The role of posterior HoxA genes in the evolution of novel fins

Transcription

1 The role of posterior HoxA genes in the evolution of novel fins A Thesis submitted to the faculty of -, San Francisco State University. In partial fulfillment of the requirements for the Degree Master of Science In Biology: Marine Biology by Shannon Noelle Barry San Francisco, California

2 Copyright by Shannon Noelle Barry 2017

3 CERTIFICATION OF APPROVAL I certify that I have read The role of posterior HoxA genes in the evolution of novel fins by Shannon Noelle Barry, and that in my opinion this work meets the criteria for approving a thesis submitted in partial fulfillment of the requirement for the degree Master o f Science in Biology: Marine Biology at San Francisco State University. Associate Professor of Biology Professor of Biology Jose de la Torre, Ph.D Associate Professor of Biology

4 The role of posterior HoxA genes in the evolution of novel fins Shannon Noelle Barry San Francisco, California 2017 Batoids exhibit unique body plans, with derived fin morphologies such as the anteriorly expanded pectoral fins that fuse to the head, or distally extended anterior pelvic fin lobes used for a modified swimming technique utilized by skates (Rajidea). The little skate (Leucoraja erinacea), exhibits both of these unique fin morphologies. These fin modifications are not present in a typical shark body plan, and little is known regarding the mechanisms underlying their development. A recent study identified a novel apical ectodermal ridge (AER) associated with the development of the anterior pectoral fin in the little skate, but the role of the posterior FIoxA genes was not featured during skate fin development. We present the first evidence for FIoxA expression {HoxA 11 and HoxA 13) in novel AER domains associated with the development of these novel fin morphologies in a representative batoid, L. erinacea. We found HoxA 13 expression associated with the recently described novel AER in the anterior pectoral fin, and HoxA 11 expression in a novel AER domain in the anterior pelvic fin that we describe here. Further, we found that HoxA 11 expression is associated with the developing fin rays in paired fins. Finally, we found evidence for the distal phase FIoxA expression in the developing claspers, suggesting a more complex Hox code than previously described during specification of these modified fin domains. I ect representation of the content o f this thesis. Chair, Thesis Committee Date

5 ACKNOWLEDGEMENTS We would like to thank the Marine Biological Laboratory for sending samples, along with Andrew Gillis for sending initial samples. We would also like to thank Tetsuya Nakamura and Neil Shubin for providing Wnt3 images and sequences. We also thank Dr. Julio Ramierz for his assistance with sectioning, and my committee members Dr. Carmen Domingo and Dr. Jose de la Torre for their advice and feedback. In addition, this work was made possible by grants through the Dr. Earl H. Myers and Ethel M. Myers Oceanographic and Marine Biology Trust and the American Elasmobranch Society student research award.

6 TABLE OF CONTENTS List of Tables... vii List of Figures...ix Introduction Methods Embryos and Staging... 4 Clear and Stain...4 Whole Mount in situ hybridization Sectioning... 5 Results HoxA expression corresponds to novel AER-like domains Posterior HoxA genes are expressed in broad domains in pelvic fin Distal phase HoxA expression occurs during clasper development...7 HoxA 11 expression is associated with support structures in paired fin s 7-9 Discussion Expression of HoxA 11 and HoxA 13 are associated with novel AERs HoxA 11 and HoxA 13 mark broad domains in posterior regions First evidence of HoxA DP expression in a paired fin domain HoxA 11 is associated with development of support structures Conclusions References

7 LIST OF TABLES Table Page 1. Primers used for in situ hybridization probes...18 vii

8 LIST OF FIGURES Figures Page 1. Developmental staging scheme of Leucoraja erinacea Unique HoxA13 expression in novel AER in the anterior pectoral fin HoxAll, HoxA13 and Wnt3 expression shares similar domains HoxA13 expression is found exclusively in the claspers of males H oxall marks AER like domain in anterior pelvic fin HoxAl 1 is associated with developing fin rays Sectioning of HoxA 11 and clear/stain domains in the pectoral fin First evidence of HoxA DP expression Fin ray counts in the pectoral fin of the little skate Cartoon illustration of 5 HoxA expression in the little skate viii

9 1 Introduction Vertebrates exhibit an impressive array of morphological diversity, with a variety of body plan features exhibited by extinct and extant taxa, and the cartilaginous fishes are no exception. Cartilaginous fishes represent the most ancestral lineage of extant jawed vertebrates, which diverged from the bony fishes approximately million years ago [1, 2], and include the holocephalans, sharks, rays and skates. Cartilaginous fishes provide an interesting insight for comparing fin development to limb development in gnathostomes, and understanding the genetic underpinnings for trait variation and body plan diversity [3]. Approximately half of all cartilaginous fishes exhibit a modified body plan that is dorsoventrally flattened, with large pectoral fins that expand anteriorly to span the length of the body (Batoidea). We are beginning to understand that morphological evolution arises by co-option and modification of ancestral genetic regulatory networks (GRNs) that were present in the common ancestor of jawed vertebrates, allowing for body plan disparity [3, 4]. A compelling focus of evolutionary developmental studies has been the fin to limb transition, which has highlighted cooption of conserved pathways such as HoxA/D expression, and the role played in patterning these homologous structures. Hox genes are classically associated with early patterning of anterior and posterior domains during embryogenesis and have the intriguing property of collinear expression, in which the genes on the 3 end of the cluster are expressed, followed by expression of the 5 genes in a more restricted and posterior domain relative to the 3 genes. Later in development, Hox genes play an important role during fin and limb morphogenesis, and are commonly referred to as the fin and limb building toolkit [5, 6]. While the posterior HoxA/D genes are well known for their collinear expression pattern in early fin and limb development, during later development of distal features, there is a reversal of the collinear Hox expression pattern referred to as distal phase (DP) expression. For example, during HoxD expression in autopod development, HoxD13 is expressed in the entire autopod, while HoxD12 is nested within and is expressed only in digits 2-4 [7], A similar expression pattern can be seen in the catshark paired fins, with HoxD 13 expressed in a

10 2 broader domain along the distal margin of pectoral and pelvic fins, while HoxD12 is more restricted posteriorly and nested within [8]. The expression patterns of the posterior HoxD genes have been well characterized, and are associated with specification of morphological disparity of distal domains, while the 5 HoxA genes are presumed to specify proximal/distal domains, and have not been implicated in the morphogenesis of unique features. In tetrapods, the posterior HoxA genes, HoxA 11 and HoxAl3, have mutually exclusive expression patterns, with HoxAl 1 patterning the forearm, and HoxAl3 patterning the autopod [9, 10]. In cartilaginous and ray-finned fishes, such as shark [11], paddlefish [12] and zebrafish [13], HoxA expression is overlapping during pectoral fin development, suggesting that the exclusive expression domains of HoxAl 1 and HoxA13 in the autopod is a tetrapod novelty [14], Fins and limbs develop as outgrowths of the body wall and are patterned by two signaling centers referred to as the apical ectodermal ridge (AER), which is associated with distal outgrowth, and the zone of polarizing activity (ZPA) which is associated with AP patterning [15]. The AER plays a major role in the patterning and outgrowth of fins and limbs, and the removal of the AER resulted in a loss of distal elements in the limbs of tetrapods [16]. AER outgrowth and patterning is accomplished via interactions with major signaling pathways involving Wnt3 and fibroblast growth factor 10 (FgflO) [16, 17]. During fin development of ray finned fishes, the AER will elongate and form an apical fold (AF) that will eventually give rise to the dermal fin rays [18]. However, in tetrapods, the AF does not form, and the AER continues to promote distal elongation of endoskeletal elements leading to the eventual development of digits [7], The AER involves signaling Fgfs, which in turn activate other important developmental genes, such as Wnt and bone morphogenetic proteins (BMP), and works to maintain the AER within the developing fin and limb mesenchyme [17, 19]. During early development of pectoral fins, maintenance of the distal AER is demonstrated by the presence of 5 HoxD genes, Fgf7 in the posterior pectoral fins and Wnt3 along the entire perimeter [20]. The extended anterior pectoral fin in skates was recently identified to be the location o f a novel AER domain in the anterior pectoral fins

11 3 [20]. Using expression patterns of outgrowth AER markers (Fgf7, Wnt3 and 3 Hox genes), Nakamura et al. [20] concluded that there is an additional and distinct AER in the anterior region of the little skate pectoral fin that is associated with anterior elongation and is not present in sharks. Another novel AER was characterized in the claspers of the little skate [21]. Claspers are sexually dimorphic modification to the pelvic fins of males that develop into rolled structures that extend from the medial portion of the pelvic fins, and are used to transfer sperm into the female during copulation [3, 22], A recent investigation into the development and outgrowth of claspers indicates collinear HoxD expression in the pelvic fins and claspers of the little skate [23], This study examined the genetic pathway driving clasper development, and found that the Sonic hedgehog (Shh) pathway initiates clasper growth and HoxD gene expression, where HoxD 12 and HoxDl 3, are expressed as sex specific genes (found in the claspers of males only and not in the pelvic fins). However, the posterior HoxA genes were not investigated, and their role in novel morphologies remain undescribed. Here, we describe novel roles for the posterior HoxA genes, H oxall and HoxA 13 during the development of modified fins in the little skate. Distinct morphologies in the anterior pectoral and pelvic fins are specified by a different HoxA gene in two distinct novel AERs. We also found evidence suggesting that HoxAll is associated with the development of the fin rays in the little skate, while HoxA 13 has been coopted for fin ray expression in a ray-finned fish [24]. Additionally, our data suggest that the posterior HoxA genes play a role in specifying domains in the posterior pelvic fin and claspers in a representative batoid, the little skate (Leucoraja erinacea). Methods Embryos and staging Little Skate embryos were obtained from the Marine Biological Laboratories at Woods Hole Oceanographic Institution (Woods Hole, MA). Embryos were removed from their

12 4 egg capsules and euthanized by cervical transection. Whole embryos were placed into 4% paraformaldehyde overnight at 4 C and then transferred to 100% methanol and stored at - 20 C. Embryos were sexed and staged following the staging scheme of Maxwell et al. [25] for the winter skate (Leucoraja ocellata). Gene expression patterns were evaluated at several stages spanning paired fin development, which were stages 27, 28, 29 30, 31, 32 and early 33 (Fig 1). Clear and Stain Little skate embryos at stages 30, 31, 32 and 33 were cleared and stained following Gillis et al. [3], In short, embryos were fixed overnight in 100% methanol, and re-hydrated in gradients of ethanol (100%;70% at 2 hours each), then left overnight in 0.2% alcian blue in ethanol containing 30% glacial acetic acid. Embryos were then moved to 100% ethanol with 30% glacial acetic acid for 24 hours, followed by three days of ethanol gradients (70%;50%25%) and 24 hours of submersion in distilled water. An addition of a 0.5% alizarin red in KOH was added for 24 hour submersion, followed by de-staining in 0.5% KOH for up to 24 hours, and a graded glycerol series for three days in 0.5% KOH before photographing in 80% glycerol. W hole-mount in situ hybridization Probes for in situ hybridization were synthesized from constructs containing the target insert for HoxA (H oxa ll, HoxA13) and HoxD (H oxd ll, HoxD12, HoxD13) genes (Table 1), were cloned using the pgem-t Vector System II (Promega) and linearized using Ncol, Spel and SphI (Promega) following Wilkinson [26]. In situ hybridization was performed following the protocol of Gillis (2010), with empirical optimization of bleaching time, hybridization temperature, blocking time and NBT/BCIP staining. Following staining, embryos were re-fixed in 4% paraformaldehyde and photographed in 50% glycerol/50% PBT and stored in 100% glycerol at 4 C. Wnt3 expression images were provided by Nakamura et al. [20]. Sectioning

13 5 Following in situ hybridization, embryos for sectioning were placed into 30% sucrose in IX PBS overnight at 4 C. Sucrose was removed and embryos were embedded with O.C.T. Compound (Tissue Tech) and were immediately frozen on dry ice in plastic molds. Embryos were cryosectioned at 15pM. Results HoxA expression corresponds with specific novel AER-like domains in two distinct morphological modifications in the anterior pectoral and pelvic fins in the little skate During pectoral fin development in the little skate, HoxA 13 is expressed in a narrow stripe along the distal margin from the anterior tip to the distal mid fin at stage 29 (Fig. 2A). By stage 30, HoxAl 3 expression recedes to the anterior most region of the pectoral fin (Fig. 2B). This region was recently identified as a novel AER in the little skate, noted by Wnt3 and anterior 3 HoxA2-5 expression [20]. This HoxAl3 expression pattern mirrors that of Wnt3, with broad expression in the distal ridge of the pectoral fin at stage 29, which is then restricted to the anterior-distal ridge of the pectoral fin by stage 30 (Fig. 3). Thus, HoxAl3 expression is exclusively associated with the novel AER domain in little skate pectoral fin. Interestingly, there is another outgrowth domain in the anterior pelvic fin of the little skate that elongates during morphogenesis, which is distinct from the distal outgrowth that occurs in the anterior pectoral fin. The anterior lobes of the pelvic fin, known as the crura (crus when referring to a singular lobe), develop into a butterfly shape [27] in the little skate beginning at stage 30 (Fig. ID) [25]. This distinct AER domain is indicated by Wnt3 expression at stage 30 (Fig. 3). Wnt3 is expressed along the entire distal rim of the pelvic fin at stage 29, but by stage 30 was restricted to the anterior and posterior portions of the pelvic fin corresponding to the crura and claspers respectively. We found HoxAl 1 expression in the anterior region of the crura during pelvic fin morphogenesis, which is associated with Wnt3 expression. HoxAl 1 expression begins at stage 28, before the crura begins to form (Fig. 5 A), with peak expression of HoxAl 1 in the elongating crura at stage

14 6 30 (Fig. 5C). H oxall expression continues until developmental stage 31 (Fig. 5D), as outgrowth in the crura continues to form a distinctly elongated lobe (Fig. 1G). The posterior HoxA genes are expressed in broad domains during pelvic fin development In pelvic fins of the little skate, HoxA 13 expression is restricted to a region corresponding with the early developing claspers (Fig. 1D-G), supporting a role for HoxA13 in novel AERs in ancestral jawed vertebrates. Wnt3 is found to be expressed in the posterior pelvic fins from which the claspers will develop of the little skate (Fig. 3C). O Shaughnessy et al. [21] described the developing clasper bud as a novel AER indicated by sustained Fg/8, Greml and Shh expression along the posterior outgrowth region of the claspers, that remained present in males well after expression had subsided in distal pelvic fin AER in females (which lack claspers). We found HoxA13 expression occurs exclusively in developing claspers of males, with no expression in pelvic fins of females in the little skate (Fig.4 A/C/E/G), which indicates that this broad expression of HoxA13 differentiates the claspers from the pelvic fin. During pelvic fin development, H oxall displays an interesting and unique expressing pattern, with a broad expression domain that marks the posterior half of the pelvic fin at developmental stage 29 (Fig. 5A). This expression pattern later recedes to the region of the claspers by developmental stage 30 (Fig. 5B). It appears that H oxall is specifying posterior patterning, and is potentially marking this region as distinct in the pelvic fin of the skates. In tetrapods, H oxall has a broad expression range in the forearm, but does not expand to the distal autopod. HoxA 13 is thought to restrict H oxall expression during tetrapod limb development, and the lack of HoxA 13 expression in the pelvic fins, may explain why H oxall can be expressed in a broader domain. However, both HoxA 13 and H oxall are expressed in the developing claspers, suggesting a unique Hox code that specifies this distinct morphological region. This broad, posterior expression pattern of H oxall has not been documented, and may be unique to the batoids. Distal Phase HoxA expression occurs during clasper development

15 7 HoxD distal phase expression has been well documented in paired fins and limbs, with the most well-known example occurring in the mouse autopod, where HoxD 13 has a broader expression domain relative to HoxD 12 in the autopod, which specifies digit 1 as unique [7, 28]. HoxD DP expression has also been observed in the cartilaginous fishes, in the pelvic fins of the catshark [7]. In the little skate, HoxA13, along with HoxD12 and HoxD13, were expressed only in the claspers of males, with no expression in the pelvic fins of males or females. Interestingly, we found no HoxD DP expression in the paired fins of little skate. However, we identified what may be consistent with DP expression of the HoxA genes in claspers of the little skate, which could be considered a modified paired fin structure (Fig. 8). During pelvic fin development, both males and females express HoxA 11 in the anterior and posterior domains of the developing pelvic fins. In males, H oxall is expressed in the claspers throughout morphogenesis, and at stage 32, expression attenuates in the pelvic fins, but remains in the distal portions of the claspers in males. At stage 32, when H oxall is restricted to the distal regions of the claspers, HoxA 13 is expressed throughout the entire clasper. Mature male claspers are a complex structure, with multiple cartilaginous elements, folding, and asymmetry. It is likely that the H oxa ll DP expression may be associated with the complexity of this structure, H o xa ll expression is associated with support structures in paired fins. During pectoral and pelvic fin development, H oxall marks fin ray elements composed of cartilaginous radials that begin to develop proximally during early fin outgrowth (Fig. 6A). As the fins continue to expand distally, H oxall expression follows the distal leading edge of the fin ray elements through developmental stage 31, after which H oxall expression in the fin rays dissipates (Fig. 6). To understand how H oxall is associated with fin ray development, I quantified fin ray elements of cleared and stained specimens, and x-rays of adult specimens (Fig. 9), as well as bands of H oxall associated with the developing fin rays. Remarkably, the number of fin ray elements is set early in development, with elements clearly visible from stage 32 through adulthood (Fig. 9). We counted bands of H oxall expression at stages 28-31, which is approximately ten fewer than the total number of elements in mature fins. However it

16 8 was difficult to count expression bands precisely on the anterior and posterior fin boundaries where expression bands merged or pelvic fins overlapped, and therefore the number of HoxAl 1 bands was underestimated (Fig 9). Nonetheless, it is clear that the patterning of fin rays is specified by HoxAl 1 expression before development of cartilaginous condensations. For example, at stages 30 and 31 there are over 55 bands of HoxAl 1 expression, but only the fin rays in the mid pectoral fin have cartilaginous condensations visible by clear and stain, and chondrification lags slightly until stage 32, when the mature number of fin rays are present. At stages 28 and 29, HoxAl 1 expression is observed in a dorsal and ventral plane in both paired fins (i.e. illustrated expression is not offset in a proximal-distal pattern, but is actually expressed in overlapping dorsal and ventral planes). We sectioned the pectoral fin of embryos after whole mount in situ hybridization, which confirmed that HoxAl 1 is expressed in two planes (Fig. 7). However, sectioning of cleared and stained fins at a later stage of development revealed that cartilaginous condensations develop in the middle mesenchymal tissue of the fin, not on the dorsal and ventral planes where HoxAl 1 is expressed, suggesting that HoxAl 1 specifies regions for fin ray development and possibly marks inter-radial domains, in a dorsal/ventral fashion (Fig. 7). Discussion Expression of H oxal 1 and HoxA13 are associated with novel AERs during fin morphogenesis in a representative batoid In ray-finned fishes and cartilaginous fishes, HoxAl3 is expressed distally in the pectoral fin, with an overlapping expression of HoxAl 1 [7, 12, 13, 29], while in the tetrapod forelimb, HoxA 13 and HoxAl 1 are mutually exclusive in their expression domains, with HoxA13 expressed in the distal regions of autopod development [7]. This distal expression pattern of HoxAl 3 is associated with the AER, a major signaling center for fin and limb outgrowth located at the distal margin of the limb bud ectoderm [16, 19]. Wnt3 expression maintains the AER during limb development, and is considered an AER marker along with multiple Fgfs, Notchl and many other transcription factors [20, 30]. In

17 9 the pectoral fin of the little skate, Wnt3 was identified along the entire distal ridge of the fin at stage 29, which then persisted in a region of continued outgrowth in the anterior fin by stage 30 [20]. We found that in the little skate, HoxA13 is expressed in the anterior domain described as the novel AER in the skate pectoral fin (Fig. 2), but there is no expression in the posterior regions of the pectoral fin that would correspond with the ancestral AER in the catshark [8, 11]. In addition, there is no broad expression of HoxA 13 in the pectoral fin, similar to what is seen in the tetrapod autopod [16]. Interestingly, when little skate embryos are submitted to retinoic acid (RA) treatment, which regulates Hox genes, anterior extension of the pectoral and pelvic fins fails, resulting in a more shark like morphology [3], Taken together, these data indicate that HoxA 13 expression in the paired fins of a representative batoid (little skate) has a derived expression pattern from tetrapods. In tetrapods, HoxA 13 is expressed in a broad domain while marking the AER during autopod development. However in the little skate, HoxA 13 expression is more restricted to the distal ends of the fin in a striped domain. In the little skate, we demonstrated that HoxA13 expression is associated with a novel AER in the anterior pectoral fin, and H oxall expression is associated with a morphologically different AER in anterior pelvic fin (Fig. 5). While the proximal/distal expression pattern of H oxall and HoxA 13 may be ancestral, what we are finding is that derived lineages which have undergone modifications in fins and limbs show novel expression patterns to develop unique features such as the mammalian autopod and the elongated pectoral fins o f the little skate. H o xa ll and HoxA13 m ark broad domains in posterior regions of fin/limbs with novel morphologies During clasper development, HoxA 13 expression marks the posterior domain of the pelvic fins of males, in a sexually dimorphic expression pattern. Claspers begin to bud from the posterior pelvic fin at developmental stage 30, meaning that earlier stages of the little skate cannot be sexed. However, HoxA 13 is expressed in the region of the clasper anlagen in half of the embryos evaluated at stages 28 and 29 (n= 4 st. 28; n=6 st. 29),

18 10 suggesting sex specific differences during the onset of clasper specification (Fig. 4 A-D). At stages 30-31, when clasper morphogenesis is apparent, HoxA13 continues to he expressed in the developing claspers of males, with no corresponding expression in females, indicating that HoxA13 expression is specific to clasper development and is accordingly, sexually dimorphic (Fig. 4 E-H). The posterior HoxD genes, HoxD12 and HoxD 13, are also sexually dimorphic during clasper development, with expression not present in female little skates, and restricted to the claspers during development [21]. Indeed, there was no HoxA 13 expression in the posterior/distal regions of developing pectoral or pelvic fins in the little skate, contrary to what has been observed in the fins of catshark [11] zebrafish [13] and paddlefish [12], and the limbs of frog [9] and chick [10]. While HoxA 13 is sexually dimorphic in the little skate, H oxall is expressed in both males and females during pelvic fin development, with expression characterized in the anterior region of the crura, and the posterior half of the pelvic fin, including the claspers of males. In the little skate, we see mutually exclusive HoxA 13 and H oxall expression domains that are reminiscent of the zeugopod/autopod domains [31, 32]. While H oxall is also expressed during clasper morphogenesis, there appear to be shared characteristics among expression patterns of skates and mammals, suggesting a shared GRN that has been modified during forelimb development in mammals. First evidence of HoxA DP expression in a paired fin domain While the DP expression pattern was thought to be unique to the HoxD genes in paired fins/limbs, HoxA DP expression was recently discovered in 5 HoxA genes during development of a medial structure in three ray-finned fishes [33]. While both HoxA and HoxD contribute to the fin and limb patterning during development, the majority of studies have focused on the 5 HoxD genes, while the role of the posterior HoxA genes in morphological evolution are relatively understudied. In the pectoral and pelvic fins of the catshark, HoxD12 and HoxD13 exhibit a DP expression pattern similar to what is observed in tetrapods, with HoxD 13 extending further up the distal portions of the fin

19 11 than HoxD12 [8]. We found no evidence of DP expression pattern for the HoxD genes, with both HoxD12 and HoxD13 exclusively expressed in the claspers, and no expression in the pelvic fins (this study, [21 ]). However, we do see a pattern that might be consistent with HoxA DP expression during clasper development. While both HoxAl 1 and HoxA 13 are expressed in similar domains during clasper development (stage 32), HoxAl3 continues to be broadly expressed in the clasper, while HoxAl 1 is restricted to the distal and posterior clasper, overlapping with HoxAl3 (Fig. 8). This DP expression pattern is likely setting up left-right asymmetry, as clasper growth will continue and cartilaginous elements will develop until the skate reaches sexual maturity. The HoxA and HoxD genes have a shared regulatory region associated with DP expression, including long range enhancer elements and 5 regulatory architecture [32, 34], suggesting a common origin in the ancestral Hox cluster. H oxal 1 is associated with development of support structures in pectoral and pelvic fins HoxAl 1 is expressed in association with the developing fin rays in pectoral and pelvic fins of the little skate. This expression pattern was also illustrated, but not described, in the developing fins of the catshark [11]. In zebrafish, HoxAl3 expression is associated with the developing fin rays [24], but HoxAl 1 was not evaluated. We found no evidence for HoxAl3 expression in the fin rays in the little skate, despite strong HoxAl3 expression in other areas of fin outgrowth and development. This suggests that HoxAl 1 is associated with patterning of fin rays in the cartilaginous fishes, and HoxAl3 may have been coopted in fin ray expression in ray-finned fishes. By comparing HoxAl 1 expression bands in pectoral fins with cartilaginous condensations in cleared and stained juveniles, and x-rays of older specimens, we discovered that the number of fin rays is specified early in development and stays consistent through adulthood (Fig. 9). Fin rays are pre-established by HoxAl 1 expression along the dorsal and ventral margins of paired fins, followed by chondrification in the mid-mesenchymal

20 12 tissue (Fig. 7). We can observe what appears to be waves of cartilage that correspond to the individual radial elements of the fin rays at stage 30 (Fig. 7B). Interestingly, in the little skate, paired fins develop from continuous finfolds that extend laterally down the sides of the body from the region just posterior to the head through the cloaca (Fig. 1). At stage 27, H oxall expression occurs in a continuous field along this entire domain (Fig. 6A). Yet by stage 28, the pectoral and pelvic fins are differentiated, and HoxA 11 expression specifies the fin rays within these paired fin domains, and the finfold tissue between pectoral and pelvic fins is no longer present. This developmental scheme might be consistent with the fin fold theory proposed by Thacher [35], which suggests that paired fins evolved as the retained portions of a continuous lateral fin on either side of the body (Mivart [36] and Balfour [37], and described in Tulenko, McCauley [38]). Freitas [39] argued that paired fins evolved from median fins based on shared HoxD expression patterns. HoxA expression patterns also inform aspects of the origin of fin/limbs such as the HoxAll pattern we see in fin rays of the little skate, but to our knowledge HoxA expression has not been evaluated in medial fins of jawless or ancestral jawed vertebrates. Conclusions The batoids exhibit fin modifications that provide a unique opportunity to investigate the role of Hox genes in novel morphologies. HoxA genes are relatively understudied and we provide evidence that the posterior HoxA genes play distinct roles in two novel AERs during skate fin development, one of which is newly described here. Further, the little skate exemplifies unique Hox expression patterns differing from the catshark, including large posterior domains of H oxall in the pelvic fin (Fig. 10). We have identified that the posterior HoxA genes play a significant role during fin development of a representative batoid, and it is intriguing to investigate other lineages to identify how these genetic modules are expressed in the diverse array of body plans

21 13 References 1. Oulion, S., et al., Evolution o f Hox Gene Clusters in Gnathostomes: Insights from a Survey o f a Shark (Scyliorhinus canicula) Transcriptome. Molecular Biology and Evolution, (12): p Wourms, J.P. and L.S. Demski, The reproduction and development o f sharks, skates, rays and ratfishes: introduction, history, overview, and future prospects, in The reproduction and development o f sharks, skates, rays and ratfishes. 1993, Springer, p Gillis, J.A. and N.H. Shubin, The evolution o f gnathostome development: Insight from chondrichthyan embryology, genesis, (12): p Coates, M.I. and M.J. Cohn, Fins, limbs, and tails: outgrowths and axial patterning in vertebrate evolution. BioEssays, (5): p Duboule, D., Vertebrate hox gene regulation: clustering and/or colinearity? Curr Opin Genet Dev, : p Graham, A., N. Papalopulu, and R. Krumlauf, The murine and Drosophila homeobox gene complexes have common features o f organization and expression. Cell, : p Schneider, I. and N. Shubin, The origin o f the tetrapod limb: from expeditions to enhancers. Trends Genet, : p Freitas, R., G. Zhang, and M.J. Cohn, Biphasic Hoxd Gene Expression in Shark Paired Fins Reveals an Ancient Origin o f the Distal Limb Domain. PLoS ONE, (8): p. e Ohgo, S., et al., Analysis ofhoxall and hoxal3 expression during patternless limb regeneration inxenopus. Developmental Biology, (2): p Nelson, C., et al., Analysis o f Hox gene expression in the chick limb bud. Development, : p Sakamoto, K., et al., Heterochronic Shift in Hox-Mediated Activation o f Sonic hedgehog Leads to Morphological Changes during Fin Development. Plos One, (4).

22 12. Davis, M.C., R.D. Dahn, and N.H. Shubin, An autopodial-like pattern o f Hox expression in the fins o f a basal actinopterygian fish. Nature, (7143): p Ahn, D. and R. Ho, Tri-phasic expression o f posterior Hox genes during development ofpectoral fins in zebrafish: implications for the evolution o f vertebrate paired appendages. Dev Biol, : p Fromental-Ramain, C., et al., Hoxa-13 and Hoxd-13play a crucial role in the patterning o f the limb autopod. Development, (10): p Burke, A.C., et al., Hox genes and the evolution o f vertebrate axial morphology. Development, (1): p Lu, P.F., et al., The apical ectodermal ridge is a timer for generating distal limb progenitors. Development, (8): p Mercader, N., Early steps ofpaired fin development in zebrafish compared with tetrapod limb development. Development Growth & Differentiation, (6): p Thorogood, P., The Development o f the Teleost Fin and Implications for Our Understanding o f Tetrapod Limb Evolution, in Developmental Patterning o f the Vertebrate Limb, J.R. Hinchliffe, J.M. Hurle, and D. Summerbell, Editors. 1991, Springer US: Boston, MA. p Laufer, E., et al., Expression o f radical fringe in limb-bud ectoderm regulates apical ectodermal ridge formation. Nature, (6623): p Nakamura, T., et al., Molecular mechanisms underlying the exceptional adaptations ofbatoid fins. Proceedings of the National Academy of Sciences of the United States of America, (52): p O'Shaughnessy, K.L., R.D. Dahn, and M.J. Cohn, Molecular development o f chondrichthyan claspers and the evolution o f copulatory organs. Nature Communications, LaMarca, M.J., The functional anatomy o f the clasper and clasper gland o f the yellow stingray, Urolophus Jamaicensis (Cuvier). Journal of Morphology, (2): p O'Shaughnessy, K.L., R.D. Dahn, and M.J. Cohn, Molecular development o f chondrichthyan claspers and the evolution o f copulatory organs. Nat Commun, Nakamura, T., et al., Digits andfin rays share common developmental histories. Nature, (7619): p Maxwell, E.E., N.B. Frobisch, and A.C. Heppleston, Variability and Conservation in Late Chondrichthyan Development: Ontogeny o f the Winter Skate (Leucoraja ocellata). The Anatomical Record: Advances in Integrative Anatomy and Evolutionary Biology, (9): p Wilkinson, D. 1992: Oxford University Press: IRL Press. 27. Koester, D.M. and C.P. Spirito, Punting: An unusual mode o f locomotion in the little skate, Leucoraja erinacea (Chondrichthyes : Rajidae). Copeia, 2003(3): p

23 28. Montavon, T., et al., Modeling Hox gene regulation in digits: reverse collinearity and the molecular origin o f thumbness. Genes Dev, : p Metscher, B.D., et al., Expression o f Hoxa-11 and Hoxa-13 in the pectoral fin o f a basal ray-finnedfish, Polyodon spathula: implications for the origin o f tetrapod limbs. Evolution & Development, (3): p Femandez-Teran, M. and M.A. Ros, The Apical Ectodermal Ridge: morphological aspects and signaling pathways. International Journal of Developmental Biology, (7): p Zakany, J. and D. Duboule, The role o f Hox genes during vertebrate limb development. Current opinion in genetics & development, (4): p Woltering, J., et al., Conservation and divergence o f regulatory strategies at Hox Loci and the origin o f Tetrapod digits. PLoS Biol, : p. el Archambeault, S., J. Taylor, and K. Crow, HoxA and HoxD expression in a variety o f vertebrate body plan features reveals an ancient origin for the distal Hox program. EvoDevo, (1): p Theodosiou, N.A., D.A. Hall, and A.L. Jowdry, Comparison o f acid mucin goblet cell distribution and Hoxl 3 expression patterns in the developing vertebrate digestive tract. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution, B(4): p Thacher, J.K., Median and paired fins, a contribution to the history o f vertebrate limbs. Trans. Conn. Acad. Sci., : p Mivart, S.G., Notes on the Fins o f Elasmobranchs, with Considerations on the Nature and Homologues o f Vertebrate Limbs. The Transactions of the Zoologoical Society of London, (10): p Balfour, F., On the development o f the skeelton o f the pairedfins o f Elasmobranchii, considered in relation to its bearing on the nature o f the limbs o f the Vertebrata. Proceedings of the Zoological Society of London, (3): p Tulenko, F.J., et al., Body wall development in lamprey and a new perspective on the origin o f vertebrate pairedfins. Proceedings of the National Academy of Sciences of the United States of America, (29): p Freitas, R., G.J. Zhang, and M.J. Cohn, Evidence that mechanisms o f fin development evolved in the midline o f early vertebrates. Nature, (7106): p

24 16 lnim i»rftw iiit» R i AS Figure 1. Developmental staging scheme for the little skate, Leucoraja erinacea, spanning early pectoral and pelvic fin development (A-C) and later pelvic fin development (D-G). Early development shows the pectoral and pelvic fin buds extending from the midline of the body. Sexual dimorphism is not observed at these stages (A-C). At developmental stage 30, the claspers begin to differentiate in the posterior pelvic fin region of males (denoted by black arrows in D), with a slight indentation and hook shape in the posterior pelvic fin that does not manifest in females. The crura also begin to form as the anterior pelvic fins begin to extend distally at this stage (D). By stage 32 the claspers are morphologically distinct (F), and by stage 33, the claspers form a separate lobe consisting of a rolled structure (G). Likewise, the crura will continue to elongate distally, forming a separate lobe (E-G). Asterisks indicate crura on both males and females.

25 17 Gene Forward (5-3 ) Reverse (5-3 ) H oxa ll GATGAGCGGGTTCCTTGTGGC GGT GGAGAAGGAGAC GAGT C HoxA 13 GC AGG AATTT GAT GGCCC AT CACCTCTGGAAGTCGAGTCT HoxD 11 GGCCAAGATTTCTCGACAGT AGTTGACCGAAAAGTCCGTG HoxD 12 C AGCTGGC AAGT CTGT C AC TCTCCCTCTGT AAAT GAAGGC HoxD 13 CT GC ATTT GGAGC AC AT C AC CT AAT GGCTGGAATGGT C AAG Table 1. Primers used for in situ hynrid ation probes a \A Figure 2. HoxA 13 exhibits a unique expression pattern in a novel AER in the anterior pectoral fin of the little skate. Broad expression of HoxA13 is first noted at stage 29 of development along the distal portion of the pectoral fin, with expression restricted at the distal mid fin (A). By stage 30, HoxA 13 is restricted to the anterior most portion of the pectoral fin, where a novel AER was identified using Wnt3 expression, along with other

26 AER genetic markers [20], indicating that HoxAl3 is associated with this novel AER (B). Black arrows denote where the expression ends in the fin. 18 HoxA13 HoxAl 1 Wnt3 M ale M ale Figure 3. Expression of HoxAl3, HoxAll and Wnt3 in little skate pectoral and pelvic fins. Wnt3 is broadly expressed in the entire distal domains of the pectoral and pelvic fin at stage 29 of development, but then recedes to the anterior domains of the pectoral fin and the anterior and posterior domain in the pelvic fin (C). In the pectoral fins, HoxAl3 overlaps with the anterior Wn/3 expression, indicating that HoxAl3 is associated with this novel AER (A). Similarly, in the pelvic fins, HoxAll expression overlaps with Wnt3 in the anterior pelvic fins, where the crura will bud out and elongate (B). Wnt3 images are courtesy of Nakamura [20].

27 19 Male Female I f t *IM &3 d S ft 3 H t w Figure 4. HoxA 13 expression is sexually dimorphic in the claspers of males, and is not expressed in pelvic fins. At developmental stages 28 and 29, sex cannot be determined as the claspers have not yet begun to differentiate, however HoxA 13 expression was seen in approximately half of all embryos, indicating that HoxA 13 is patterning the claspers before they form (A-D). Once the claspers have budded from the pelvic fins, HoxA 13 expression is only in the claspers, and has no expression in the pelvic fins of males or females (E-H). Stage 28 Stage 29 Stage 30 Stage 31 Figure 5. HoxAll marks a novel AER in the anterior pelvic fins. Expression begins faintly at stage 28 (A), and comes on strongly by stage 29 (B), turning off after stage 31 (D). It appears that HoxAll is associated with a novel AER, and assisting with the distal outgrowth of the crura. Interestingly the crura does not begin to bud until stage 31 (C), indicating that H oxall begins to pattern the crura before elongation occurs.

28 Figure 6. H oxall is associated with the developing fin rays in the pectoral and pelvic fins. HoxAll expression begins proximally in the pectoral and pelvic fins in small stripes that correspond to fin ray development (A,A ). As the fins continue to elongate, HoxAll expression follows the distal leading edge of the developing fin rays, until stage 31 which is the last stage expression is noted (B-E). Boxed areas (A,D) show where magnification (A,D ) was taken. D Fig. 7. HoxAll in the pectoral fin of the little skate at stage 29 (A) and clear and stain in the pectoral fin at stage 30 (B). The black lines indicate where the sections were taken. The black arrows in the section depict faint staining in the fin rays, indicating that HoxAll is not in the fm rays themselves, but parallel to where the fin rays will form (C). The section of the cleared and stained individual confirms that the fm rays form in the middle of the fin, and the black arrows point to grooves that run perpendicular from the fin rays, and may be where HoxAll is expressed (D).

29 21 HoxAll HoxA13 Figure 8. First evidence of distal phase expression of HoxAll in paired structures. In situ hybridization showing HoxA 13 is expressed broadly in the entire clasper (B), whereas HoxAll is restricted to the distal portion of the clasper (A). It is likely that HoxAll is assisting with setting up left-right asymmetry in the clasper. Black arrows note HoxAll expression (A) in the claspers at stage 32 of development.

30 23 Fin ray counts in the pectoral fin o f the Little Skate * C? oi 55,c E g i 1» * H oxa li Clear/Stain X-RAY Stage 28 Stage 29 Stage 30 Stage 31 Stage 32 Stage 33 Pre-hatch wks wks wks J 30+ wks Adult Figure 9. Pectoral fin ray counts of the little skate during development. Blue points indicate cleared and stained specimens, purple indicates HoxAll in situ hybridization specimens, and grey points are taken from x-rays of adults. HoxAll expression does not vary during development, indicating that the number of fin rays is set early on in development. After 26 weeks of development expression of HoxAll turns off and cartilaginous condensation is present in all fin rays, with a total number of fin rays per individual. A lower count of HoxAll may be due to the inability to count individual fin rays at the anterior and posterior ends of the pectoral fin, resulting in a slight difference of total fin rays for HoxAll and clear/stained individuals. Development in weeks is located under developmental stage. N=4, st. 28; N= 5, st. 29; N=5, st 30; N=5, st. 31; N=5, st. 32; N=6, st. 33; N=7, Pre-Hatch; N=3, Adult.

31 23 Wr»fJ HoxA13 HoxAll V / M*le Fem**p Figure 10. Cartoon illustrating expression of HoxA13 and HoxAll during development of paired fins in the little skate (Leucoraja erinacea). HoxA13 and HoxAll expression mirrors expression of Wnt3 in the novel AER domains in the pectoral and pelvic fins, respectively. Note that Wnt3 is expressed in both anterior AER domains, but each is patterned by a different HoxA gene. HoxAll has unique expression profiles in a novel AER region in the pelvic fin that is associated with a distal outgrowth called the crura, in developing fin rays, and marks a broad domain in the posterior half of pelvic fin during St. 28. HoxA13 is not expressed during crura development in the pelvic fin, but is expressed in the novel AER in the anterior pectoral fin, and the modified posterior region o f the claspers. Wnt3 expression provided by Nakamura [20].