -δ (d) on protein extracts from and hippocampal samples. Bottom, quantification revealed similar expression of GABA A R-α 1 (b) and GABA A R-α 3 (c) subunits (expressed as percentage of ) in both vehicle- (, orange;, blue) and bumetanide-treated (pink) and (light blue) mice (post Two-Way ANOVA Tukey test, P >.5). Bumetanide treatment increased expression of GABA A R-δ only in mice (d, post Two-Way ANOVA Tukey test, P =.36). For all panels, bar charts represent average ± SEM, whereas circles indicate data from single animals. Nature Medicine: doi:1.138/nm.3827

22 Object Location Task a 3-4 month-old and mice Acute Behavioral Testing Bumetanide.2 mg/kg/day (i.p.) Washout Weeks of treatment Washout Behavioral Testing Vehicle Vehicle Bumetanide Bumetanide 24 h Chronic treatment - Washout Acute treatment b Exploration time (sec) Total exploration (acquisition) c Total exploration (trial) ** * e Total exploration (acquisition) f Total exploration (trial) * * Vehicle Bumetanide Vehicle Bumetanide Vehicle Bumetanide Vehicle Bumetanide d 1 % Object preference (acquisition) g 1 % Object preference (acquisition) Exploration time (%) /Veh /Veh /Bum /Bum /Veh /Veh /Bum /Bum Suppl. Fig. 11 Nature Medicine: doi:1.138/nm.3827

23 Supplementary Fig. 11 Total exploration time and object preference in the object location task in the chronic-treatment washout and in the acute-treatment experiments. (a) Schematic cartoon of the experimental protocol (left) for the different experimental groups (right). (b-d) In the chronic-treatment washout experiment, (b) mice showed no difference in object exploration during the acquisition phase of the object location task (Two-Way ANOVA, P >.5), and this behavior was not significantly altered after bumetanide washout; (c) mice showed increased object exploration in the trial phase in comparison to independent of bumetanide washout (post Two-Way ANOVA Tukey test, P =.7,.13); (d) the percentage of time spent exploring the two objects during the acquisition phase was similar across groups, and it was not altered after bumetanide washout (ANOVA, P >.5). (e-g) In the acute-treatment experiment, (e) mice showed no difference in object exploration during the acquisition phase of the object location task (Two-Way ANOVA, P >.5), and this behavior was not significantly altered by bumetanide treatment; (f) vehicle-treated mice showed increased object exploration in comparison to during the trial phase (post Two-Way ANOVA Tukey test, P =.45), and bumetanide treatment slightly decreased object exploration (post Two-Way ANOVA Tukey test, P =.14); (g) the percentage of time spent exploring the two objects during the acquisition phase was similar across groups and it was not altered after bumetanide treatment (ANOVA, P >.5). All bar charts represent average ± SEM, whereas circles indicate data from single animals. Statistical significance: *P <.5, **P <.1. Nature Medicine: doi:1.138/nm.3827

24 Novel Object Recognition Task a 3-4 month-old and mice Acute Behavioral Testing Bumetanide.2 mg/kg/day (i.p.) Washout Weeks of treatment Washout Behavioral Testing Vehicle Vehicle Bumetanide Bumetanide 24 h Chronic treatment - Washout Acute treatment b Exploration time (sec) Total exploration (acquisition) c Total exploration (trial) ** * e Total exploration (acquisition) f Total exploration (trial) * Vehicle Bumetanide Vehicle Bumetanide Vehicle Bumetanide Vehicle Bumetanide d 8 % Object preference (acquisition) g 8 % Object preference (acquisition) Exploration time (%) /Veh /Veh /Bum /Bum /Veh /Veh /Bum /Bum Suppl. Fig. 12 Nature Medicine: doi:1.138/nm.3827

25 Supplementary Fig. 12 Total exploration time and object preference in the novel object recognition task in the washout and in the acute-treatment experiments. (a) Schematic cartoon of the different experimental protocols (left) for the experimental groups (right). (b-d) In the chronic-treatment washout experiment, (b) mice showed no difference in object exploration during the acquisition phase of the NOR task (Two-Way ANOVA, P >.5), and this behavior was not significantly altered after bumetanide washout; (c) vehicle-treated mice showed increased object exploration in the trial phase with respect to (post Two-Way ANOVA Tukey test, P =.4), which was decreased after bumetanide washout (post Two-Way ANOVA Tukey test, P =.17); (d) the percentage of time spent exploring the three objects during the acquisition phase was similar across groups and it was not altered after bumetanide (ANOVA, P >.5). (e-g) In the acutetreatment experiment, (e) mice showed no difference in object exploration during the acquisition phase of the NOR task (Two-Way ANOVA, P >.5), and this behavior was not significantly altered after bumetanide treatment; (f) vehicle-treated mice showed increased object exploration in the trial phase compared to (post Two-Way ANOVA Tukey test, P =.26); (g) the percentage of time spent exploring the three objects during the acquisition phase was similar across groups, and it was not altered by bumetanide treatment (ANOVA, P >.5). All bar charts represent average ± SEM, whereas circles indicate data from single animals. Nature Medicine: doi:1.138/nm.3827

26 Figure 3a Figure 3b Figure 3c Figure 3d NKCC1 NKCC1 NKCC1 NKCC1 NaK ATPase Figure 3e Input Figure 3f Pull-down Supplementary Figure 2a Supplementary Figure 2b NKCC1 NKCC1 NKCC1 NKCC1 NaK ATPase NaK ATPase NaK ATPase Supplementary Figure 2c Supplementary Figure 2d Supplementary Figure 2e Supplementary Figure 2f Supplementary Figure 2g Supplementary Figure 2h Input Pull-down NaK ATPAse NaK ATPAse NaK ATPase NaK ATPase Supplementary Figure 3d Supplementary Figure 4b Supplementary Figure 4c APP NKCC1 Supplementary Figure 1b Supplementary Figure 1c Supplementary Figure 1d GABRA-A1 GABRA-A3 GABRA-D Suppl. Fig. 13 Nature Medicine: doi:1.138/nm.3827

27 Supplementary Fig. 13 Full-length blot images corresponding to the cropped western blot data presented in Figure 3 and Supplemental Figures 2, 3, 4, 1. Nature Medicine: doi:1.138/nm.3827

28 Supplementary Tables Supplementary Table 1. Mice cohorts for behavioral testing. Cohort # Acute test 1 week test 4 week test Washout test 1 none OL NOR none 2 none OL NOR none 3 none OL 4 none NOR 5 none NOR 6 none NOR 7 none NOR NOR CFC OL CFC OL CFC OL CFC OL CFC none none none none none 8 none CFC none none 9 none CFC none none 1 OL CFC none none 11 OL none none none 12 NOR none none OL CFC 13 NOR none none CFC 14 none none none OL CFC 15 CFC none LA NOR 16 CFC none LA NOR OL: Object Location test. NOR: Novel Object Recognition test. CFC: Contextual Fear Conditioning test. LA: 24-hours Locomotor Activity Nature Medicine: doi:1.138/nm.3827

29 Supplementary Table 2. SYBR green RT-qPCR primer sequences. Gene symbol SLC12A2 Gene name Solute carrier family 12, member 2 (NKCC1) Organism Homo Sapiens Accession number Forward primer (5'-3') Reverse primer (5'-3') NM_146 GCTCTATCTAAGGACCTACCACCA AGGCACTGAAGTACCATTCTGGAG SLC12A5 APP GAPDH PPIA ACTB HPRT1 Slc12a2 Solute carrier family 12, member 5 () Amyloid beta (A4) precursor protein Glyceraldehyde-3- phosphate dehydrogenase Peptidylprolyl isomerase A (cyclophilin A) beta Hypoxanthine phosphoribosyl transferase 1 Solute carrier family 12, member 2 (NKCC1) Homo Sapiens Homo Sapiens Homo Sapiens Homo Sapiens Homo Sapiens Homo Sapiens Mus Musculus NM_ TCCTTCAGTAGACCTCCCT CACAGCCCATCACATCAG NM_484 CCGCCACAGCAGCCTCTG AAATGGACACCGATGGGTAGTGAA NM_ AATGAAGGGGTCATTGATGG AAGGTGAAGGTCGGAGTCAA NM_2113 TTCTGCTGTCTTTGGGACCT CACCGTGTTCTTCGACATTG NM_111 CAGCAAGCAGGAGTATGAC GAAAGGGTGTAACGCAACT NM_194 ACCCTTTCCAAATCCTCAGC GTTATGGCGACCCGCAG NM_9194 CCACCAGGAAACCATACCA AAGGCAGGCAAGTCTACC Slc12a5 App Gapdh Ppia Actb Hprt Solute carrier family 12, member 5 () Amyloid beta (A4) precursor protein Glyceraldehyde-3- phosphate dehydrogenase Peptidylprolyl isomerase A (cyclophilin A) beta Hypoxanthine guanine phosphoribosyl transferase Mus Musculus Mus Musculus Mus Musculus Mus Musculus Mus Musculus Mus Musculus NM_2333 GGACCACTAGCTGACCTC CACCTGAGCCGTTTGATG NM_ GCAGCAGAACGGATATGAG GATGGGTAGTGAAGCAATGG NM_884 GAACATCATCCCTGCATCCA CCAGTGAGCTTCCCGTTCA NM_897 CACTGTCGCTTTTCGCCGCTTG TTTCTGCTGTCTTTGGAACTTTGTCTGC NM_7393 AAGTGGTTACAGGAAGTCC ATAATTTACACAGAAGCAATGC NM_13556 TGAGGCGGCGAGGGAGAG AAGCGGTCTGAGGAGGAAGC Nature Medicine: doi:1.138/nm.3827

30 Supplementary Table 3. SYBR green RT-qPCR efficiency. Gene symbol Organism Accession number Amplicon length (bp) Final primer concentration ( M) Calibration curve (slope / R 2 ) Calculated PCR efficiency (%) SLC12A2 Homo Sapiens NM_ / SLC12A5 Homo Sapiens NM_ / Primer dimers Only in NTC samples Only in NTC samples APP Homo Sapiens NM_ / Not detected GAPDH Homo Sapiens NM_ / Only in NTC samples PPIA Homo Sapiens NM_ / Not detected ACTB Homo Sapiens NM_ / Not detected HPRT1 Homo Sapiens NM_ / Not detected Slc12a2 Mus Musculus NM_ / Not detected Slc12a5 Mus Musculus NM_ / Not detected App Mus Musculus NM_ / Not detected Gapdh Mus Musculus NM_ / Ppia Mus Musculus NM_ / Only in NTC samples Only in NTC samples Actb Mus Musculus NM_ / Not detected Hprt Mus Musculus NM_ / Occasionally only in NTC sample Nature Medicine: doi:1.138/nm.3827

31 Supplementary Table 4. Human sample information. Case number Disorder Age (years) Gender 1276 DS 13 M 5277 DS 19 M 5341 DS 25 M 55 DS 39 F M196M DS 19 M 4925 Control 13 M 1841 Control 19 M 65 Control 25 M 566 Control 35 F 4782 Control 18 M Supplementary Table 5. Number of animals utilized and degrees of freedom for all figure panels. FIGURE PANEL Number of animals (unless otherwise specified) Number of cells/slices/samples (shown in bracket or as dots in panels) 1b 4, 8 12, c 12, 37 33, Degrees of Freedom 1d 2, 2 5, 6 4, 5 2b, E Cl measurement 8, 11 9, b, V m measurement 2, 1 7, c 4, 7 5, 7 4, 6 2d 1, 3 5, 5 4, 4 2e 2, 5 5, a 25, 25 25, b 16, 15 16, c Human Samples; Control 5, DS 5 Human Samples; Control 5, DS 5 8 3d 16, 16 16, e Human Samples; Control 5, DS 5 Human Samples; Control 5, DS 5 8 3f 4, 4 4, 4 Total 6, Surface 6 Nature Medicine: doi:1.138/nm.3827

32 4c Veh 12, Veh 8, Veh 17, Veh 11, 48 Bume 7, Bume 7 Bume 12, Bume 12 4d 4, 4 4, 5 7 4e 4f 5b 5c 5d 6c 6e 6f SUPPLEMENTARY FIGURE PANEL Veh 5, Veh 4, Bume 4, Bume 4 Veh 4, Veh 4, Bume 4, Bume 3 Veh 44, Veh 2, Bume 1W 16, Bume 1W 9, Bume 4W 27, Bume 4W 16 Veh 31, Veh 15, Bume 1W 18, Bume 1W 1, Bume 4W 14, Bume 4W 9 Veh 26, Veh 15, Bume 1W 14, Bume 1W 8, Bume 4W 17, Bume 4W 9 Veh 4, Veh 2, Bume 5, Bume 3 left panel Veh 17, Veh 1, Bume 16, Bume 9; middle panel Veh 11, Veh 1, Bume 11, Bume 9; right panel Veh 15, Veh 9, Bume 14, Bume 1 left panel Veh 14, Veh 11, Bume 14, Bume 1; middle panel Veh 18, Veh 8, Bume 13, Bume 8; right panel Veh 16, Veh 1, Bume 15, Bume 1 Number of animals (unless otherwise specified) Veh 6, Veh6, 18 Bume 4, Bume 6 Veh 6, Veh 6, 15 Bume 5, Bume 4 NA 126 NA 91 NA 83 Veh 1, Veh 7, 29 Bume 9, Bume 7 NA left panel 48 ; middle panel 37; right panel 44 NA left panel 45; middle panel 43; ight panel 47 Number of cells/slices/samples (shown in bracket or as dots in panels) Degrees of Freedom 1a See Fig. 1b See Fig. 1b See Fig. 1b 1b c 2, 3 5, 6 4, 5 1d 2, 2 27, e Same as Fig. 2e Same as Fig. 2e Same as Fig. 2e 2c 25, 25 25, d 16, 16 16, e Human Samples; Control 5, DS 5 Human Samples; Control 5, DS 5 8 2f 16, 16 16, g Human Samples; Control 5, DS 5 Human Samples; Control 5, DS 5 8 Nature Medicine: doi:1.138/nm.3827

33 2h 4, 4 4, 4 Total 6, Surface 6 3a 8, 8 (for each mrna) 8, 8 (for each mrna) 14 (for each mrna) 3b Human Samples; Control 5, DS 5 Human Samples; Control 5, DS 5 8 (for each mrna) 3c 16, 16 (for each mrna) 16, 16 (for each mrna) 3 (for each mrna) 3d 16, 16 16, a 3, 4 5, 6 8, 1 4b 16, 15 16, c 16, 16 16, d 8, 8 (for each mrna) 8, 8 (for each mrna) 14 (for each mrna) 5c Veh 12, Veh 8, Veh 17, Veh 11, 36 VU 3, VU 3 VU 5, VU 7 5e Veh 12, Veh 8, Veh 17, Veh 11, 39 GABA 5, GABA 4 GABA 9, GABA 6 6b Same as in Fig. 5b NA Same as Fig. 5b (both for pre- and postshock) 6d Same as Fig. 6e left panel NA Same as Fig.6e left panel 6e Same as Fig. 6f left panel NA Same as Fig.6f left panel 7b Same as Fig. 5c NA Same as Fig. 5c 7c Same as Fig. 5c NA Same as Fig. 5c 7d Same as Fig. 5c NA 85 8b Same as Fig. 5d NA Same as Fig. 5d 8c Same as Fig. 5d NA Same as Fig. 5d 8d Same as Fig. 5d NA 71 9b Left panel: Veh 13, Veh 12, Bume 13, Bume 13; Right panel: Veh 1, Veh 12, Bume 8, Bume 13 NA left panel 47; right panel 39 9c Same as Suppl. Fig. 9b NA Same as Suppl. Fig. 9b 9d Veh 19, Veh 19, NA 72 Bume 19, Bume 19 9e Veh 19, Veh 19, NA 72 Bume 19, Bume 19 1b Veh 8, Veh 8, Veh 8, Veh 8, 28 Bume 8, Bume 8 Bume 8, Bume 8 1c Veh 8, Veh 8, Bume 8, Bume 8 Veh 8, Veh 8, Bume 8, Bume 8 28 Nature Medicine: doi:1.138/nm.3827

34 1d Veh 8, Veh 8, Veh 8, Veh 8, 28 Bume 8, Bume 8 Bume 8, Bume 8 11b Same as Fig. 6e middle panel NA Same as Fig.6e middle panel 11c Same as Fig. 6e middle panel NA Same as Fig.6e middle panel 11d Same as Fig. 6e middle panel NA 33 11e Same as Fig. 6f middle panel NA Same as Fig.6f middle panel 11f Same as Fig. 6f middle panel NA Same as Fig.6f middle panel 11g Same as Fig. 6f middle panel NA 39 12b Same as Fig. 6e right panel NA Same as Fig.6e right panel 12c Same as Fig. 6e right panel NA Same as Fig.6e right panel 12d Same as Fig. 6e right panel NA 36 12e Same as Fig. 6f right panel NA Same as Fig. 6f right panel 12f Same as Fig. 6f right panel NA Same as Fig. 6f right panel 12g Same as Fig. 6f right panel NA 39 Nature Medicine: doi:1.138/nm.3827