April DNA. DNA and Chemical Analyses of Commercial Fly Agaric-Related Products

Transcription

1 April DNA , DNA and Chemical Analyses of Commercial Fly Agaric-Related Products Takuro M6GJN6B6 1,Nobuo K6L6=6G6 1,Toshimitsu FJ@>=6GJ 2, Kazumasa YD@DN6B6 3,Yukiko M6@>CD 4 1, and Yukihiro GD96 ( 1 National Institute of Health Sciences: Kamiyoga, Setagaya-ku, Tokyo , Japan; 2 Natural History Museum and Institute, Chiba: Aoba, Chuo-ku, Chiba , Japan; 3 Faculty of Education, Shiga University: Hiratsu, Otsu , Japan; 4 Kanto-Shin etsu Regional Narcotic Control O$ce, Ministry of Health, Labor and Welfare: Nakameguro, Meguro-ku, Tokyo , Japan; Corresponding author) Since June 6, 2002, psilocin and psilocybin-containing fungi (commonly called magic mushrooms ) have been regulated by the Narcotics and Psychotropics Control Law in Japan. However, various fly agaric-related products are now entering the Japanese market via the internet. In this study, fly agaric-related products available in this way were investigated for raw materials by DNA analysis and for additives by chemical analysis. Nucleotide sequence analysis of the mitochondrial 12S rdna region suggested that these fly agaric-related products originate from A. muscaria or A. muscaria var. persicina. Furthermore, they were classified into three strains based on the ITS2-LSU nucleotide sequence. Harmine derivatives and/or tryptamine derivatives were detected in some of these products by LC/MS analysis. In accordance with this, the matk gene of Peganum harmala was found in all of the harmine derivative-containing samples. (Received October 14, 2004) Key words: fly agaric; internal transcribed spacer; 12S DNA mitochondrial 12S ribosomal DNA; tryptamine derivatives; harmine derivatives 2 1 psilocin (1), psilocybin (2) (Fig. 1) (Panaeolus cyanescens), (Psilocybe cubensis) 1), 2) ) ibotenic acid (3) muscimol (4) (Amanita muscaria), (A. pantherina) 4), 5) 6) Soma 5) A. muscaria, A. pantherina, A. strobiliformis 3 7) 9) 3 4 Bowden 10), 11),Eugster 12) A.

2 50 Vol. 46, No. 2 Fig. 1. Chemical structures of several hallucinogens muscaria LC/MS 1. (Peganum harmala) Table 1 KY7119 (Amanita gemmata) Table 1. Sample Information FB , 4 Across Sigma Harmine (5), harmaline (6) N,N-Diisopropyl-5-methoxytryptamine (5-MeO-DIPT: 7) 1 H-, 13 C-NMR, ESI-MS a-methyltryptamine (AMT: 8) TLC preparative TLC Merck Silicagel 60 F 254 Silicagel 60, 0.5 mm with concentrating zone Genomic DNA PrepMan Ultra Reagent Applied Biosystems PCR KOD DNA polymerase Toyobo dntps cycle sequencing BigDye Terminator v 3.1 Cycle Sequencing Kit Applied Biosystems DYEnamic ET Terminator Cycle Sequencing Kit Amersham Biosciences 3. NMR JEOL ECA-600 d (ppm) LC/ MS Waters FractionLynx MS ZQ 2996 PDA SR-2 W Taitec KUBOTA-1920 Kubota DNA MM-300 Qiagen TaKaRa PCR Thermal Cycler MP Takara Shuzo DNA Engine PTC-200 MJ Research ABI Prism Avant genetic analyzer Applied Biosystems 4. DNA DNA Fig. 2 Sample Type No. (n) A Dried fruiting body Conc. extract powder Conc. extract powder Additive Harmala seed 1 Fig. 2. Flow chart of DNA and chemical analyses

3 April 2005 DNA 51 Table 2. The Sequences of Primers Used in This Study Sense Sequence (5 3 ) Antisense Sequence (5 3 ) ITS2-LSU First reaction ITS2-S1 CAAGGATTCCCCTAGTAACTGCGA LSU-AS1 GCAGTCAGAATCGCTACGA Second reaction ITS2-S2 TCATCGAATCTTTGAACGC LSU-AS2 TTCTCACCCTCTATGACGCTCC 12S First reaction mit-ssu-s1 CAGCAGTCAAGAATATTAGTCAATG mit-ssu-as1 GCGGATTATCGAATTAAATAAC Second reaction mit-ssu-s1 mit-ssu-as2 CCTTCGTTTCTCAGCGTCAATC matk First reaction matk-s1 CGCTTGCTCATGATCATGG matk-as2 CCAATAGCGAAGGGTTTGAA Second reaction matk-s2 TCTCGAAAATTTAGGTTATGACA matk-as2 45, 1 DNA 200 ml 95, 1 genomic DNA Genomic DNA Table 2 PCR DNA ITS2 (rdna internal transcribed spacer 2) LSU (rdna large subunit) 500 bp, DNA 12S rdna 400 bp DNA matk 350 bp Microcon- PCR (Millipore) dntps 440 bp, 240 bp, 240 bp 5. TLC 10 mg 500 ml 10 (20,000 2 min) TLC (Fig. 2). TLC n- (3 :1:1) (2 :4:1) Ehrlich 6. 5-MeO-DIPT (7) AMT (8) A-7, A-9, 100 mg 5mL 10 (3, min) mg, 47.2 mg preparative TLC (20 10 cm) 2 :4:1(A-7), 5 : 4 : 1 (A-9) A-7 7 A mg 5-MeO-DIPT (7): 1 H-NMR (CDCl 3 ): d1.12 (12H, d, J 5.8 Hz), 2.76 (2H, br s), 2.87 (2H, br s), 3.17 (2H, br s), 3.86 (3H, s), 6.86 (1H, dd, J 2.4, 8.9 Hz), 7.01 (1H, d, J 2.0 Hz), 7.06 (1H, d, J 2.4 Hz), 7.25 (1H, d, J 8.6 Hz), 7.88 (1H, br s). ESI-MS, m/z ( ): 114 (100), 174 (21.7), 275 ([M H],46.6). AMT (8): 1 H-NMR (CDCl 3 ): d1.18: (3H, d, J 6.2 Hz), 2.66 (1H, dd, J 8.2, 14.4 Hz), 2.89 (1H, dd, J 5.5, 15.1 Hz), 3.31 (1H, m), 7.05 (1H, d, J 2.1 Hz), 7.12 (1H, t, J 6.9 Hz), 7.20 (1H, t, J 7.6 Hz), 7.37 (1H, d, J 8.2 Hz), 7.62 (1H, d, J 8.2 Hz), 8.10 (1H, br s). ESI-MS, m/z ( ): 158 (100), 175 ([M H],7.7). 7. LC/MS TLC 10 Millex-GN Millipore Inertsil ODS mm, 5 mm; GL Sciences 10 mmol/l ammonium formate bu#er (ph 3.0) acetonitrile (83 : 17) MS ESI positive mode 4kV, 120, 350, 350, 60 L/hr, 30 V 1. DNA DNA A-1 A-11 DNA ITS2-LSU DNA 12S rdna rdna (GenBank, EMBL, DDBJ) A. muscaria (Acc. no.: AF026673) A. muscaria var. persicina (Acc. no.: AF159064) A. pantherina (Acc. no.: AB ) A. gemmata (Acc. no.: AB190362) 6 10 (Fig. 3). DNA ITS2 LSU 3 (Fig. 4, Table 3). type 1 Oda A. muscaria (Acc. no.: AB AB080779, AB AB , AB AB ) 13) A. muscaria (A. ibotengutake) A. muscaria ITS2 4 AT type 1 type 3

4 52 Vol. 46, No. 2 Fig. 3. DNA sequence alignment of mitochondrial 12S rdna region of Amanita products Ahyphen - indicates deletion of the corresponding nucleotide. Boxes indicate a nucleotide di#ering that of A. muscaria. Fig. 4. DNA sequence alignment of ITS2-LSU region of Amanita products Ahyphen - indicates deletion of the corresponding nucleotide. Boxes indicate a nucleotide di#ering from that of the other two sequences. Table 3. The Results of LC/MS and DNA Analyses Sample Added compounds DNA analysis ITS2 LSU Mitochondrial 12S rdna Harmala matk A-1 Type 1 A. muscaria or A. muscaria var. persicina 2 Type 3 A. muscaria or A. muscaria var. persicina 3 Type 3 A. muscaria or A. muscaria var. persicina 4 Type 2 A. muscaria or A. muscaria var. persicina 5 Type 3 A. muscaria or A. muscaria var. persicina 6 Type 2 A. muscaria or A. muscaria var. persicina 7 Type 3 A. muscaria or A. muscaria var. persicina 8 Type 2 A. muscaria or A. muscaria var. persicina 9 Type 2 A. muscaria or A. muscaria var. persicina 10 Type 2 A. muscaria or A. muscaria var. persicina 11 Type 3 A. muscaria or A. muscaria var. persicina 12 These compounds occur naturally in this plant.

5 April 2005 DNA 53 A. muscaria Oda A. muscaria A. pantherina ITS b-tubulin 14) type 2, 3 A. muscaria (Acc. no.: AB AB080795: clade M-III in ref. 14) (98 99 ) type 2, 3 type 2, type 2, 3 DNA DNA matk 350 bp LC/ MS harmaline A-7, A-10, A-11, A-12 (Acc. no.: AY177667) 2 (Fig. 5). (A-7, 10, 11) 5, 6 Table 3 2. TLC (A-6 A-11) UV A-6 A-8 7 A-9 8 preparative TLC 1 H, 13 C-NMR LC/MS 5-MeO-DIPT AMT A-7, A-10, A-11 3 (A-12) MAO (Monoamine Oxidase) harmine (5), harmaline (6), harmol (9) harmalol (10) LC/MS 5, 6 (Fig. 6-A). m/z 199, 201 9, 10 (Fig. 6-B, C). TLC Fig. 6. Total ion and mass chromatograms of MeOH ext. of A-7 on LC-MS analysis A, Total ion chromatogram; B, Mass chromatogram at m/z 201; C, Mass chromatogram at m/z 199 Fig. 5. DNA sequence alignment of matk region of DNA derived from Amanita products Boxes indicate a nucleotide di#ering from that of P. harmala.

6 54 Vol. 46, No. 2 Rf 15) TLC 3 5, 6, 10 LC/MS 9 TLC 3 4 TLC TLC A. muscaria 3, 4 4) 3, 4 3 DNA A. muscaria ITS2 LSU 3 N,N-diisopropyl-5-methoxytryptamine (5 -MeO-DIPT; FOXY) a-methyltryptamine (AMT) 16 1) Maruyama, T., Shirota, O., Kawahara, N., Yokoyama, K., Makino, Y., Goda, Y., Discrimination of psychoactive fungi (commonly called Magic Mushroom ) based on the DNA sequence of the internal transcribed spacer region. Shokuhin Eiseigaku Zasshi (J. Food Hyg. Soc. Japan), 44, (2003). 2) Stamets, P., Psilocybin Mushrooms of the World, Berkeley, CA, USA, Ten Speed Press, (ISBN ) 3) 169 (2002) ) Michelot, D., Melendez-Howell, L. M., Amanita muscaria: chemistry, biology, toxicology, and ethnomycology. Mycol. Res., 107, (2003). 5) Chilton, W. S., Ibotenic Acid-Muscimol. In: The Primordial Pangk and Amrta, Otto, J. (ed.), Pharmacotheon 2nd ed., Kennewick, WA, USA, Natural Product Co., 1996, p (ISBN ) 6) Saar, M., Ethnomycological data from Siberia and North-East Asia on the e#ect of Amanita muscaria. J. Ethnopharmacol., 31, (1991). 7) Takemoto, T., Yokobe, T., Nakajima, T., Studies on the constituents of indigenous fungi. II. Isolation of the flycidal constituent from Amanita strobiliformis. Yakugaku Zasshi, 84, 1,186 1,188 (1964). 8) Takemoto, T., Nakajima, T., Yokobe, T., Structure of ibotenic acid. Yakugaku Zasshi, 84, 1,232 1,233 (1964). 9) Takemoto, T., Nakajima, T., Sakuma, R., Isolation of a flycidal constituent Ibotenic Acid from Amanita muscaria and A. pantherina. Yakugaku Zasshi, 84, 1,233 1,234 (1964). 10) Bowden, K., Drysdale, A. C., A novel constituent of Amanita muscaria. Tetrahedron Lett., 6, (1965). 11) Bowden, K., Drysdale, A. C., Constituents of Amanita muscaria. Nature, 206, 1,359 1,360 (1965). 12) Eugster, C. H., Müller, G. F. R., Good, R., Wirksto#e aus Amanita muscaria: Ibotensäure und muscazon. Tetrahedron Lett., 6, 1,813 1,815 (1965). 13) Oda, T., Yamazaki, T., Tanaka, C., Terashita, T., Taniguchi, N., Tsuda, M., Amanita ibotengutake sp. Nov., a poisonous fungus from Japan. Mycological Progress, 1, (2002). 14) Oda, T., Tanaka, C., Tsuda, M., Molecular phylogeny and biogeography of the widely distributed Amanita species, A. muscaria and A. pantherina. Mycol. Res., 108, (2004). 15) Shimamine, M., Takahashi, K., Ono, M., Identification of psychotropic drugs. Analysis of b-carboline derivatives. Bulletin of National Institute of Health Sciences, 99, (1981).