binds multiple sites within the aroh and
|
|
- Carol Bruce
- 5 years ago
- Views:
Transcription
1 Downloaded from genesdev.cshlp.org on November 14, Publshed by Cold Sprng Harbor Laboratory Press Eschercha cod tryptophan repressor bnds multple stes wthn the aroh and trp operators Andrew A. Kumamoto, ~ Wllam G. Mller, 2 and Robert P. GunsalusL2 1Molecular Bology nsttute and the 2Department of Mcrobology, Unversty of Calfoma, Los Angeles, Calfoma USA DNase footprntng and methylaton protecton studes have been used to analyze the bndng of Eschercha col Trp repressor to the trpr, aroh, and trp operators. The methylaton protecton assay shows that Trp repressor bnds n two successve major grooves of the trpr operator, three successve major grooves of the aroh operator, and four successve major grooves of the trp operator. The smplest model that explans the dfference n Trp repressor nteracton at the three operators s that the aroh and trp operators are composed of multple, helcally stacked bndng stes. When vewed n three dmensons, each ste s postoned on a dfferent face of the DNA, and together process up the surface of the DNA helx. Analyss of a deleton dervatve of the trp operator supports ths model. [Key Words" Trp repressor; aroh operator; trp operator; repressor bndng] Receved February 23, 1987; revsed verson accepted June 6, The Trp repressor of Eschercha col coordnately regulates the expresson of the trp, aroh, and trpr operons n response to the ntracellular levels of L-tryptophan (Cohen and Jacob 1959; Brown 1968; Rose et al. 1973; Gunsalus and Yanofsky 1980). The trpr operon, located at 99.5 mn, codes for the Trp aporepressor and s autoregulated (Morse and Yanofsky 1969; Gunsalus and Yanofsky 1980; Kelley and Yanofsky 1982; Bachman 1983; Gunsalus et al. 1986). The aroh operon, located at 37 mn, encodes one of the three sozymes of 3-deoxy- D-arabno-heptulosonc acd-7-phosphate synthetase (DAHP). Ths enzyme catalyzes the frst step n the common pathway of aromatc amno acd bosynthess (Brown 1968; Pttard et al. 1969; Zurawsk et al. 1981). The thrd operon, trp, s located at 27 mn on the E. col genetc map and encodes the enzymes that carry out the fnal steps of L-tryptophan bosynthess from the cellular ntermedate, chorsmc acd (Yanofsky 1971). The natve form of the Trp aporepressor s a dmer composed of dentcal subunts of 108 amno acds (Gunsalus and Yanofsky 1980; Joachmak et al. 1983; Arvdson et al. 1986). Bndng of the corepressor, L-tryptophan ncreases the affnty of Trp repressor for operator DNA, leadng to the formaton of the ternary repressor DNA complex (Rose et al. 1973). The bndng of Trp repressor to ts operators nhbts the ntaton of transcrpton of the trpr, aroh, and trp operon messages by preventng RNA polymerase from bndng to the promoters (Oppenhem et al. 1980). The physcal locaton of the trp operator was prevously defned by deleton studes (Bennett et al. 1976) and by the solaton of consttutve mutatons wthn the trp operator {Bennett and Yanofsky 1978). These operator consttutve mutatons map at postons -16, -15, -7, and -6 n the trp promoter sequence. The DNA sequences of the trpr and aroh operons reveal stes that exhbt sgnfcant sequence homology to the trp operator (Gunsalus and Yanofsky 1980; Sngelton et al. 1980; Zurawsk et al n Fgure 1, the sequences of the three operators are algned to show max- trpr aro H -o TGCTATCGTACTCTT :::: :..... ~so :::: 4o ;..... GCCGAATGTACTAGAG ::::~ ;..... AATCATCGAACTAGT" ' AGCGAGTACAACCGGGG A.AdTAG+~CATTAGCTT :-0 " " " + ACTAG+ACGCXAGTTC Fgure 1. DNA sequence comparson of the operator regons of the trpr, aroh, and trp operons. The nucleotde sequence of each operator regon s numbered relatve to the start of transcrpton. Sequence smlarty between the operators s ndcated by the vertcal dashes The sold vertcal double-headed arrow represents the sequence axs of symmetry. The comparson of the trpr and aroh operators shows conservaton of 13 of 22 base pars, the aroh and trp sequences have 15 of 22 conserved base pars, whle the trpr and the trp operator regons show 16 out of 22 conserved base pars No conservaton of DNA sequence s seen n the flankng regons of the three operators. 556 GENES & DEVELOPMENT 1: by Cold Sprng Harbor Laboratory SSN /87 $1.00
2 trpr, aroh, and trp operators mum dentty. The bndng of Trp repressor at the trpr and aroh operators was demonstrated by a Rsa endonuclease protecton assay (Gunsalus and Yanofsky 1980; Zurawsk et al. 1981). n ths assay bound Trp repressor protects a Rsa endonuclease ste, located n the operator, from cleavage by Rsa. n ths report, we explore the specfc nteractons between the E. col Trp repressor and the trpr, aroh, and trp operators by bochemcal protecton experments. These nteractons are defned by the ablty of Trp repressor to protect each operator from methylaton by the alkylatng agent dmethyl sulfate, or cleavage by the endonuclease DNase. Comparson of the Trp repressor nteractons shows that Trp repressor nteracts dfferently at each operator. The smplest hypothess that accounts for our data s that Trp repressor bnds multple, helcally stacked stes. Results DNase footprntng of Trp repressor at the trpr, aroh, and trp operators shows dfferng domans of protecton We have determned the DNase footprnts of Trp repressor at the trpr, aroh, and trp operators. DNase -dependent cleavage reactons were performed n the pres- ence and absence of Trp repressor over a range of dfferent DNA and proten concentratons. DNase footprnts of the trpr, aroh, and trp operators are shown n Fgure 2. The DNase cleavage pattern for the trpr operator n the presence of Trp repressor reveals nteractons that extend from postons - 10 to + 15 on the top strand of the trpr operator and from postons - 14 to + 12 on the bottom strand. These results are summarzed n Fgure 3, and show that the ste protected by Trp repressor extends over a 30-bp regon, s centered at the start pont of transcrpton, and overlaps the -10 regon of the trpr promoter. The DNase pattern for the Trp repressor nteractons at the aroh operator s shown n Fgure 2B. Protectons extend from postons -46 to -22 on the top strand and from postons -54 to -21 on the bottom strand. Trp repressor protects a 33-bp regon that overlaps the -35 regon of the aroh promoter. Fgure 2C depcts the changes n the DNase cleavage pattern of the trp operator n the presence of Trp repressor. These nteractons extend from postons -23 to + 8 on the top strand and from postons -27 to + 8 on the bottom strand. nteractons between the Trp repressor and the trp operator span 35 bp, and overlap the -10 regon of the trp promoter. Ths regon has also A trpr B aro/-/ C trp B T B G-+ G-+ G-+ T B T G-+ G-+ G , +!7.\ ~. +16~ +15~ ~ +4- _ = 23_, t Em o ~ m... ~glpo o ~ " O O ~ald g o -49-, ~--= -32- " " _ z m ! Fgure 2. DNase footprnt of Trp repressor bndng at the trpr, aroh, and trp operators. (A, B, and C) DNase footprnts of the trpr, aroh, and trp operators, respectvely. n each panel, the G lanes show the DNA guanne cleavage sequence reacton for the bottom {B) and top (T) strands {A > G reacton for aroh) and are used as a reference to algn the DNA sequence for the DNase reacton lanes. The DNase footprnt ladder for each strand n the presence ( + ) and absence (-) of Trp repressor s ndcated. Numberng of the DNA sequence s relatve to the start of transcrpton GENES & DEVELOPMENT 557
3 Downloaded from genesdev.cshlp.org on November 14, Publshed by Cold Sprng Harbor Laboratory Press Kumamoto et al. Fgure 3. Summary of the DNase footprnt and methylaton protecton results for Trp repressor bndng at the trpr, aroh, and trp operators. The vertcal double-headed arrow represents the DNA sequence axs of symmetry as shown n Fg. 1. The brackets above and below the DNA sequences ndcate the DNase -protected regons (Fg. 2) of each operator for each strand. Guanne resdues represented n boldface ndcate bases that show decreased methylaton by dmethylsulfate n the presence of Trp repressor relatve to operator DNA alone. been dentfed genetcally by consttutve mutatons (Bennett and Yanofsky 1978). The DNase protecton data for the trpr, aroh, and trp operators are compared n Fgure 3. Trp repressor protects a dfferent number of base pars at each operator from DNase cleavage. The protected regon vares from 30 bp for the trpr operator to 35 bp for the trp operator, and the number and locaton of repressor-nduced hypersenstve DNase cleavage stes n each operator dffers. The protected domans for the aroh and trp operators extend beyond the homologous regon of the operators (Fg. 1). Methylaton of each operator by dmethyl sulfate The results of the DNase protecton experments show that the regon of each operator protected by Trp repressor dffers n length. To determne whether ths result s due to an dosyncrasy of the partcular DNAmodfyng agent we used, we examned the nteracton of the Trp repressor wth each operator usng the chemcal methylatng agent dmethyl sulfate. n ths method, the ablty of bound Trp repressor to alter the reactvty of purne mno groups wth dmethyl sulfate s revealed by changes n the methylaton-dependent cleavage at partcular guanne or adenne resdues. Data obtaned from these studes are shown n Fgure 4. The bndng of Trp repressor at the trpr operator causes reduced methylaton n the top strand for guannes at postons -9, +2, +4, and +6. n the bottom strand, guannes at -6, -4, and +9 show reduced methylaton. ncreased methylaton s not detected at resdues n ether strand. These nteractons extend from -9 to +9, and span 18 bp (Fg. 3). No changes were seen n the cleavage pattern of the adennes, ndcatng that Trp repressor does not make contacts wth the 3-mno groups of adennes n the mnor groove (data not shown). The effect of Trp repressor bndng on the methylaton of the aroh operator s shown n Fgure 4B. For the top strand, reduced methylaton s seen for guanne resdues at -46, -32, and -24. The guanne at poston -24 s weakly protected from methylaton. ncreased methylaton s seen for guannes at postons -30, -38, and -40. n the bottom strand, reduced methylaton s seen trpr aro H trp A : 'l - 7 GATATGC TATC ---~TACTCTT T;AGCGAGTAC, AACC GGGGGAGGC AT C TATACGAT AGCATGAGAAATCG CTCATGTTGG C,j CCC TCCG TA t -] ' ,, ~ AGTCG r" F-r~AATGTA CTAGAGAACTAGTGC ATTAGCTTATTTTTTT TCAGCOSCTTACATGATCTCT TGATC ACGTAATC GAATAAAAAAA T_ -3-- J ~ : 1 ~ F AA rtaatcatcgaac TAGT~AACTAGTAC GCAAGTTCA~C GTAAAA TTAATTAGTAGCTTGATCAAJTTGATCATGCGTTCAAGT GCATTTT -E l t at guannes at -43, -35, and -29. No ncreased methylaton of any guanne resdue s observed wthn the bottom strand of the operator regon, and no changes n the methylaton pattern of adennes are observed for ether strand of the aroh operator (data not shown). The methylaton data for the aroh operator are summarzed n Fgure 3. Methylaton protectons extend from postons -46 to -24 and span 23 bp. The methylaton protecton pattern of the trp operator s shown n Fgure 4C. For the top strand, changes occur at guannes at postons - 14, -6, and + 3. The guanne at poston +3 shows weak protecton. n the bottom strand, changes occur at guannes at postons -24, - 17, - 9, - 3, and + 6. The guannes at postons - 24 and + 6 show weak protecton. No changes n the methylaton at adenne resdues were seen for ether strand (data not shown). The results for both strands of the trp operator are summarzed n Fgure 3. Methylaton protectons extend from postons -24 to + 6 and span 30 bp. Comparson of the methylaton data for the three operators reveals that Trp repressor nteracts dfferently at each operator (Fg. 3). The sze of the operators defned by ths method vares from 18 bp for trpr, to 23 bp for aroh, and 30 bp for trp, dfferng n ncrements of 5-7 bp. The szes of the trpr, aroh, and trp operators defned by methylaton are smaller than the szes defned by DNase footprntng. However, the operators are unquely ranked n sze by both methods. The results obtaned by both methods suggest that the Trp repressor makes dfferent, specfc contacts n each operator. The trp operator s comprsed of multple bndng stes One hypothess that accounts for these results s that Trp repressor bnds multple stes n the aroh and trp operators. To test ths hypothess, we constructed a plasmd that carres a deleton of the left porton of the trp operator (Fg. 5). We refer to the operator sequence on ths plasmd as the mutant trp operator. To examne the bndng of Trp repressor at ths ste, we performed DNase and methylaton protecton studes. As shown n Fgure 6, the mutant operator s protected from methylaton and from DNase cleavage n the presence of Trp repressor. The results of these studes are summarzed n 558 GENES & DEVELOPMENT
4 Downloaded from genesdev.cshlp.org on November 14, Publshed by Cold Sprng Harbor Laboratory Press trpr, aroh, and trp operators ! A rrpr f3 uro/-/ O /rp B f T B T -54~ W -52,7 nm -51 ~:; -45- ~ 11~ -~ u _3o_ m -32- B T UU 4-- t,, O~ -47"~2~ -~ - : od -20- ~q, "'' -58- ~~ -9- oa ~ -14- ~,. all -6- ~.~ ~ ~ "-, ~ ~ ~.,, "~ ~ ~ ,, ll Fgure 4. Methylaton protecton patterns of the trpr, aroh, and trp operators. DNA methylaton of the three operators by dmethylsulfate n the presence and absence of Trp repressor are shown n A (trpr, B (aroh), and C {trp). DNA methylaton patterns for the top (T) strand and the bottom (B) strand are ndcated for each operator n the presence ( + )or absence (-) of Trp repressor. Numberng of the gel ladder s relatve to the start of transcrpton. Fgure 5. Contacts n the homologous portons of the mutant and wld-type trp operators show dentcal protecton patterns wth ether assay. However, no protecton of bases from methylaton s observed for the mutant operator n the nonhomologous regon substtuted for the base pars to the left of the axs of symmetry. Moreover, the extent of DNase protecton n ths substtuted regon s reduced by 10 bp. These results show that at least two Trp repressor bndng stes comprse the trp operator, one of whch s entrely conserved n the mutant operator, and one of whch s at least partally mssng n the mutant operator (Fg. 5). n add- ton, the relatve degree to whch guanne resdues are protected by saturatng Trl0 repressor at homologous postons n the mutant trp and wld-type trp operators s nearly the same (data not shown), whch ndcates that the maxmal occupancy of Trp repressor for the respectve bndng stes s approxmately equal. Dscusson Our results show that Trp repressor nteracts dfferently wth the trpr, aroh, and trp operators. There are dfferences n the extent of Trp repressor nteractons, as de- mutant wld type V//////////////////////////////~ '-0 +1 "10 CACCGAAACG~GCGAGGCA ---L-- G A A C TAGTACG C AAGTTC--~GT AAA A G TGGC TTTGCGCGC TCC GTGTT~ATCAT~CGTTCAA~TGC t tl T AT TT T AA TT AAt~ AT C G AAC TAGTTAA C TAGTAbGC AAGTTC/~ C G TAAAA TTAATTA~TAGCTT~ATCAATT~ATCAT~CGTTC [ ' V AA~TGCATTTT Fgure 5. Summary of the DNase and methylaton protecton results for the mutant trp operator. The vertcal double-headed arrow represents the axs of DNA symmetry of the trp operator as drawn n Fg. 1. The regon of the wld-type trp operator deleted n the mutant trp operator s ndcated by the bar above the sequence. The brackets above and below the DNA sequences ndcate the regons of DNase protecton. The methylaton protecton results for Trp repressor bndng at the half-operator are ndcated for bases that show decreased methylaton {bold). The trp operator methylaton and DNase data are from Fgs. 2 and 4. GENES & DEVELOPMENT 559
5 Kumamoto et al. A ---- B T.-F-- B B T G -+ G O -259" 11p : g S m / = = '~ ~ = : -267_ ~ " ' _ o ~ ~ -261f ~ "" " -26 n ~ ~ " ~ J -267_ ~ ; ,: ~ m ~ '~-... ~ ~ ~ a ~ ~ ~ ~ ~ ~ - O ~ ~ Q ~ Q +9-,~ ,~. Fgure 6. DNase footprntng and DMS methylaton protecton of the mutant trp operator by Trp repressor. DMS methylaton and DNase reactons are shown n A and B, respectvely. Reactons were performed as descrbed n Fgs. 2 and 4 and n Materals and methods. The bottom (B) and top (T) strands are ndcated. The numberng of the DNA sequence ladder s relatve to the start of trp operon transcrpton. fned by both assays (Fg. 3). For the trpr operator, 18 bp are protected from methylaton and 30 bp are protected from DNase dgeston. For the aroh operator, 23 bp are protected from methylaton and 33 bp are protected from DNase dgeston. For the trp operator, 30 bp are protected from methylaton and 35 bp are protected from DNase dgeston. The smplest hypothess to account for these dfferences s that the aroh and trp operators are composed of multple, helcally stacked Trp repressor bndng stes. Fgure 3 llustrates that the smplest operator bound by Trp repressor s the trpr operator. We assume that the trpr ste s bound by a sngle repressor dmer and s composed of two operator half-stes. Sx of seven guannes protected n ths operator are symmetrcally pared about ts dyad axs and are n two consecutve major grooves on one face of the helx. A nearly symmetrc pattern of protected guannes n two consecutve major grooves s seen for the bndng of other dmerc repressor protens, ncludng h Cro proten and h c repressor (Johnson et al. 1978). Bass et al. (1987) show that the sequences crtcal for Trp repressor bndng to a symmetrc dealzed operator are two 5'-CTAG-3' half-ste sequences, separated by a 4-bp spacer regon. The trpr operator has three changes n the 5'-CTAG-3' half-stes from the dealzed sequence, but none of these changes causes a severe loss of bndng affnty n vvo (see Bass et al. 1987). The observed pattern of methylaton protecton for the trpr operator s consstent wth ths mnmal defnton of a repressor bndng ste. Two of the three symmetrc pars of protected guannes fall n the 4-bp half-stes. These guannes are n the bottom strand of the left half-ste and n the top strand of the rght halfste {Fg. 7). The other symmetrc par of guannes protected from methylaton s located 9 bp from the symmetry axs on the opposte strand of each half-ste. Ths poston s not crtcal for Trp repressor bndng, snce all three symmetrc pars of base par substtutons at ths poston have lttle effect on bndng {Bass et al. 1987). t s lkely that a nonspecfc nteracton s responsble for the observed protecton. The nteractons of the Trp repressor wth the aroh and trp operators are more complex than wth the trpr operator. Unlke the trpr operator, whch has protected guannes n two consecutve major grooves, the aroh operator has protected guannes n three consecutve major 560 GENES & DEVELOPMENT
6 trpr, aroh, and trp operators grooves, and the trp operator has protected guannes n four consecutve major grooves. The protected guannes n the aroh and trp operators can be dssected nto sets of protecton pattems that resemble the protecton pattem of the trpr operator (Fg. 7). We propose that the aroh operator has two helcally stacked Trp repressor bndng stes and the trp operator has three helcally stacked Trp repressor bndng stes. The pattem of protecton for the mutant trp operator s consstent wth the dea that the trp operator has three stes. The deleton/substtuton mutatons destroy two of the four half-ste sequences n the trp operator. The remanng two half-ste sequences consttute a sngle bndng ste for a Trp repressor dmer. We reasoned that the pattem of protecton observed for the mutant trp operator should resemble the trpr operator, the smplest natural operator, snce both of these operators are composed of a sngle dmer bndng ste. The protecton data summarzed n Fgure 5 show that the protected guannes n the mutant trp operator span 15 bp, and occur at several postons homologous to the postons of protected guannes n the trpr operator. Trp repressor makes no contacts to the left of the remanng wld-type sequences n the mutant trp operator. Therefore, no sequences recognzed by Trp repressor have been fortutously ntroduced to the left of the predcted bndng ste. Experments that measure the relatve apparent equlbrum bndng constants of the mutant and wld-type trp operators show that the mutant operator bnds Trp repressor wth an affnty that s only two- to fvefold less than wld type (Haydock et al. 1983; Kumamoto and Gunsalus, unpubl.). Ths result precludes the possblty that only one Trp repressor dmer makes all of the contacts n the wld-type trp operator. These data further suggest that bndng to the helcally stacked stes may be cooperatve. Bass et al. (1987) propose that the Trp repressor makes specfc contacts wth an operator half-ste along only one strand of the DNA. Such a model would permt two repressor dmers to contact the same half-ste, because the dmers would be postoned roughly around the DNA from one another. Alternatvely, because the 4 bp n each half-ste are a palndrome, both repressor dmers may make dentcal contacts wth each strand of a shared half-ste, as do symmetrcally related monomers of an endonuclease EcoR dmer wth an EcoR recognton ste (McClarn et al. 1986). All fve of the operator consttutve mutatons solated n the trp operator fall wthn half-stes shared by two adjacent Trp repressor bndng stes (Bennett and Yanofsky 1978). The effects these mutatons have on each of the three bndng stes correlate wth ther phenotypes. An A: T ~ T : A transverson at poston -7 causes the greatest loss n represson of the four mutatons. Ths change s predcted to ntroduce severe defects n the central and rghtmost repressor bndng stes. The A:T--*C:G, the G:C~T:A, and the T : A ~ G : C transversons at postons -7, -6, and -16, respectvely, ntroduce severe defects n the central bndng ste, and mld defects n the rghtmost (-7, -6) and leftmost stes (-16), respectvely. These mutants retan an ntermedate level of represson. Fnally, the A : T ~ G : C transton at poston - 15 ntroduces a severe defect nto the central bndng ste and has lttle effect on the leftmost ste (Fg. 7). Ths mutant operator retans the greatest represson of the four consttutve mutants. t s nterestng to note that these consttutve mutatons are found only n the shared half-stes of the trp operator, where they may affect two stes smultaneously. Ths concdence may explan why Bennett and Yanofsky (1978) faled to solate consttutve mutatons n the outermost half-stes of the trp operator. The crystal structure and negatve domnant mutatons of the Trp repressor show that the helx-turn-helx motf s used to recognze a bndng ste (Kelley and Yanofsky 1985; Schevtz et al. 1985). From computer-asssted dockng studes of the Trp repressor wth a synthetc 20-bp canoncal operator sequence, t s evdent that the two helx-turn-helx structures may be postoned so that contacts can be made n two successve major grooves. The locaton of the helcally stacked stes should allow Trp repressor to make classcal contacts n all three operators (.e., each Trp repressor dmer makes trp R oro H fro muton? GATATG CTAT d~,, ACTC TT~A~'~AC C TATACGATAGCA TT T', G ATTTT --! Fgure 7. Proposed model for the Trp repressor bndng stes at the trpr, atoll, trp, and mutant trp operators. AACC GG G GGAGG C ATT The vertcal double-headed arrow represents the DNA TGGCCCCCTCCGTAA sequence axs of sym_metry as shown n Fg. 1. Enclosed regons (shaded, hatched, dotted} represent bases that comprse the multple Trp repressor bndng stes at each operator. The trpr, aroh, trp, and mutant tro operators contan one, two, three, and one stes, respectvely {see text; Bass et al Guanne resdues represented n boldface ndcate bases that show decreased methylaton by dmethylsultate n the presence of Trp repressor relatve to operator DNA alone (Fgs. 3 and 51. When vewed, -. n three dmensons, the Trp repressor bndng stes are CACCGAAACGCGcGAGGC~_.~ACGTAAAA GTGGcTTTGCGCGCTCCGT~"T~.'~~~'A'~GCGTTCA~,/. GCATTTT the DNA n helcal fashon. "-'""-,:- ":"J tandemly stacked, and together process up the surface Of GENES & DEVELOPMENT 561
7 Kumamoto et al. contacts n two successve major grooves). n contrast, any model n whch only one Trp repressor dmer s responsble for all the contacts n each operator must nvoke nonclasscal nteractons n the aroh and trp operators. The precse locaton and orentaton of Trp repressor on the surface of the operator DNA, however, cannot be resolved untl the structure of the proten- DNA co-crystal has been determned. The trpr, aroh, and trp operons show dfferng extents of regulaton by Trp repressor n vvo. The trp operon s regulated by over a 70-fold range, and the aroh and the trpr operons are regulated over a four- to fvefold range (Kelley and Yanofsky 1982; Grove and Gunsalus 1987). The role of the multple stacked Trl0 repressor bndng stes n ths dfferental regulaton s unknown. Bochemcal and genetc studes are n progress to establsh the contrbuton of these structures to trp regulon control. Materals and methods Bacteral strans and plasmds E. col LE392 [hsdrs14 (t-,m-), supe44, supf58, lacy1, galt22, metb1, trpr55] was used for plasmd constructon and solaton of DNA. Plasmd prpg5 (trpr +) was the source of all trpr operator DNA fragments (Gunsalus and Yanofsky 1980). Plasmd pdna1 contanng the E. col aroh operator was the gft of Denns N. Arvdson (Grove and Gunsalus 1987). The source of trp operator DNA fragments was pkrs101 (Spndler et al. 1984), prpg78, or prpg79. Plasmd prpg78 contans the trp promoter/operator regon and was derved from pkrs 101. t was constructed by solatng a 303-bp Pvu-Rsa fragment from pkrs 101, whch was flled n and nserted nto the Sna ste of prs415 (Smons et al. 1987). The trp promoter/operator fragment contaned on a 309- bp EcoR-BamH fragment was excsed from prpg78 and combned wth the large EcoR-BamH fragment of pbr327 to gve plasmd prpg79. The mutant trp operator plasmd prpg71 was constructed by deletng the 247-bp Hpa fragment of pkrs 101. The DNA sequence of the mutant trp operator s shown n Fgure 5. Preparaton of labeled DNA fragments Preparaton and labelng of DNA fragments were performed as descrbed prevously (Manats 1982). End-labelng at the 5' poston was done usng T4 polynucleotde knase and [~-32P]ATP (3000 C/mmole) or by end-fllng wth an approprate a-32p-labeled deoxynucleotde. Secondary cleavage reactons were performed to gve unque 5'-end-labeled operator contanng DNA fragments for the DNase and methylaton protecton studes. For the aroh sense strand studes, the Hpa 249-bp fragment was solated from pdna1, 5'-end-labeled, and an Hae secondary cleavage reacton performed to yeld a sngly end-labeled 67-bp aroh operator fragment. For the antsense strand studes, pdna1 was cut wth Hae, a 351-bp fragment was solated and 5'-end-labeled, and then cut wth Hpa to yeld a 5' sngly end-labeled 67-bp operator fragment. For trpr sense strand studes, prpg5 was dgested wth Hae, and the 448-bp fragment solated and 5'-end-labeled. Secondary cuttng wth Sau3A yelded a 5' sngly end-labeled 95-bp fragments. For the trpr antsense strand, the 187-bp Sau3A fragment was solated, 5' end-labled, and a secondary cuttng reacton performed wth Sal to gve a 158-bp 5' sngly end-labeled fragment. For DNase and methylaton studes wth the trp sense strand, prpg79 was dgested wth EcoR and BamH, and the 308-bp fragment solated. Followng 5' end labelng, a secondary cleavage reacton wth Hha was performed to gve a unque 5'-end-labeled 120-bp trp operator fragment. For studes wth the antsense strand, prpg79 was dgested wth BamH. The lnearzed plasmd was 3'-end-labeled and then cut wth EcoR to generate a 3' sngly end-labeled 308-bp fragment. DNA fragments contanng the mutant trp operator were prepared from plasmd prpg71 by BamH dgeston. The ends were labeled, cut wth EcoR, and the 86-bp mutant trp operator fragment solated. Trp aporepressor purfcaton Trp aporepressor was purfed from E. cold cells as prevously descrbed (Gunsalus and Yanofsky 1980; Arvdson et al. 1987). Analyss of purfed Trp aporepressor proten by SDS-polyacrylamde gel electrophoress revealed the presence of a sngle proten band (Mr = 12,500). The purty was estmated to be greater than 99%. The Trp aporepressor preparatons were greater than 90% actve for operator DNA bndng as determned by a DNase protecton gel assay (Kumamoto and Gunsalus, unpubl.). Proten concentraton was determned by absorbance at 280 nm (El% = 1.2 cm -l rag-l; Joachmak et al. 1983). DNase footprntng of operator DNA For standard DNase footprntng experments, approxmately 20 pmoles of purfed Trp aporepressor was added to approxmately 1 pmole of 32P-labeled operator DNA fragment n 1 ~1 of DNase reacton buffer (30 mm Trs-HC1, ph 8, 100 mm KC1, 3 mm MgC1, 2 mm DTT, 2 mm EDTA, 2 ~g soncated salmon sperm DNA, _+ 1 mm L-tryptophan; Galas and Schmtz 1978). The fnal concentratons of aporepressor and operator used n these experments were typcally n the range of 500 and 5 nm, respectvely, and are at physologcal levels (Gunsalus et al. 1986). All of the DNase and DMS methylaton experments were performed n the presence of salmon sperm DNA (nonspecfc carrer DNA). The operator DNA was present at 20 ng versus 2000 ng of the carrer DNA, whch corresponds to a 100- fold excess on a weght/weght bass, or a 1000-fold molar excess of nonspecfc DNA bndng stes relatve to operator stes. DNase was dluted n DNase buffer supplemented wth 2 mm CaC12 and added at a fnal concentraton of 10 ~g/ml to ntate the reacton. The mxture was ncubated at 37 C for 10 ran and the reacton was then quenched by the addton of 75 ~1 of DNase stop soluton (Galas and Schmdt 1978). The DNA mxture was phenol-treated and desalted on a Sephadex G-25 column, and the DNA fragments were precptated by addton of two volumes of ethanol. Sequence analyss of labeled DNA fragments (Maxam and Glbert 1977) and DNA polyacrylamde gel electrophoress (Sanger and Coulson 1978)were performed as descrbed. Chemcal methylaton of operator DNA by dmethyl sulfate Methylaton protecton reactons wth each strand of the trp, trpr, and aroh operators were carred out usng a standard reacton protocol. Operator DNA (---1 pmole of 5' end-labeled fragment) was added to 200 ~1 of dmethyl sulfate reacton buffer (Glbert et al. 1976) contanng 2 ~g of soncated salmon sperm DNA. Where ndcated, L-tryptophan was present at a fnal concentraton of 1 mm and Trp repressor was added to the teat- 562 GENES & DEVELOPMENT
8 trpr, atoll, and trp operators ton mxture at a fnal concentraton of 250 nm. The mxture was prencubated on ce for 10 mn and the reacton was ntated by addton of dmethyl sulfate (1 ~1). After 5 mn at 20 C, the methylaton reacton was stopped by the addton of DMS stop soluton (50 ~1), the DNA fragments were precptated (2 x ), washed once wth 75% ethanol, and dred (Maxam and Glbert 1977). DNA samples were then treated accordng to the alternatve guanne cleavage (G reacton) or the strong adenne/ weak guanne cleavage (A>G reacton)procedures of Maxam and Glbert (1977). DNA sequence analyss and gel electrophoress were performed as descrbed (Maxam and Glbert 1977; Sanger and Coulson 1978). Enzymes and reagents Calf ntestnal alkalne phosphatase was obtaned from Boehrnger Mannhem (ndanapols, ndana), restrcton enzymes (Hae, Hpa, BamH, and EcoR) were obtaned from BRL (Gathersburg, Maryland)(Sau3A and Sal) or from New England Bolabs (Beverly, Massachusetts), and T4 polynucleotde knase was purchased from Pharmaca-PL Bochemcals (Pscataway, New Jersey). [~/-a2p]atp (3000 C/mmole)and [~-a~p]datp (3000 C/mmole)were obtaned from Amersham (Arlngton Heghts, llnos). Dmethyl sulfate was purchased from Aldrch Chemcal Corporaton (Mlwaukee, Wsconsn). Acknowledgments We thank Phlp Youderan for crtcal comments on the manuscrpt. Ths work was supported by a grant from the Natonal nsttutes of Health {GM 29456) and by a UCLA Bochemcal Research Grant to R.P.G.A.A.K. was supported n part by a Publc Health Servce Genetcs Tranng Grant (GM07104) from the Natonal nsttutes of Health. Reterences Arvdson, D.N., C. Bruce, and R.P. Gunsalus nteracton of the Trp repressor wth ts lgand, t-tryptophan. J. Bol. Chem. 261: Arvdson, D.N., A.A. Kumamoto, and R.P. Gunsalus A smple three-step batch purfcaton of the Eschercha cold Tryptophan repressor. Proten purfcaton: Mcro to macro. UCLA Syrup. Mol. Cell. Bol. New Seres 68: (n press). Bachman, B.J Lnkage map of Eschercha cold K-12, 7 ed. Mcrobol. Rev. 47: Bass, S., P. Sugono, D.N. Arvdson, R.P. Gunsalus, and P. Youderan DNA specfcty determnants of Eschercha cold tryptophan repressor bndng. Genes Dev. 1: Bennett, G.N., M.E. Schwengruber, K.D. Brown, C. Squres, and C. Yanofsky Nucleotde sequence of regon precedng trp mrna ntaton ste and ts role n promoter and operator functon. Proc. Natl. Acad. Sc. 73: Bennett, G.N. and C. Yanofsky Sequence analyss of operator consttutve mutants of the tryptophan operon of Eschercha cold. J. Mol. Bol. 121: Brown, K.D Regulaton of aromatc amno acd bosynthess n Eschercha col K12. Genetcs 60: Cohen, G. and F. Jacob Sur la represson de la synthese des enzymes ntervenant dans la formaton du tryptophane chez Eschercha cold. C.R. Acad. Sc. Ser. D. 248: Galas, D.J. and A. Schmtz DNase footprntng: A smple method for the detecton of proten-dna bndng specfcty. Nuclec Acds Res. 5: Glbert, W., A. Maxam, and A.D. Mrzabekov Control of rbosome synthess, The Alfred Benson Symposum X (ed. N.O. Kjelgaard and O. Maaloe), pp Munksgaard, Copenhagen. Grove, C. and R.P. Gunsalus Regulaton of the aroh operon of Eschercha cold by the tryptophan repressor. J. Bacterol. 169: Gunsalus, R.P. and C. Yanofsky Nucleotde sequence and expresson of Eschercha cold trpr, the structural gene for the trp aporepressor. Proc. Natl. Acad. Sc. 77: Gunsalus, R.P., A. Gunsalus-Mguel, and G.L. Gunsalus ntracellular Trp repressor levels n Eschercha cold. J. Bacterol. 167: Haydock, P.N., G. Bogosan, K. Brechlng, and R.L. Somervlle Studes on the nteracton of trp holorepressor wth several operators. J. Mol. Bol. 170: Joachmak, A., R.L. Kelley, R.P. Gunsalus, C. Yanofsky, and P.B. Sgler Purfcaton and characterzaton of Trp aporepressor. Proc. Natl. Acad. Sc. 80: Johnson, A., B.J. Meyer, and M. Ptashne Mechansm of acton of the cro proten of bacterophage X. Proc. Natl. Acad. Sc. 75: Kelley, R.L. and C. Yanofsky Trp aporepressor producton s controlled by autogenous regulaton and neffcent translaton. Proc. Natl. Acad. Sc. 79: ~ Mutatonal studes wth the Trp repressor of Eschercha cold support the helx-turn-helx model of repressor recognton of operator DNA. Proc. Natl. Acad. Sc. 82: Manats, T., E.F. Frtsch, and J. Sambrook Molecular clonng: A laboratory manual. Cold Sprng Harbor Laboratory, Cold Sprng Harbor, New York. Maxam, A. and W. Glbert A new method for sequencng DNA. Proc. Natl. Acad. Sc. 74: McClarn, J.A., C.A. Frederck, B.C. Wang, P. Greene, H.W. Boyer, J. Grable, and J.M. Rosenberg Structure of the DNA-EcoR endonuclease complex at 3A resoluton. Scence 234: Morse, D. and C. Yanofsky Amber mutants of the trpr regulatory gene. J. Mol. Bol. 44: Oppenhem, D.S., G.N. Bennett, and C. Yanofsky Eschercha col RNA polymerase and Trp repressor nteracton wth the promoter-operator regon of the tryptophan operon of Salmonella typhmurum. J. Mol. Bol. 144: Pttard, J., L. Camakars, and B.J. Wallace nhbton of 3-Deoxy-D-arabnohepulosonc acd-7-phosphate synthetase (trp) n Eschercha col. J. Bacterol. 97: Rose, J.K., C.L. Squres, C. Yanofsky, H. Yang, and G. Zubay Tryptophanyl-tRNA and tryptophanyl trna synthetase are not requred for n vtro represson of the tryptophan operon. Nature New Bol. 245: Sanger, F. and A.R. Coulson The use of thn acrylamde gels for DNA sequencng. FEBS Lett. 87: Schevtz, R.W., Z. Otwnowsk, A. Joachmak, C.L. Lawson, and P.B. Sgler The three-dmensonal structure of trp repressor. Nature 317: Smons, R.W., F. Houman, and N. Kleckner mproved multcopy lac-based proten and operon fuson clonng tools. Gene (n press). Sngleton, C.K., W.D. Roeder, G. Bogosan, R.L. Somervlle, and H.L. Weth DNA sequence of the E. cold trpr gene and predcton of the amno acd sequence of Trp repressor. Nuclec Acd Res. 8: Spndler, K.R., D.S. Rosser, and A.J. Berk Analyss of adenovrus transformng protens from early regons 1A and GENES & DEVELOPMENT 563
9 Kumamoto et al. 1B wth antsera to nducble fuson antgens produced n Eschercha coll. ]. Vrol. 49: Yanofsky, C Tryptophan bosynthess n Eschercha coll. ]. Am. Med. Assoc. 218: Zurawsk, G., R.P. Gunsalus, K.D. Brown, and C. Yanofsky Structure and regulaton of aroh, the structural gene for the tryptophan-repressble 3-Deoxy-D-arabno-heptulosonc acd-7-phosphate synthetase of Eschercha coll. L Mol. Bol. 145: GENES & DEVELOPMENT
10 Eschercha col tryptophan repressor bnds multple stes wthn the aroh and trp operators. A A Kumamoto, W G Mller and R P Gunsalus Genes Dev. 1987, 1: Access the most recent verson at do: /gad References Ths artcle ctes 28 artcles, 14 of whch can be accessed free at: Lcense Emal Alertng Servce Receve free emal alerts when new artcles cte ths artcle - sgn up n the box at the top rght corner of the artcle or clck here. Copyrght Cold Sprng Harbor Laboratory Press
Reduced drift, high accuracy stable carbon isotope ratio measurements using a reference gas with the Picarro 13 CO 2 G2101-i gas analyzer
Reduced drft, hgh accuracy stable carbon sotope rato measurements usng a reference gas wth the Pcarro 13 CO 2 G2101- gas analyzer Chrs Rella, Ph.D. Drector of Research & Development Pcarro, Inc., Sunnyvale,
More informationTerminating Head
Termnatng Head 58246-1 Instructon Sheet for MTA- 100 Receptacle Connectors 408-6929 Usng Dscrete Wre 07 APR 11 Locatng Pawl Feed Slde Tool Base Wre Inserter Adjuster (Inserton Rod) Mass Termnaton Assembly
More informationFirst digit of chosen number Frequency (f i ) Total 100
1 4. ANALYSING FREQUENCY TABLES Categorcal (nomnal) data are usually summarzed n requency tables. Contnuous numercal data may also be grouped nto ntervals and the requency o observatons n each nterval
More informationEvaluation of a Center Pivot Variable Rate Irrigation System
Evaluaton of a Center Pvot Varable Rate Irrgaton System Ruxu Su Danel K. Fsher USDA-ARS Crop Producton Systems Research Unt, Stonevlle, Msssspp Abstrat: Unformty of water dstrbuton of a varable rate center
More information#16 - Profiles & HMMs 9/28/07
# - Profles & HMMs 9/28/7 BCB 444/544 Lecture Profles & Hdden Markov Models (HMMs) #_Sept28 Requred Readng (before lecture) Mon & Wed Sept 24 & 2- Lecture 4 & 5 Revew: Nucleus, Chromosomes, Genes, RNAs,
More informationMechanical Engineering Journal
56789 Bulletn of the JSME Mechancal Engneerng Journal Vol., o., 6 Measurement of three-dmensonal orentaton of golf club head wth one camera Wataru KIMIZUKA* and Masahde OUKI* * DULOP SPORTS CO. LTD. Waknohama-cho
More informationPREDICTIONS OF CIRCULATING CURRENT FIELD AROUND A SUBMERGED BREAKWATER INDUCED BY BREAKING WAVES AND SURFACE ROLLERS. Yoshimitsu Tajima 1
PREDICTIONS O CIRCULATING CURRENT IELD AROUND A SUBMERGED BREAKWATER INDUCED BY BREAKING WAVES AND SURACE ROLLERS Yoshmtsu Tama 1 Ths paper develops a quas-three-dmensonal nearshore current model whch
More informationGAS-LIQUID INTERFACIAL AREA IN OXYGEN ABSORPTION INTO OIL-IN-WATER EMULSIONS
AS-LIQUID INTERFACIAL AREA IN OXYEN ABSORPTION INTO OIL-IN-WATER EMULSIONS ómez-díaz, D. a, omes, N. b, Texera, J.A. b, Belo, I. b a Department of Chemcal Engneerng, Unversty of Santago de Compostela,
More informationADDITIONAL INSTRUCTIONS FOR ISU SYNCHRONIZED SKATING TECHNICAL CONTROLLERS AND TECHNICAL SPECIALISTS
A ADDITIONAL INSTRUCTIONS FOR ISU SYNCHRONIZED SKATING TECHNICAL CONTROLLERS AND TECHNICAL SPECIALISTS DIFFICULTY GROUPS OF FEATURES 1 DEFINITIONS: Change of Rotaton: Refers to TURNS or LINKING STEPS rotatng
More informationCoastal Engineering Technical Note
Coastal Engneerng Techncal Note CETN V-10 Even-Odd Functon Analyss of Shorelne Poston and Volume Change by Jule Dean RoSllt and Nchollls C. Kraus Purpose: To present the background and methodology for
More informationAn intro to PCA: Edge Orientation Estimation. Lecture #09 February 15 th, 2013
An ntro to PCA: Edge Orentaton Estmaton Lecture #09 February 15 th, 2013 Revew: Edges Convoluton wth an edge mask estmates the partal dervatves of the mage surface. The Sobel edge masks are: " #!1 0 1!2
More informationEngineering Analysis of Implementing Pedestrian Scramble Crossing at Traffic Junctions in Singapore
Engneerng Analyss of Implementng Pedestran Scramble Crossng at Traffc Junctons n Sngapore Dr. Lm Wee Chuan Eldn Department of Chemcal & Bomolecular Engneerng, Natonal Unversty of Sngapore, 4 Engneerng
More informationVOLUME TRENDS NOVEMBER 1988 TRAVEL ON ALL ROADS AND STREETS IS FOR NOVEMBER 1988 AS COMPARED UP BY 3.4 PERCENT TO NOVEMBER 1987.
VOLUME U.S. Department of Transportation Federal Highway TRENDS NOVEMBER 1988 TRAVEL ON ALL ROADS AND STREETS S FOR NOVEMBER 1988 AS COMPARED UP BY 3.4 PERCENT TO NOVEMBER 1987. rr ALL DATA FOR THS MONTH
More informationWave Breaking Energy in Coastal Region
ave Breang Energy n Coastal Regon Ray-Qng Ln and Lwa Ln Dept. of Seaeepng Davd Taylor Model Basn NSCCD U.S. Army Engneer Researc and Development Center. INTERODUCTION Huang 006 suggested tat wave breang
More informationEvaluating the Effectiveness of Price and Yield Risk Management Products in Reducing. Revenue Risk for Southeastern Crop Producers * Todd D.
Evaluatng the Effectveness of Prce and Yeld Rsk Management Products n Reducng Revenue Rsk for Southeastern Crop Producers * Todd D. Davs ** Abstract A non-parametrc smulaton model ncorporatng prce and
More informationRCBC Newsletter. August Richmond County Baseball Club. Inside this issue: 2016 College Showcase Camp. Tournament Update.
August 2016 Rchmond County Baseball Club 1400 Travs Ave. Staten Island, NY 10314 RCBC Newsletter If you have any nterestng nfo or news you would lke ncluded n a future newsletter, please emal to jm@rcbclub.com.
More informationM.H.Ahn, K.J.Lee Korea Advance Institute of Science and Technology 335 Gwahak-ro, Yuseong-gu, Daejeon , Republic of Korea
The Methodology on Exposure Dose Evaluaton Modelng Related to Arbtrary Accdent n the Temporary Storage Faclty for Low and Intermedate Level Waste - 9133 M.H.Ahn, K.J.Lee Korea Advance Insttute of Scence
More informationContractor's Material and Test Certificate for Underground Piping
UNDERGROUND PPNG 13-97 Contractors Materal and Test Certfcate for Underground Ppng PROCEDURE Upon completon of work, nspecton and tests shall be made by the contractors representatve and wtnessed by an
More informationPERFORMANCE AND COMPENSATION ON THE EUROPEAN PGA TOUR: A STATISTICAL ANALYSIS
PERFORMANCE AND COMPENSATION ON THE EUROPEAN PGA TOUR: A STATISTICAL ANALYSIS C. Barry Pftzner and Chrs Spence, Department of Economcs/Busness, Randolph-Macon College, Ashland, VA, bpftzne@rmc.edu, cspence@rmc.edu
More informationA Study on Parametric Wave Estimation Based on Measured Ship Motions
1 A Study on Parametrc Wave Estmaton Based on Measured Shp Motons Ulrk Dam NIELSEN * and Tosho ISEKI ** Abstract The paper studes parametrc wave estmaton based on the wave buoy analogy, and data and results
More informationDevelopment of Accident Modification Factors for Rural Frontage Road Segments in Texas
Development of Accdent Modfcaton Factors for Rural Frontage Road Segments n Texas Domnque Lord* Zachry Department of Cvl Engneerng & Center for Transportaton Safety Texas Transportaton Insttute Texas A&M
More informationEquilibrium or Simple Rule at Wimbledon? An Empirical Study
Equlbrum or Smple Rule at Wmbledon? An Emprcal Study Shh-Hsun Hsu, Chen-Yng Huang and Cheng-Tao Tang Revson: March 2004 Abstract We follow Walker and Wooders (200) emprcal analyss to collect and study
More informationLSSVM Model for Penetration Depth Detection in Underwater Arc Welding Process
ISS 1746-7659, England, UK Journal of Informaton and Computng Scence Vol. 5, o. 4, 2010, pp. 271-278 LSSVM Model for Penetraton Depth Detecton n Underwater Arc Weldng Process WeMn Zhang 1, 2, GuoRong Wang
More informationGeophysical validation of NSCAT winds using atmospheric data and analyses
JOURNAL OF GEOPHYSCAL RESEARCH, VOL. 104, NO. C5, PAGES 11,405-11,424, MAY 15, 1999 Geophyscal valdaton of NSCAT wnds usng atmospherc data and analyses R. Atlas, 1 S.C. Bloom, 2 R. N. Hoffman, 3 E. Brn,
More informationJIMAR ANNUAL REPORT FOR FY 2001 (Project ) Project Title: Analyzing the Technical and Economic Structure of Hawaii s Pelagic Fishery
1 JIMAR ANNUAL REPORT FOR FY 2001 (Project 653540) P.I. Name: PngSun Leung, Khem Sharma and Sam Pooley Project Research Assstant: Naresh Pradhan Project Ttle: Analyzng the Techncal and Economc Structure
More informationHigh Speed 128-bit BCD Adder Architecture Using CLA
Hgh Speed 128-bt BCD Archtecture Usng CLA J.S.V.Sa Prasanth 1, Y.Yamn Dev 2 PG Student [VLSI&ES], Dept. of ECE, Swamy Vvekananda Engneerng College, Kalavara, Andhrapradesh, Inda 1 Assstant Professor, Dept.
More information2017 GIRLS CENTRAL DISTRICT PLAYER DEVELOPMENT GUIDE
2017 GIRLS CENTRAL DISTRICT PLAYER DEVELOPMENT GUIDE GENERAL OVERVIEW USA Hockey Grls Player Development Dstrct-Specfc Gude The USA Hockey Grls Player Development Dstrct-Specfc Gude outlnes the 2017 grls
More informationOWNERSHIP STRUCTURE IN U.S. CORPORATIONS. Mohammad Rahnamaei. A Thesis. in the. John Molson School of Business
OWNERSHIP STRUCTURE IN U.S. CORPORATIONS Mohammad Rahnamae A Thess n the John Molson School of Busness Presented n Partal Fulfllment of the Requrements For the Degree of Master of Scence (Busness Admnstraton)
More informationThe impact of foreign players on international football performance
MPRA Munch Personal RePEc Archve The mpact of foregn players on nternatonal football performance Orhan Karaca Ekonomst Magazne, Research Department October 008 Onlne at http://mpra.ub.un-muenchen.de/11064/
More informationWORKING PAPER SERIES Long-term Competitive Balance under UEFA Financial Fair Play Regulations Markus Sass Working Paper No. 5/2012
WORKING PAPER SERIES Impressum ( 5 TMG) Herausgeber: Otto-von-Guercke-Unverstät Magdeburg Fakultät für Wrtschaftswssenschaft Der Dekan Verantwortlch für dese Ausgabe: Otto-von-Guercke-Unverstät Magdeburg
More informationProduct Information. Long-stroke gripper PFH-mini
Product Informaton PFH-mn PFH-mn Loadable. Flexble. Relable. PFH-klen long-stroke grpper 2-fnger parallel grpper wth large jaw stroke for large parts and / or a broad range of parts Feld of applcaton clean
More informationDegassing of deep groundwater in fractured rock
WATER RESOURCES RESEARCH, VOL. 36, NO. 9, PAGES 2477-2492, SEPTEMBER 2000 Degassng of deep groundwater n fractured rock around boreholes and drfts Jerker Jarsj6 and Georga Destoun Dvson of Water Resources
More informationPlanning of production and utility systems under unit performance degradation and alternative resource-constrained cleaning policies
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 Plannng of producton and utlty systems under unt performance degradaton
More informationSpherical solutions of an underwater explosion bubble
89 Sphercal solutons of an underwater exploson bubble Andrew B. Wardlaw, Jr. Naval Surface Warfare Center, Code 423, Indan Head Dvson, Indan Head, MD 20640-5035, USA E-mal: 423@uwtech.h.navy.ml Hans U.
More informationRecreational trip timing and duration prediction: A research note
Recreatonal trp tmng and duraton predcton: A research note Ataelty Halu a and Le Gao a* a School of Agrcultural and Resource Economcs, The Unversty of Western Australa, Crawley, WA 6009, Australa *E-mal
More information2018 GIRLS DISTRICT-SPECIFIC PLAYER DEVELOPMENT GUIDE
2018 GIRLS DISTRICT-SPECIFIC PLAYER DEVELOPMENT GUIDE GENERAL OVERVIEW USA Hockey Grls Player Development Dstrct-Specfc Gude The USA Hockey Grls Player Development Dstrct-Specfc Gude outlnes the 2018 grls
More informationBETHANY TAX INCREMENT FINANCING DISTRICT NO. 1 NOTICE OF TWO PUBLIC HEARINGS
BETHANY TAX NCREMENT FNANCNG DSTRCT NO. 1 NOTCE OF TWO PUBLC HEARNGS On December 12, 2017 at 7:00 P.M., at Bethany Cty Hall, 6700 N.W. 36th Street, Bethany, Oklahoma, the Cty Councl of the Cty of Bethany
More informationSeabed type clustering using single-beam echo sounder time series data
SELECTED TOPICS n POWER SYSTEMS and REMOTE SENSING Seabed type clusterng usng sngle-beam echo sounder tme seres data PETER HUNG, SEÁN MCLOONE Department of Electronc Engneerng, StratAG Natonal Unversty
More informationM. Álvarez-Mozos a, F. Ferreira b, J.M. Alonso-Meijide c & A.A. Pinto d a Department of Statistics and Operations Research, Faculty of
Ths artcle was downloaded by: [b-on: Bbloteca do conhecmento onlne UP] On: 29 May 205, At: 02:46 Publsher: Taylor & Francs Informa Ltd Regstered n England and Wales Regstered Number: 072954 Regstered offce:
More informationALASKA DEPARTMENT OF FISH AND GAME DIVISION OF COMMERCIAL FISHERIES NEWS RELEASE
ALASKA DEPARTMENT OF FISH AND GAME DIVISION OF COMMERCIAL FISHERIES NEWS RELEASE Cora Campbell, Commssoner Jeff Regnart, Drector Contact: Cordova ADF&G Steve Mofftt, PWS Fnfsh Research Bologst 401 Ralroad
More informationGripping force, O.D. gripping. MPZ 20 / 4 bar MPZ 20 / 6 bar. MPZ 20-AS / 4 bar MPZ 20-AS / 6 bar. Gripping force, I.D. gripping
SCHUNK Grppers pneumatc 3-Fnger Centrc Grppers Small Components Grpper Grppng force, O.D. grppng Fnger load Grppng force 50 MPZ 20 / 4 bar MPZ 20 / 6 bar MPZ 20-AS / 4 bar MPZ 20-AS / 6 bar 40 30 20 10
More informationCOMPENSATING FOR WAVE NONRESPONSE IN THE 1979 ISDP RESEARCH PANEL
COMPENSATING FOR WAVE NONRESPONSE IN THE 1979 ISDP RESEARCH PANEL 1. Introducton Graham Kalton, Unversty of Mchgan ames Lepkowsk, Unversty of Mchgan Tng-Kwong Ln. Natonal Unversty of Sngapore The choce
More informationDecomposition guide Technical report on decomposition
June 2013 Decomposton gude Techncal report on decomposton Erasmus MC Start date of project: 20 Aprl 2012 Duraton: 36 months 1 Table of contents Abstract... 4 Acknowledgements... 5 Introducton... 6 Part
More information2017 GIRLS DISTRICT-SPECIFIC PLAYER DEVELOPMENT GUIDE
2017 GIRLS DISTRICT-SPECIFIC PLAYER DEVELOPMENT GUIDE GENERAL OVERVIEW USA Hockey Grls Player Development Dstrct-Specfc Gude The USA Hockey Grls Player Development Dstrct-Specfc Gude outlnes the 2017 grls
More informationSCIENTIFIC COMMITTEE THIRTEENTH REGULAR SESSION. Rarotonga, Cook Islands 9-17 August, 2017
SCIENTIFIC COMMITTEE THIRTEENTH REGULAR SESSION Rarotonga, Cook Islands 9-17 August, 2017 Relatve abundance of yellowfn tuna for the purse sene and handlne fsheres operatng n the Phlppnes Moro Gulf (Regon
More informationFor models: 660 EF/EFO
Installaton Instructons Gas converson kts For models: 660 EF/EFO Part no. 660NGKIT/660LPKIT Warnng: Ths kt must be nstalled by a qualfed nstaller n accordance wth these nstructons and all applcable codes
More informationAalborg Universitet. Published in: 9th ewtec Publication date: Document Version Publisher's PDF, also known as Version of record
Aalborg Unverstet Predctablty of the Power Output of Three Wave Energy Technologes n the Dansh orth Sea Chozas, Jula Fernandez; Jensen,. E. Helstrup; Sørensen, H. C.; Kofoed, Jens Peter; Kabuth, Alna Krstn
More informationStudy on coastal bridge under the action of extreme wave
Study on coastal brdge under the acton of extreme wave Bo Huang Bng Zhu Jawe Zhang School of Cvl Engneerng, Southwest Jaotong Unversty, Chengdu 610031, Chna Abstract In order to research the catastrophc
More informationSample Preparation. Solid Phase Extraction Mechanisms
Sample Preparaton Sold Phase Extracton Mechansms Wherever you see ths symbol, t s mportant to access the on-lne course as there s nteractve materal that cannot be fully shown n ths reference manual. Ams
More informationInternal Wave Maker for Navier-Stokes Equations in a Three-Dimensional Numerical Model
Journal of Coastal Research SI 64 511-515 ICS2011 (Proceedngs) Poland ISSN 0749-0208 Internal Wave Maker for Naver-Stokes Equatons n a Three-Dmensonal Numercal Model T. Ha, J.W. Lee and Y.-S. Cho Dept.
More informationMajor League Duopolists: When Baseball Clubs Play in Two-Team Cities. Phillip Miller. Department of Economics. Minnesota State University, Mankato
Major League Duopolsts: When Baseball Clubs Play n Two-Team Ctes Phllp Mller Department of Economcs Mnnesota State Unversty, Mankato September 2006 Abstract: Ths paper focuses on examnng the attendance
More informationAerator Performance in Reducing Phenomenon of Cavitation in Supercritical Flow in Steep Channel Bed
Engneerng Internatonal Conference UNNES Conservaton 13 Proceedng Aerator Performance n Reducng Phenomenon of Cavtaton n Supercrtcal Flow n Steep Channel Bed Yer Sutopo 1, Bud Wgnyosukarto, Istarto, dan
More informationRisk analysis of natural gas pipeline
Rsk analyss of natural gas ppelne Y.-D. Jo 1, K.-S. Park 1, J. W. Ko, & B. J. Ahn 3 1 Insttute of Gas Safety Technology, Korea Gas Safety Corporaton, South Korea Department of Chemcal Engneerng, Kwangwoon
More informationEndogenous Coalition Formation in Global Pollution Control
Fondazone En Enrco Matte Endogenous Coalton Formaton n Global Polluton Control Mchael Fnus and Banca Rundshagen NOTA DI LAVORO 43.001 JUNE 001 Coalton Theory Network Unversty of Hagen, Germany Ths paper
More informationMethodology for ACT WorkKeys as a Predictor of Worker Productivity
Methodology for ACT WorkKeys as a Predctor of Worker Productvty The analyss examned the predctve potental of ACT WorkKeys wth regard to two elements. The frst s tme to employment. People takng WorkKeys
More informationDRAFT FOR PUBLIC CONSULTATION INTERCONNECTION AGREEMENT v.2.0 FOR IP KULATA/SIDIROKASTRO DEFINITIONS, BUSINESS RULES, EXCEPTIONAL EVENT
RAFT FOR PUBLIC CONSULTATION INTERCONNECTION AGREEMENT v.2.0 FOR IP KULATA/SIIROKASTRO EFINITIONS, BUSINESS RULES, EXCEPTIONAL EVENT ARTICLE 1: EFINITIONS All terms of the INTERCONNECTION AGREEMENT shall
More informationComparisons of Means for Estimating Sea States from an Advancing Large Container Ship
Downloaded from orbt.dtu.dk on: Jan 31, 18 Comparsons of Means for Estmatng Sea States from an Advancng Large Contaner Shp Nelsen, Ulrk Dam; Andersen, Ingrd Mare Vncent; Konng, Jos Publshed n: Proceedngs
More informationEvolutionary Sets of Safe Ship Trajectories: Evaluation of Individuals
Internatonal Journal on Marne Navgaton and Safety of Sea Transportaton Volume 6 Number 3 September 2012 Evolutonary Sets of Safe Shp Trajectores: Evaluaton of Indvduals R. Szlapczynsk Gdansk Unversty of
More informationProduction of Milk Clotting Enzyme in Submerged Fermentation with Streptococcus Lactis by Using Whey Medium
IOSR Journal of Engneerng (IOSRJEN) ISSN (e): 2250-3021, ISSN (p): 2278-8719 Vol. 08, Issue 3 (March. 2018), V2 PP 29-36 www.osrjen.org Producton of Mlk Clottng Enzyme n Submerged Fermentaton wth Streptococcus
More informationAutomated External Defibrillators DESIGNED FOR UNEXPECTED HEROES
Automated External Defbrllators DESIGNED FOR UNEXPECTED HEROES HOPE IS IN YOUR HANDS It happens n a splt second. A person collapses the vctm of sudden cardac arrest (SCA) and the clock starts tckng n the
More information'!' CORDOVA BRANDON GREEN
STERLNG HWY FOREST SERVCE- REGON TEN CHUGACH NATONAL FOREST CORDOVA RANGER DSTRCT PLANS FOR PROPOSED CONSTRUCTON SAND ROAD TRAL PARKNG AREA LEGAL DESCRPTON T. 16 S., R. 2 W., COPPER RVER MERDAN SHEET NDEX
More informationMass Spectrometry. Fundamental GC-MS. GC-MS Interfaces
Mass Spectrometry Fundamental GC-MS GC-MS Interfaces Wherever you see ths symbol, t s mportant to access the on-lne course as there s nteractve materal that cannot be fully shown n ths reference manual.
More informationDynamic Analysis of the Discharge Valve of the Rotary Compressor
Purdue Unversty Purdue e-pubs Internatonal Compressor Engneerng Conference School of Mechancal Engneerng 8 Dynamc Analyss of the Dscharge Valve of the Rotary Compressor Bo Huang Shangha Htach Electrcal
More informationComprehensive evaluation research of volleyball players athletic ability based on Fuzzy mathematical model
ISSN : 0974-7435 Volume 10 Issue 3 Comprehensve evaluaton research of volleyball players athletc ablty based on Fuzzy mathematcal model Shangbn L, Peyu Zhao, Yngshuang Lu, Lxn Wu* Physcal Educaton Department,
More informationBit shape geometric considerations when sampling by dry drilling for obtaining chloride profiles in concrete
Materals and Structures/Matéraux et Constructons, Vol. 34, Aprl 2001, pp 150-154 TECHNICAL REPORTS Bt shape geometrc consderatons when samplng by dry drllng for obtanng chlorde profles n concrete M. A.
More informationResponse based sea state estimation for onboard DSS Safe and Efficient Marine Operations
Response based sea state estmaton for onboard DSS Safe and Effcent Marne Operatons Ulrk Dam Nelsen AMOS Workshop, NTNU, Trondhem, 13 th and 14 th November, 2014 Contents Introducton: Context Montorng and
More informationLake Clarity Model: Development of Updated Algorithms to Define Particle Aggregation and Settling in Lake Tahoe
Lake Clarty Model: Development of Updated Algorthms to Defne Partcle Aggregaton and Settlng n Lake Tahoe Goloka B. Sahoo S. Geoffrey Schladow John E. Reuter Danel Nover Davd Jassby Lake Clarty Model Weather
More informationJohnnie Johnson, Owen Jones and Leilei Tang. Exploring decision-makers use of price information in a speculative market
Johnne Johnson, Owen Jones and Lele Tang Explorng decson-makers use of prce nformaton n a speculatve market Abstract We explore the extent to whch the decsons of partcpants n a speculatve market effectvely
More informationAalborg Universitet. Published in: 9th ewtec Publication date: Document Version Accepted author manuscript, peer reviewed version
Aalborg Unverstet Predctablty of the Power Output of Three Wave Energy Technologes n the Dansh orth Sea Chozas, Jula Fernandez; Jensen,. E. Helstrup; Sørensen, H. C.; Kofoed, Jens Peter; Kabuth, Alna Krstn
More informationModeling the Performance of a Baseball Player's Offensive Production
Brgham Young Unversty BYU ScholarsArchve All Theses and Dssertatons 006-03-09 Modelng the Performance of a Baseball Player's Offensve Producton Mchael Ross Smth Brgham Young Unversty - Provo Follow ths
More informationCAUTION When using any equipment, always follow the manufacturer s instructions for safe operation.
Cleanng 3M Controltac Decorated Graphc Vnyl Awnng Flmand Sgn Facngs Instructon Bulletn 6.1 Release I, Effectve March 2017 (replaces H, Oct 03) These cleanng nstructons are furnshed as a gude. The end-user
More informationGene Regulation II. Genetics Bio 36404
Gene Regulation II Genetics Bio 36404 Review DNA RNA protein Every cell in body has same DNA. Not all cells make all proteins What turns genes on and off? Prokaryotes Operon - group of related genes and
More informationHeart rates during competitive orienteering
BrJ Sp Med 1993; 27(1) Heart rates durng compettve orenteerng S. R. Brd PhD M Bol, R Baley BA and J Lews BA Department of Sport Scence, Chrst Church College, Canterbury, UK Ths study nvestgated the heart
More information1.1 Noise maps: initial situations. Rating environmental noise on the basis of noise maps. Written by Henk M.E. Miedema TNO Hieronymus C.
TIP4-CT-2005-516420 Page 1 of 34 DELIVERABLE D 1.5 CONTRACT N PROJECT N ACRONYM TITLE TIP4-CT-2005-516420 FP6-516420 QCITY Quet Cty Transport Subproject 1 Nose mappng & modellng Work Package 1.1 Nose maps:
More informationA NEW METHOD FOR IMPROVING SCATTEROMETER WIND QUALITY CONTROL
A NEW METHOD FOR IMPROVING SCATTEROMETER WIND QUALITY CONTROL M. Portabella (, A. Stoffelen (, A. Verhoef (, J. Verspeek ( ( Undad de Tecnología Marna CSIC, Pg. Marítm Barceloneta 37-9, 3 Barcelona, Span
More informationCanadian Journal of Fisheries and Aquatic Sciences. Seasonal and Spatial Patterns of Growth of Rainbow Trout in the Colorado River in Grand Canyon, AZ
Seasonal and Spatal Patterns of Growth of Ranbow Trout n the Colorado Rver n Grand Canyon, AZ Journal: Manuscrpt ID cjfas-15-2.r1 Manuscrpt Type: Artcle Date Submtted by the Author: 23-Jun-15 Complete
More informationSummary and Cruise Statistics 8
Suary and Cruse Statstcs 8 July 1, 014 8-1 Cruse Colaton Manual Mnstry of Forests, Lands and NRO 8.1 Plot Suary Reort Overvew The Plot Suary reorts nuber of stes, daeter, and erchantable volue nforaton
More informationCross-shore Structure of Longshore Currents during Duck94
CHAPTER 283 Cross-shore Structure of Longshore Currents durng Duck94 Falk Feddersen 1, R.T. Guza 2, Steve Elgar 3, and T.H.C Herbers 4 Abstract The cross-shore structure of the mean longshore current on
More informationProduct Information. Gripper for small components MPG-plus
Product Informaton Grpper for small components MPG-plus MPG-plus Grpper for small components More powerful. Faster. Longer fngers. MPG-plus grpper for small components 2-fnger parallel grpper wth smooth
More informationPrice Determinants of Show Quality Quarter Horses. Mykel R. Taylor. Kevin C. Dhuyvetter. Terry L. Kastens. Megan Douthit. and. Thomas L.
Prce Determnants of Show Qualty Quarter Horses Mykel R. Taylor Kevn C. Dhuyvetter Terry L. Kastens Megan Doutht and Thomas L. Marsh* The authors would lke to thank Professonal Aucton Servces, Inc. for
More informationA PROBABILITY BASED APPROACH FOR THE ALLOCATION OF PLAYER DRAFT SELECTIONS IN AUSTRALIAN RULES
Journal of Sports Scence and Medcne (2006) 5, 509-516 http://www.jssm.org Research artcle The 8th Australasan Conference on Mathematcs and Computers n Sport, 3-5 July 2006, Queensland, Australa A PROBABILITY
More informationNumerical Study of Occupants Evacuation from a Room for Requirements in Codes
Numercal Study of Occupants Evacuaton from a Room for Requrements n Codes HL MU JH SUN Unversty of Scence and Technology of Chna State Key Laboratory of Fre Scence Hefe 2300326, CHINA muhl@mal.ustc.edu.cn
More informationPedestrian Facilities Planning on Tianjin New Area program
Avalable onlne at www.scencedrect.com ScenceDrect Proceda - Socal and Behavoral Scenc es 96 ( 2013 ) 683 692 13th COTA Internatonal Conference of Transportaton Professonals (CICTP 2013) Pedestran Facltes
More informationNew Roads to International Environmental Agreements: The Case of Global Warming *
New Roads to Internatonal Envronmental Agreements: The Case of Global Warmng * Second draft: February, 24 Johan Eyckmans K.U.Leuven, Centrum voor Economsche Studën, Naamsestraat 69, B-3 Leuven, Belgum
More informationarxiv: v1 [cs.ne] 3 Jul 2017
Modelng preference tme n mddle dstance trathlons Iztok Fster, 1 Andres Iglesas, 2 Suash Deb, 3, 4 Dušan Fster, 5 and Iztok Fster Jr. 6 1 Unversty of Marbor, Faculty of Electrcal Engneerng and Computer
More informationAvailability assessment of a raw gas re-injection plant for the production of oil and gas. Carlo Michelassi, Giacomo Monaci
16 th IMEKO TC4 Symposum Explorng New Fronters of Instrumentaton and Methods for Electrcal and Electronc Measurements Avalablty assessment of a raw gas re-njecton plant for the producton of ol and gas
More informationSteelhead Broodstock Acclimation and Monitoring (BAM) Program in the Okanogan Basin, Annual Report 2012
2012 Annual Report Steelhead Broodstock Acclmaton and Montorng (BAM) Program n the Okanogan Basn, Annual Report covers performance under GPUD Contract No. 430-3559 1/1/2012 12/31/2013 Tbbts, W.T., R.E.
More informationProceedings of the ASME nd International Conference on Ocean, Offshore and Arctic Engineering OMAE2013 June 9-14, 2013, Nantes, France
Proceedngs of the ASME nd Internatonal Conference on Ocean, Offshore and Arctc Engneerng OMAE June 9-,, Nantes, France OMAE-6 ROLL DAMPING COEFFICIENTS ASSESSMENT AND COMPARISON FOR ROUND BILGE AND HARD
More informationSECOND-ORDER CREST STATISTICS OF REALISTIC SEA STATES
SECOND-ORDER CREST STATISTICS OF REALISTIC SEA STATES MARIOS CHRISTOU Shell Internatonal Exploraton and Producton, 2288 GS Rjswjk, The Netherlands. E-mal: maros.chrstou@shell.com PETER TROMANS Ocean Wave
More informationPropagation of Big Island eddies
JOURNAL OF GEOPHYSICAL RESEARCH, VOL. 106, NO. C1, PAGES 935-944, JANUARY 15, 2001 Propagaton of Bg Island eddes Chrstna L. Holland and Gary T. Mtchum College of Marne Scence, Unversty of South Florda,
More informationSafety Impact of Gateway Monuments
*Manuscrpt Clck here to vew lnked References Ye, Venezano, and Lord 1 Safety Impact of Gateway Monuments Zhru Ye a,*, Davd Venezano a, Domnque Lord b a Western Transportaton Insttute, Montana State Unversty,
More informationPERMIT TRADING AND STABILITY OF INTERNATIONAL CLIMATE AGREEMENTS 19. MICHAEL FINUS * University of Hagen and National University of Singapore
Journal of Appled Economcs. Vol IX, No. 1 (May 2006), 19-47 PERMIT TRADING AND STABILITY OF INTERNATIONAL CLIMATE AGREEMENTS 19 PERMIT TRADING AND STABILITY OF INTERNATIONAL CLIMATE AGREEMENTS JUAN-CARLOS
More informationCFD Simulation of R134a and R410A Two-Phase Flow in the Vertical Header of Microchannel Heat Exchanger
Purdue Unversty Purdue e-pubs Internatonal Refrgeraton and Ar Condtonng Conference School of Mechancal Engneerng 2016 CFD Smulaton of R134a and R410A Two-Phase Flow n the Vertcal Header of Mcrochannel
More informationAalborg Universitet. CLIMA proceedings of the 12th REHVA World Congress Heiselberg, Per Kvols. Publication date: 2016
Aalborg Unverstet CLIMA 2016 - proceedngs of the 12th REHVA World Congress Heselberg, Per Kvols Publcaton date: 2016 Document Verson Publsher's PDF, also known as Verson of record Lnk to publcaton from
More informationOklahoma Corporation Commission Oil & Gas Conservation Division Post Office Box Oklahoma City, Oklahoma Rule 165:
Oklahoma Corporaton Commsson Ol & Gas Conservaton Dvson Post Offce Box 52000 Oklahoma Cty, Oklahoma 73152-2000 Rule 165: 10-3-25 Form 1002A AP No.: 35043231380001 OTC Prod. Unt No.: 043-205416 Completon
More informationBourdon tube pressure gauges for chemical applications with electrical contact
Electrcal contacts chemcal applcatons wth electrcal contact Measurng system fully welded to housng Robust mechatroncal pressure gauge Up to three contacts Tghtness-tested wth helum GOSSTNDRT-certfed Page
More informationAMP-O-MATIC* Side-Feed Stripper-Crimper III Machine No [ ] customer manual TOOLING ASSISTANCE CENTER
AMP-O-MATIC* Sde-Feed Strpper-Crmper III Machne No. 1320895-[ ] Customer Manual 409-10012 28 DEC 11 SAFETY A. PRECAUTIONS READ THIS FIRST!............................ 2 customer manual 1. INTRODUCTION.......................................................
More informationA Prediction of Reliability of Suction Valve in Reciprocating Compressor
Purdue Unversty Purdue e-pubs nternatonal Compressor Engneerng Conference School of Mechancal Engneerng 1996 A Predcton of Relablty of Sucton Valve n Recprocatng Compressor W. H. You Samsung Electroncs
More informationEvaluating Rent Dissipation in the Spanish Football Industry *
Evaluatng Rent Dsspaton n the Spansh Football Industry * Gudo Ascar Dp. d Economa Poltca e Metod Quanttatv Va S. Felce 5 27100 Pava, Italy Tel: (+39) 0382 506211 Fax: (+39) 0382 304226 gascar@eco.unpv.t
More informationThe fish community of Rat Cove, Otsego Lake, sumn,er 1997
74 The fsh communty of Rat Cove, Otsego Lake, sumn,er 1997 Mcah ngalls ABSTRACT n Rat cove thrteen speces of fsh were documented durng the summer of 1997: alewfe (Alosa pseudoharengus), yellow perch (Percaflavenscens),
More information