binds multiple sites within the aroh and

Transcription

1 Downloaded from genesdev.cshlp.org on November 14, Publshed by Cold Sprng Harbor Laboratory Press Eschercha cod tryptophan repressor bnds multple stes wthn the aroh and trp operators Andrew A. Kumamoto, ~ Wllam G. Mller, 2 and Robert P. GunsalusL2 1Molecular Bology nsttute and the 2Department of Mcrobology, Unversty of Calfoma, Los Angeles, Calfoma USA DNase footprntng and methylaton protecton studes have been used to analyze the bndng of Eschercha col Trp repressor to the trpr, aroh, and trp operators. The methylaton protecton assay shows that Trp repressor bnds n two successve major grooves of the trpr operator, three successve major grooves of the aroh operator, and four successve major grooves of the trp operator. The smplest model that explans the dfference n Trp repressor nteracton at the three operators s that the aroh and trp operators are composed of multple, helcally stacked bndng stes. When vewed n three dmensons, each ste s postoned on a dfferent face of the DNA, and together process up the surface of the DNA helx. Analyss of a deleton dervatve of the trp operator supports ths model. [Key Words" Trp repressor; aroh operator; trp operator; repressor bndng] Receved February 23, 1987; revsed verson accepted June 6, The Trp repressor of Eschercha col coordnately regulates the expresson of the trp, aroh, and trpr operons n response to the ntracellular levels of L-tryptophan (Cohen and Jacob 1959; Brown 1968; Rose et al. 1973; Gunsalus and Yanofsky 1980). The trpr operon, located at 99.5 mn, codes for the Trp aporepressor and s autoregulated (Morse and Yanofsky 1969; Gunsalus and Yanofsky 1980; Kelley and Yanofsky 1982; Bachman 1983; Gunsalus et al. 1986). The aroh operon, located at 37 mn, encodes one of the three sozymes of 3-deoxy- D-arabno-heptulosonc acd-7-phosphate synthetase (DAHP). Ths enzyme catalyzes the frst step n the common pathway of aromatc amno acd bosynthess (Brown 1968; Pttard et al. 1969; Zurawsk et al. 1981). The thrd operon, trp, s located at 27 mn on the E. col genetc map and encodes the enzymes that carry out the fnal steps of L-tryptophan bosynthess from the cellular ntermedate, chorsmc acd (Yanofsky 1971). The natve form of the Trp aporepressor s a dmer composed of dentcal subunts of 108 amno acds (Gunsalus and Yanofsky 1980; Joachmak et al. 1983; Arvdson et al. 1986). Bndng of the corepressor, L-tryptophan ncreases the affnty of Trp repressor for operator DNA, leadng to the formaton of the ternary repressor DNA complex (Rose et al. 1973). The bndng of Trp repressor to ts operators nhbts the ntaton of transcrpton of the trpr, aroh, and trp operon messages by preventng RNA polymerase from bndng to the promoters (Oppenhem et al. 1980). The physcal locaton of the trp operator was prevously defned by deleton studes (Bennett et al. 1976) and by the solaton of consttutve mutatons wthn the trp operator {Bennett and Yanofsky 1978). These operator consttutve mutatons map at postons -16, -15, -7, and -6 n the trp promoter sequence. The DNA sequences of the trpr and aroh operons reveal stes that exhbt sgnfcant sequence homology to the trp operator (Gunsalus and Yanofsky 1980; Sngelton et al. 1980; Zurawsk et al n Fgure 1, the sequences of the three operators are algned to show max- trpr aro H -o TGCTATCGTACTCTT :::: :..... ~so :::: 4o ;..... GCCGAATGTACTAGAG ::::~ ;..... AATCATCGAACTAGT" ' AGCGAGTACAACCGGGG A.AdTAG+~CATTAGCTT :-0 " " " + ACTAG+ACGCXAGTTC Fgure 1. DNA sequence comparson of the operator regons of the trpr, aroh, and trp operons. The nucleotde sequence of each operator regon s numbered relatve to the start of transcrpton. Sequence smlarty between the operators s ndcated by the vertcal dashes The sold vertcal double-headed arrow represents the sequence axs of symmetry. The comparson of the trpr and aroh operators shows conservaton of 13 of 22 base pars, the aroh and trp sequences have 15 of 22 conserved base pars, whle the trpr and the trp operator regons show 16 out of 22 conserved base pars No conservaton of DNA sequence s seen n the flankng regons of the three operators. 556 GENES & DEVELOPMENT 1: by Cold Sprng Harbor Laboratory SSN /87 $1.00

2 trpr, aroh, and trp operators mum dentty. The bndng of Trp repressor at the trpr and aroh operators was demonstrated by a Rsa endonuclease protecton assay (Gunsalus and Yanofsky 1980; Zurawsk et al. 1981). n ths assay bound Trp repressor protects a Rsa endonuclease ste, located n the operator, from cleavage by Rsa. n ths report, we explore the specfc nteractons between the E. col Trp repressor and the trpr, aroh, and trp operators by bochemcal protecton experments. These nteractons are defned by the ablty of Trp repressor to protect each operator from methylaton by the alkylatng agent dmethyl sulfate, or cleavage by the endonuclease DNase. Comparson of the Trp repressor nteractons shows that Trp repressor nteracts dfferently at each operator. The smplest hypothess that accounts for our data s that Trp repressor bnds multple, helcally stacked stes. Results DNase footprntng of Trp repressor at the trpr, aroh, and trp operators shows dfferng domans of protecton We have determned the DNase footprnts of Trp repressor at the trpr, aroh, and trp operators. DNase -dependent cleavage reactons were performed n the pres- ence and absence of Trp repressor over a range of dfferent DNA and proten concentratons. DNase footprnts of the trpr, aroh, and trp operators are shown n Fgure 2. The DNase cleavage pattern for the trpr operator n the presence of Trp repressor reveals nteractons that extend from postons - 10 to + 15 on the top strand of the trpr operator and from postons - 14 to + 12 on the bottom strand. These results are summarzed n Fgure 3, and show that the ste protected by Trp repressor extends over a 30-bp regon, s centered at the start pont of transcrpton, and overlaps the -10 regon of the trpr promoter. The DNase pattern for the Trp repressor nteractons at the aroh operator s shown n Fgure 2B. Protectons extend from postons -46 to -22 on the top strand and from postons -54 to -21 on the bottom strand. Trp repressor protects a 33-bp regon that overlaps the -35 regon of the aroh promoter. Fgure 2C depcts the changes n the DNase cleavage pattern of the trp operator n the presence of Trp repressor. These nteractons extend from postons -23 to + 8 on the top strand and from postons -27 to + 8 on the bottom strand. nteractons between the Trp repressor and the trp operator span 35 bp, and overlap the -10 regon of the trp promoter. Ths regon has also A trpr B aro/-/ C trp B T B G-+ G-+ G-+ T B T G-+ G-+ G , +!7.\ ~. +16~ +15~ ~ +4- _ = 23_, t Em o ~ m... ~glpo o ~ " O O ~ald g o -49-, ~--= -32- " " _ z m ! Fgure 2. DNase footprnt of Trp repressor bndng at the trpr, aroh, and trp operators. (A, B, and C) DNase footprnts of the trpr, aroh, and trp operators, respectvely. n each panel, the G lanes show the DNA guanne cleavage sequence reacton for the bottom {B) and top (T) strands {A > G reacton for aroh) and are used as a reference to algn the DNA sequence for the DNase reacton lanes. The DNase footprnt ladder for each strand n the presence ( + ) and absence (-) of Trp repressor s ndcated. Numberng of the DNA sequence s relatve to the start of transcrpton GENES & DEVELOPMENT 557

3 Downloaded from genesdev.cshlp.org on November 14, Publshed by Cold Sprng Harbor Laboratory Press Kumamoto et al. Fgure 3. Summary of the DNase footprnt and methylaton protecton results for Trp repressor bndng at the trpr, aroh, and trp operators. The vertcal double-headed arrow represents the DNA sequence axs of symmetry as shown n Fg. 1. The brackets above and below the DNA sequences ndcate the DNase -protected regons (Fg. 2) of each operator for each strand. Guanne resdues represented n boldface ndcate bases that show decreased methylaton by dmethylsulfate n the presence of Trp repressor relatve to operator DNA alone. been dentfed genetcally by consttutve mutatons (Bennett and Yanofsky 1978). The DNase protecton data for the trpr, aroh, and trp operators are compared n Fgure 3. Trp repressor protects a dfferent number of base pars at each operator from DNase cleavage. The protected regon vares from 30 bp for the trpr operator to 35 bp for the trp operator, and the number and locaton of repressor-nduced hypersenstve DNase cleavage stes n each operator dffers. The protected domans for the aroh and trp operators extend beyond the homologous regon of the operators (Fg. 1). Methylaton of each operator by dmethyl sulfate The results of the DNase protecton experments show that the regon of each operator protected by Trp repressor dffers n length. To determne whether ths result s due to an dosyncrasy of the partcular DNAmodfyng agent we used, we examned the nteracton of the Trp repressor wth each operator usng the chemcal methylatng agent dmethyl sulfate. n ths method, the ablty of bound Trp repressor to alter the reactvty of purne mno groups wth dmethyl sulfate s revealed by changes n the methylaton-dependent cleavage at partcular guanne or adenne resdues. Data obtaned from these studes are shown n Fgure 4. The bndng of Trp repressor at the trpr operator causes reduced methylaton n the top strand for guannes at postons -9, +2, +4, and +6. n the bottom strand, guannes at -6, -4, and +9 show reduced methylaton. ncreased methylaton s not detected at resdues n ether strand. These nteractons extend from -9 to +9, and span 18 bp (Fg. 3). No changes were seen n the cleavage pattern of the adennes, ndcatng that Trp repressor does not make contacts wth the 3-mno groups of adennes n the mnor groove (data not shown). The effect of Trp repressor bndng on the methylaton of the aroh operator s shown n Fgure 4B. For the top strand, reduced methylaton s seen for guanne resdues at -46, -32, and -24. The guanne at poston -24 s weakly protected from methylaton. ncreased methylaton s seen for guannes at postons -30, -38, and -40. n the bottom strand, reduced methylaton s seen trpr aro H trp A : 'l - 7 GATATGC TATC ---~TACTCTT T;AGCGAGTAC, AACC GGGGGAGGC AT C TATACGAT AGCATGAGAAATCG CTCATGTTGG C,j CCC TCCG TA t -] ' ,, ~ AGTCG r" F-r~AATGTA CTAGAGAACTAGTGC ATTAGCTTATTTTTTT TCAGCOSCTTACATGATCTCT TGATC ACGTAATC GAATAAAAAAA T_ -3-- J ~ : 1 ~ F AA rtaatcatcgaac TAGT~AACTAGTAC GCAAGTTCA~C GTAAAA TTAATTAGTAGCTTGATCAAJTTGATCATGCGTTCAAGT GCATTTT -E l t at guannes at -43, -35, and -29. No ncreased methylaton of any guanne resdue s observed wthn the bottom strand of the operator regon, and no changes n the methylaton pattern of adennes are observed for ether strand of the aroh operator (data not shown). The methylaton data for the aroh operator are summarzed n Fgure 3. Methylaton protectons extend from postons -46 to -24 and span 23 bp. The methylaton protecton pattern of the trp operator s shown n Fgure 4C. For the top strand, changes occur at guannes at postons - 14, -6, and + 3. The guanne at poston +3 shows weak protecton. n the bottom strand, changes occur at guannes at postons -24, - 17, - 9, - 3, and + 6. The guannes at postons - 24 and + 6 show weak protecton. No changes n the methylaton at adenne resdues were seen for ether strand (data not shown). The results for both strands of the trp operator are summarzed n Fgure 3. Methylaton protectons extend from postons -24 to + 6 and span 30 bp. Comparson of the methylaton data for the three operators reveals that Trp repressor nteracts dfferently at each operator (Fg. 3). The sze of the operators defned by ths method vares from 18 bp for trpr, to 23 bp for aroh, and 30 bp for trp, dfferng n ncrements of 5-7 bp. The szes of the trpr, aroh, and trp operators defned by methylaton are smaller than the szes defned by DNase footprntng. However, the operators are unquely ranked n sze by both methods. The results obtaned by both methods suggest that the Trp repressor makes dfferent, specfc contacts n each operator. The trp operator s comprsed of multple bndng stes One hypothess that accounts for these results s that Trp repressor bnds multple stes n the aroh and trp operators. To test ths hypothess, we constructed a plasmd that carres a deleton of the left porton of the trp operator (Fg. 5). We refer to the operator sequence on ths plasmd as the mutant trp operator. To examne the bndng of Trp repressor at ths ste, we performed DNase and methylaton protecton studes. As shown n Fgure 6, the mutant operator s protected from methylaton and from DNase cleavage n the presence of Trp repressor. The results of these studes are summarzed n 558 GENES & DEVELOPMENT

4 Downloaded from genesdev.cshlp.org on November 14, Publshed by Cold Sprng Harbor Laboratory Press trpr, aroh, and trp operators ! A rrpr f3 uro/-/ O /rp B f T B T -54~ W -52,7 nm -51 ~:; -45- ~ 11~ -~ u _3o_ m -32- B T UU 4-- t,, O~ -47"~2~ -~ - : od -20- ~q, "'' -58- ~~ -9- oa ~ -14- ~,. all -6- ~.~ ~ ~ "-, ~ ~ ~.,, "~ ~ ~ ,, ll Fgure 4. Methylaton protecton patterns of the trpr, aroh, and trp operators. DNA methylaton of the three operators by dmethylsulfate n the presence and absence of Trp repressor are shown n A (trpr, B (aroh), and C {trp). DNA methylaton patterns for the top (T) strand and the bottom (B) strand are ndcated for each operator n the presence ( + )or absence (-) of Trp repressor. Numberng of the gel ladder s relatve to the start of transcrpton. Fgure 5. Contacts n the homologous portons of the mutant and wld-type trp operators show dentcal protecton patterns wth ether assay. However, no protecton of bases from methylaton s observed for the mutant operator n the nonhomologous regon substtuted for the base pars to the left of the axs of symmetry. Moreover, the extent of DNase protecton n ths substtuted regon s reduced by 10 bp. These results show that at least two Trp repressor bndng stes comprse the trp operator, one of whch s entrely conserved n the mutant operator, and one of whch s at least partally mssng n the mutant operator (Fg. 5). n add- ton, the relatve degree to whch guanne resdues are protected by saturatng Trl0 repressor at homologous postons n the mutant trp and wld-type trp operators s nearly the same (data not shown), whch ndcates that the maxmal occupancy of Trp repressor for the respectve bndng stes s approxmately equal. Dscusson Our results show that Trp repressor nteracts dfferently wth the trpr, aroh, and trp operators. There are dfferences n the extent of Trp repressor nteractons, as de- mutant wld type V//////////////////////////////~ '-0 +1 "10 CACCGAAACG~GCGAGGCA ---L-- G A A C TAGTACG C AAGTTC--~GT AAA A G TGGC TTTGCGCGC TCC GTGTT~ATCAT~CGTTCAA~TGC t tl T AT TT T AA TT AAt~ AT C G AAC TAGTTAA C TAGTAbGC AAGTTC/~ C G TAAAA TTAATTA~TAGCTT~ATCAATT~ATCAT~CGTTC [ ' V AA~TGCATTTT Fgure 5. Summary of the DNase and methylaton protecton results for the mutant trp operator. The vertcal double-headed arrow represents the axs of DNA symmetry of the trp operator as drawn n Fg. 1. The regon of the wld-type trp operator deleted n the mutant trp operator s ndcated by the bar above the sequence. The brackets above and below the DNA sequences ndcate the regons of DNase protecton. The methylaton protecton results for Trp repressor bndng at the half-operator are ndcated for bases that show decreased methylaton {bold). The trp operator methylaton and DNase data are from Fgs. 2 and 4. GENES & DEVELOPMENT 559

5 Kumamoto et al. A ---- B T.-F-- B B T G -+ G O -259" 11p : g S m / = = '~ ~ = : -267_ ~ " ' _ o ~ ~ -261f ~ "" " -26 n ~ ~ " ~ J -267_ ~ ; ,: ~ m ~ '~-... ~ ~ ~ a ~ ~ ~ ~ ~ ~ - O ~ ~ Q ~ Q +9-,~ ,~. Fgure 6. DNase footprntng and DMS methylaton protecton of the mutant trp operator by Trp repressor. DMS methylaton and DNase reactons are shown n A and B, respectvely. Reactons were performed as descrbed n Fgs. 2 and 4 and n Materals and methods. The bottom (B) and top (T) strands are ndcated. The numberng of the DNA sequence ladder s relatve to the start of trp operon transcrpton. fned by both assays (Fg. 3). For the trpr operator, 18 bp are protected from methylaton and 30 bp are protected from DNase dgeston. For the aroh operator, 23 bp are protected from methylaton and 33 bp are protected from DNase dgeston. For the trp operator, 30 bp are protected from methylaton and 35 bp are protected from DNase dgeston. The smplest hypothess to account for these dfferences s that the aroh and trp operators are composed of multple, helcally stacked Trp repressor bndng stes. Fgure 3 llustrates that the smplest operator bound by Trp repressor s the trpr operator. We assume that the trpr ste s bound by a sngle repressor dmer and s composed of two operator half-stes. Sx of seven guannes protected n ths operator are symmetrcally pared about ts dyad axs and are n two consecutve major grooves on one face of the helx. A nearly symmetrc pattern of protected guannes n two consecutve major grooves s seen for the bndng of other dmerc repressor protens, ncludng h Cro proten and h c repressor (Johnson et al. 1978). Bass et al. (1987) show that the sequences crtcal for Trp repressor bndng to a symmetrc dealzed operator are two 5'-CTAG-3' half-ste sequences, separated by a 4-bp spacer regon. The trpr operator has three changes n the 5'-CTAG-3' half-stes from the dealzed sequence, but none of these changes causes a severe loss of bndng affnty n vvo (see Bass et al. 1987). The observed pattern of methylaton protecton for the trpr operator s consstent wth ths mnmal defnton of a repressor bndng ste. Two of the three symmetrc pars of protected guannes fall n the 4-bp half-stes. These guannes are n the bottom strand of the left half-ste and n the top strand of the rght halfste {Fg. 7). The other symmetrc par of guannes protected from methylaton s located 9 bp from the symmetry axs on the opposte strand of each half-ste. Ths poston s not crtcal for Trp repressor bndng, snce all three symmetrc pars of base par substtutons at ths poston have lttle effect on bndng {Bass et al. 1987). t s lkely that a nonspecfc nteracton s responsble for the observed protecton. The nteractons of the Trp repressor wth the aroh and trp operators are more complex than wth the trpr operator. Unlke the trpr operator, whch has protected guannes n two consecutve major grooves, the aroh operator has protected guannes n three consecutve major 560 GENES & DEVELOPMENT

6 trpr, aroh, and trp operators grooves, and the trp operator has protected guannes n four consecutve major grooves. The protected guannes n the aroh and trp operators can be dssected nto sets of protecton pattems that resemble the protecton pattem of the trpr operator (Fg. 7). We propose that the aroh operator has two helcally stacked Trp repressor bndng stes and the trp operator has three helcally stacked Trp repressor bndng stes. The pattem of protecton for the mutant trp operator s consstent wth the dea that the trp operator has three stes. The deleton/substtuton mutatons destroy two of the four half-ste sequences n the trp operator. The remanng two half-ste sequences consttute a sngle bndng ste for a Trp repressor dmer. We reasoned that the pattem of protecton observed for the mutant trp operator should resemble the trpr operator, the smplest natural operator, snce both of these operators are composed of a sngle dmer bndng ste. The protecton data summarzed n Fgure 5 show that the protected guannes n the mutant trp operator span 15 bp, and occur at several postons homologous to the postons of protected guannes n the trpr operator. Trp repressor makes no contacts to the left of the remanng wld-type sequences n the mutant trp operator. Therefore, no sequences recognzed by Trp repressor have been fortutously ntroduced to the left of the predcted bndng ste. Experments that measure the relatve apparent equlbrum bndng constants of the mutant and wld-type trp operators show that the mutant operator bnds Trp repressor wth an affnty that s only two- to fvefold less than wld type (Haydock et al. 1983; Kumamoto and Gunsalus, unpubl.). Ths result precludes the possblty that only one Trp repressor dmer makes all of the contacts n the wld-type trp operator. These data further suggest that bndng to the helcally stacked stes may be cooperatve. Bass et al. (1987) propose that the Trp repressor makes specfc contacts wth an operator half-ste along only one strand of the DNA. Such a model would permt two repressor dmers to contact the same half-ste, because the dmers would be postoned roughly around the DNA from one another. Alternatvely, because the 4 bp n each half-ste are a palndrome, both repressor dmers may make dentcal contacts wth each strand of a shared half-ste, as do symmetrcally related monomers of an endonuclease EcoR dmer wth an EcoR recognton ste (McClarn et al. 1986). All fve of the operator consttutve mutatons solated n the trp operator fall wthn half-stes shared by two adjacent Trp repressor bndng stes (Bennett and Yanofsky 1978). The effects these mutatons have on each of the three bndng stes correlate wth ther phenotypes. An A: T ~ T : A transverson at poston -7 causes the greatest loss n represson of the four mutatons. Ths change s predcted to ntroduce severe defects n the central and rghtmost repressor bndng stes. The A:T--*C:G, the G:C~T:A, and the T : A ~ G : C transversons at postons -7, -6, and -16, respectvely, ntroduce severe defects n the central bndng ste, and mld defects n the rghtmost (-7, -6) and leftmost stes (-16), respectvely. These mutants retan an ntermedate level of represson. Fnally, the A : T ~ G : C transton at poston - 15 ntroduces a severe defect nto the central bndng ste and has lttle effect on the leftmost ste (Fg. 7). Ths mutant operator retans the greatest represson of the four consttutve mutants. t s nterestng to note that these consttutve mutatons are found only n the shared half-stes of the trp operator, where they may affect two stes smultaneously. Ths concdence may explan why Bennett and Yanofsky (1978) faled to solate consttutve mutatons n the outermost half-stes of the trp operator. The crystal structure and negatve domnant mutatons of the Trp repressor show that the helx-turn-helx motf s used to recognze a bndng ste (Kelley and Yanofsky 1985; Schevtz et al. 1985). From computer-asssted dockng studes of the Trp repressor wth a synthetc 20-bp canoncal operator sequence, t s evdent that the two helx-turn-helx structures may be postoned so that contacts can be made n two successve major grooves. The locaton of the helcally stacked stes should allow Trp repressor to make classcal contacts n all three operators (.e., each Trp repressor dmer makes trp R oro H fro muton? GATATG CTAT d~,, ACTC TT~A~'~AC C TATACGATAGCA TT T', G ATTTT --! Fgure 7. Proposed model for the Trp repressor bndng stes at the trpr, atoll, trp, and mutant trp operators. AACC GG G GGAGG C ATT The vertcal double-headed arrow represents the DNA TGGCCCCCTCCGTAA sequence axs of sym_metry as shown n Fg. 1. Enclosed regons (shaded, hatched, dotted} represent bases that comprse the multple Trp repressor bndng stes at each operator. The trpr, aroh, trp, and mutant tro operators contan one, two, three, and one stes, respectvely {see text; Bass et al Guanne resdues represented n boldface ndcate bases that show decreased methylaton by dmethylsultate n the presence of Trp repressor relatve to operator DNA alone (Fgs. 3 and 51. When vewed, -. n three dmensons, the Trp repressor bndng stes are CACCGAAACGCGcGAGGC~_.~ACGTAAAA GTGGcTTTGCGCGCTCCGT~"T~.'~~~'A'~GCGTTCA~,/. GCATTTT the DNA n helcal fashon. "-'""-,:- ":"J tandemly stacked, and together process up the surface Of GENES & DEVELOPMENT 561

7 Kumamoto et al. contacts n two successve major grooves). n contrast, any model n whch only one Trp repressor dmer s responsble for all the contacts n each operator must nvoke nonclasscal nteractons n the aroh and trp operators. The precse locaton and orentaton of Trp repressor on the surface of the operator DNA, however, cannot be resolved untl the structure of the proten- DNA co-crystal has been determned. The trpr, aroh, and trp operons show dfferng extents of regulaton by Trp repressor n vvo. The trp operon s regulated by over a 70-fold range, and the aroh and the trpr operons are regulated over a four- to fvefold range (Kelley and Yanofsky 1982; Grove and Gunsalus 1987). The role of the multple stacked Trl0 repressor bndng stes n ths dfferental regulaton s unknown. Bochemcal and genetc studes are n progress to establsh the contrbuton of these structures to trp regulon control. Materals and methods Bacteral strans and plasmds E. col LE392 [hsdrs14 (t-,m-), supe44, supf58, lacy1, galt22, metb1, trpr55] was used for plasmd constructon and solaton of DNA. Plasmd prpg5 (trpr +) was the source of all trpr operator DNA fragments (Gunsalus and Yanofsky 1980). Plasmd pdna1 contanng the E. col aroh operator was the gft of Denns N. Arvdson (Grove and Gunsalus 1987). The source of trp operator DNA fragments was pkrs101 (Spndler et al. 1984), prpg78, or prpg79. Plasmd prpg78 contans the trp promoter/operator regon and was derved from pkrs 101. t was constructed by solatng a 303-bp Pvu-Rsa fragment from pkrs 101, whch was flled n and nserted nto the Sna ste of prs415 (Smons et al. 1987). The trp promoter/operator fragment contaned on a 309- bp EcoR-BamH fragment was excsed from prpg78 and combned wth the large EcoR-BamH fragment of pbr327 to gve plasmd prpg79. The mutant trp operator plasmd prpg71 was constructed by deletng the 247-bp Hpa fragment of pkrs 101. The DNA sequence of the mutant trp operator s shown n Fgure 5. Preparaton of labeled DNA fragments Preparaton and labelng of DNA fragments were performed as descrbed prevously (Manats 1982). End-labelng at the 5' poston was done usng T4 polynucleotde knase and [~-32P]ATP (3000 C/mmole) or by end-fllng wth an approprate a-32p-labeled deoxynucleotde. Secondary cleavage reactons were performed to gve unque 5'-end-labeled operator contanng DNA fragments for the DNase and methylaton protecton studes. For the aroh sense strand studes, the Hpa 249-bp fragment was solated from pdna1, 5'-end-labeled, and an Hae secondary cleavage reacton performed to yeld a sngly end-labeled 67-bp aroh operator fragment. For the antsense strand studes, pdna1 was cut wth Hae, a 351-bp fragment was solated and 5'-end-labeled, and then cut wth Hpa to yeld a 5' sngly end-labeled 67-bp operator fragment. For trpr sense strand studes, prpg5 was dgested wth Hae, and the 448-bp fragment solated and 5'-end-labeled. Secondary cuttng wth Sau3A yelded a 5' sngly end-labeled 95-bp fragments. For the trpr antsense strand, the 187-bp Sau3A fragment was solated, 5' end-labled, and a secondary cuttng reacton performed wth Sal to gve a 158-bp 5' sngly end-labeled fragment. For DNase and methylaton studes wth the trp sense strand, prpg79 was dgested wth EcoR and BamH, and the 308-bp fragment solated. Followng 5' end labelng, a secondary cleavage reacton wth Hha was performed to gve a unque 5'-end-labeled 120-bp trp operator fragment. For studes wth the antsense strand, prpg79 was dgested wth BamH. The lnearzed plasmd was 3'-end-labeled and then cut wth EcoR to generate a 3' sngly end-labeled 308-bp fragment. DNA fragments contanng the mutant trp operator were prepared from plasmd prpg71 by BamH dgeston. The ends were labeled, cut wth EcoR, and the 86-bp mutant trp operator fragment solated. Trp aporepressor purfcaton Trp aporepressor was purfed from E. cold cells as prevously descrbed (Gunsalus and Yanofsky 1980; Arvdson et al. 1987). Analyss of purfed Trp aporepressor proten by SDS-polyacrylamde gel electrophoress revealed the presence of a sngle proten band (Mr = 12,500). The purty was estmated to be greater than 99%. The Trp aporepressor preparatons were greater than 90% actve for operator DNA bndng as determned by a DNase protecton gel assay (Kumamoto and Gunsalus, unpubl.). Proten concentraton was determned by absorbance at 280 nm (El% = 1.2 cm -l rag-l; Joachmak et al. 1983). DNase footprntng of operator DNA For standard DNase footprntng experments, approxmately 20 pmoles of purfed Trp aporepressor was added to approxmately 1 pmole of 32P-labeled operator DNA fragment n 1 ~1 of DNase reacton buffer (30 mm Trs-HC1, ph 8, 100 mm KC1, 3 mm MgC1, 2 mm DTT, 2 mm EDTA, 2 ~g soncated salmon sperm DNA, _+ 1 mm L-tryptophan; Galas and Schmtz 1978). The fnal concentratons of aporepressor and operator used n these experments were typcally n the range of 500 and 5 nm, respectvely, and are at physologcal levels (Gunsalus et al. 1986). All of the DNase and DMS methylaton experments were performed n the presence of salmon sperm DNA (nonspecfc carrer DNA). The operator DNA was present at 20 ng versus 2000 ng of the carrer DNA, whch corresponds to a 100- fold excess on a weght/weght bass, or a 1000-fold molar excess of nonspecfc DNA bndng stes relatve to operator stes. DNase was dluted n DNase buffer supplemented wth 2 mm CaC12 and added at a fnal concentraton of 10 ~g/ml to ntate the reacton. The mxture was ncubated at 37 C for 10 ran and the reacton was then quenched by the addton of 75 ~1 of DNase stop soluton (Galas and Schmdt 1978). The DNA mxture was phenol-treated and desalted on a Sephadex G-25 column, and the DNA fragments were precptated by addton of two volumes of ethanol. Sequence analyss of labeled DNA fragments (Maxam and Glbert 1977) and DNA polyacrylamde gel electrophoress (Sanger and Coulson 1978)were performed as descrbed. Chemcal methylaton of operator DNA by dmethyl sulfate Methylaton protecton reactons wth each strand of the trp, trpr, and aroh operators were carred out usng a standard reacton protocol. Operator DNA (---1 pmole of 5' end-labeled fragment) was added to 200 ~1 of dmethyl sulfate reacton buffer (Glbert et al. 1976) contanng 2 ~g of soncated salmon sperm DNA. Where ndcated, L-tryptophan was present at a fnal concentraton of 1 mm and Trp repressor was added to the teat- 562 GENES & DEVELOPMENT

8 trpr, atoll, and trp operators ton mxture at a fnal concentraton of 250 nm. The mxture was prencubated on ce for 10 mn and the reacton was ntated by addton of dmethyl sulfate (1 ~1). After 5 mn at 20 C, the methylaton reacton was stopped by the addton of DMS stop soluton (50 ~1), the DNA fragments were precptated (2 x ), washed once wth 75% ethanol, and dred (Maxam and Glbert 1977). DNA samples were then treated accordng to the alternatve guanne cleavage (G reacton) or the strong adenne/ weak guanne cleavage (A>G reacton)procedures of Maxam and Glbert (1977). DNA sequence analyss and gel electrophoress were performed as descrbed (Maxam and Glbert 1977; Sanger and Coulson 1978). Enzymes and reagents Calf ntestnal alkalne phosphatase was obtaned from Boehrnger Mannhem (ndanapols, ndana), restrcton enzymes (Hae, Hpa, BamH, and EcoR) were obtaned from BRL (Gathersburg, Maryland)(Sau3A and Sal) or from New England Bolabs (Beverly, Massachusetts), and T4 polynucleotde knase was purchased from Pharmaca-PL Bochemcals (Pscataway, New Jersey). [~/-a2p]atp (3000 C/mmole)and [~-a~p]datp (3000 C/mmole)were obtaned from Amersham (Arlngton Heghts, llnos). Dmethyl sulfate was purchased from Aldrch Chemcal Corporaton (Mlwaukee, Wsconsn). Acknowledgments We thank Phlp Youderan for crtcal comments on the manuscrpt. Ths work was supported by a grant from the Natonal nsttutes of Health {GM 29456) and by a UCLA Bochemcal Research Grant to R.P.G.A.A.K. was supported n part by a Publc Health Servce Genetcs Tranng Grant (GM07104) from the Natonal nsttutes of Health. Reterences Arvdson, D.N., C. Bruce, and R.P. Gunsalus nteracton of the Trp repressor wth ts lgand, t-tryptophan. J. Bol. Chem. 261: Arvdson, D.N., A.A. Kumamoto, and R.P. Gunsalus A smple three-step batch purfcaton of the Eschercha cold Tryptophan repressor. Proten purfcaton: Mcro to macro. UCLA Syrup. Mol. Cell. Bol. New Seres 68: (n press). Bachman, B.J Lnkage map of Eschercha cold K-12, 7 ed. Mcrobol. Rev. 47: Bass, S., P. Sugono, D.N. Arvdson, R.P. Gunsalus, and P. Youderan DNA specfcty determnants of Eschercha cold tryptophan repressor bndng. Genes Dev. 1: Bennett, G.N., M.E. Schwengruber, K.D. Brown, C. Squres, and C. Yanofsky Nucleotde sequence of regon precedng trp mrna ntaton ste and ts role n promoter and operator functon. Proc. Natl. Acad. Sc. 73: Bennett, G.N. and C. Yanofsky Sequence analyss of operator consttutve mutants of the tryptophan operon of Eschercha cold. J. Mol. Bol. 121: Brown, K.D Regulaton of aromatc amno acd bosynthess n Eschercha col K12. Genetcs 60: Cohen, G. and F. Jacob Sur la represson de la synthese des enzymes ntervenant dans la formaton du tryptophane chez Eschercha cold. C.R. Acad. Sc. Ser. D. 248: Galas, D.J. and A. Schmtz DNase footprntng: A smple method for the detecton of proten-dna bndng specfcty. Nuclec Acds Res. 5: Glbert, W., A. Maxam, and A.D. Mrzabekov Control of rbosome synthess, The Alfred Benson Symposum X (ed. N.O. Kjelgaard and O. Maaloe), pp Munksgaard, Copenhagen. Grove, C. and R.P. Gunsalus Regulaton of the aroh operon of Eschercha cold by the tryptophan repressor. J. Bacterol. 169: Gunsalus, R.P. and C. Yanofsky Nucleotde sequence and expresson of Eschercha cold trpr, the structural gene for the trp aporepressor. Proc. Natl. Acad. Sc. 77: Gunsalus, R.P., A. Gunsalus-Mguel, and G.L. Gunsalus ntracellular Trp repressor levels n Eschercha cold. J. Bacterol. 167: Haydock, P.N., G. Bogosan, K. Brechlng, and R.L. Somervlle Studes on the nteracton of trp holorepressor wth several operators. J. Mol. Bol. 170: Joachmak, A., R.L. Kelley, R.P. Gunsalus, C. Yanofsky, and P.B. Sgler Purfcaton and characterzaton of Trp aporepressor. Proc. Natl. Acad. Sc. 80: Johnson, A., B.J. Meyer, and M. Ptashne Mechansm of acton of the cro proten of bacterophage X. Proc. Natl. Acad. Sc. 75: Kelley, R.L. and C. Yanofsky Trp aporepressor producton s controlled by autogenous regulaton and neffcent translaton. Proc. Natl. Acad. Sc. 79: ~ Mutatonal studes wth the Trp repressor of Eschercha cold support the helx-turn-helx model of repressor recognton of operator DNA. Proc. Natl. Acad. Sc. 82: Manats, T., E.F. Frtsch, and J. Sambrook Molecular clonng: A laboratory manual. Cold Sprng Harbor Laboratory, Cold Sprng Harbor, New York. Maxam, A. and W. Glbert A new method for sequencng DNA. Proc. Natl. Acad. Sc. 74: McClarn, J.A., C.A. Frederck, B.C. Wang, P. Greene, H.W. Boyer, J. Grable, and J.M. Rosenberg Structure of the DNA-EcoR endonuclease complex at 3A resoluton. Scence 234: Morse, D. and C. Yanofsky Amber mutants of the trpr regulatory gene. J. Mol. Bol. 44: Oppenhem, D.S., G.N. Bennett, and C. Yanofsky Eschercha col RNA polymerase and Trp repressor nteracton wth the promoter-operator regon of the tryptophan operon of Salmonella typhmurum. J. Mol. Bol. 144: Pttard, J., L. Camakars, and B.J. Wallace nhbton of 3-Deoxy-D-arabnohepulosonc acd-7-phosphate synthetase (trp) n Eschercha col. J. Bacterol. 97: Rose, J.K., C.L. Squres, C. Yanofsky, H. Yang, and G. Zubay Tryptophanyl-tRNA and tryptophanyl trna synthetase are not requred for n vtro represson of the tryptophan operon. Nature New Bol. 245: Sanger, F. and A.R. Coulson The use of thn acrylamde gels for DNA sequencng. FEBS Lett. 87: Schevtz, R.W., Z. Otwnowsk, A. Joachmak, C.L. Lawson, and P.B. Sgler The three-dmensonal structure of trp repressor. Nature 317: Smons, R.W., F. Houman, and N. Kleckner mproved multcopy lac-based proten and operon fuson clonng tools. Gene (n press). Sngleton, C.K., W.D. Roeder, G. Bogosan, R.L. Somervlle, and H.L. Weth DNA sequence of the E. cold trpr gene and predcton of the amno acd sequence of Trp repressor. Nuclec Acd Res. 8: Spndler, K.R., D.S. Rosser, and A.J. Berk Analyss of adenovrus transformng protens from early regons 1A and GENES & DEVELOPMENT 563

9 Kumamoto et al. 1B wth antsera to nducble fuson antgens produced n Eschercha coll. ]. Vrol. 49: Yanofsky, C Tryptophan bosynthess n Eschercha coll. ]. Am. Med. Assoc. 218: Zurawsk, G., R.P. Gunsalus, K.D. Brown, and C. Yanofsky Structure and regulaton of aroh, the structural gene for the tryptophan-repressble 3-Deoxy-D-arabno-heptulosonc acd-7-phosphate synthetase of Eschercha coll. L Mol. Bol. 145: GENES & DEVELOPMENT

10 Eschercha col tryptophan repressor bnds multple stes wthn the aroh and trp operators. A A Kumamoto, W G Mller and R P Gunsalus Genes Dev. 1987, 1: Access the most recent verson at do: /gad References Ths artcle ctes 28 artcles, 14 of whch can be accessed free at: Lcense Emal Alertng Servce Receve free emal alerts when new artcles cte ths artcle - sgn up n the box at the top rght corner of the artcle or clck here. Copyrght Cold Sprng Harbor Laboratory Press