Optogenetic control of Drosophila using a red-shifted channelrhodopsin reveals experience-dependent influences on courtship

Transcription

1 Optogeneti ontrol of Drosophil using red-shifted hnnelrhodopsin revels experiene-dependent influenes on ourtship Hidehiko K Ingki 1,2,, Yonil Jung 1,2,, Eri D Hoopfer 1,2, Alln M Wong 1,2, Neeli Mishr 2, John Y Lin 3, Roger Y Tsien 1,3 & Dvid J Anderson 1,2 213 Nture Ameri, In. All rights reserved. Optogenetis llows the mnipultion of neurl tivity in freely moving nimls with milliseond preision, ut its pplition in Drosophil melnogster hs een limited. Here we show tht reently desried red tivtle hnnelrhodopsin () permits ontrol of omplex ehvior in freely moving dult flies, t wvelengths tht re not thought to interfere with norml visul funtion. This tool ffords the opportunity to ontrol neurl tivity over rod dynmi rnge of stimultion intensities. Using time-resolved tivtion, we show tht the neurl ontrol of mle ourtship song n e seprted into (i) proilisti, persistent nd (ii) deterministi, ommnd-like omponents. The former, ut not the ltter, neurons re sujet to funtionl modultion y soil experiene, whih supports the ide tht they onstitute lous of stte-dependent influene. This seprtion is not evident using thermogeneti tools, result undersoring the importne of temporlly preise ontrol of neuronl tivtion in the funtionl dissetion of neurl iruits in Drosophil. D. melnogster is one of the most powerful model orgnisms ville for the geneti dissetion of neurl iruit funtion 1,2. Likewise, the use of light-sensitive miroil opsins, suh s hnnelrhodopsin, hs revolutionized the funtionl dissetion of neurl iruits in ehving nimls 3,. Unfortuntely, with the exeption of lrvl neurons nd peripherl sensory neurons in dults 5 13, this powerful tehnology nd model orgnism hve een lrgely inomptile in the se of dult flies (ut see refs. 1,13). Therefore, Drosophil reserhers hve, to lrge extent, een unle to exploit the rpidly expnding optogeneti toolkit for neurl iruit mnipultion. Although P2X2, n ionotropi purinergi reeptor, hs een used s n optogeneti tool in dult Drosophil, this tehnique requires injetion of ged ATP into the rins of individul nesthetized flies 1. This reltively invsive tehnology is suoptiml for mny pplitions, espeilly lrge-sle, high-throughput sreening. In the sene of file optogeneti mnipultion, dtrpa1, thermosensitive tion hnnel, hs een the preferred method for neuronl tivtion in freely ehving dult flies 1,15. Beuse this method depends on hnges in temperture to ontrol neuronl tivity, however, it lks preision in oth the temporl nd intensity domins nd suffers from potentilly onfounding influene of temperture hnges on ehvior. Here we demonstrte tht expression of in dult entrl nervous system (CNS) neurons enles rpid nd temporlly preise ontrol of ehvior in freely moving dult Drosophil. Using this optogeneti method, we hve seprted the ontrol of wing extension, mle-speifi ourtship ehvior, into either proilisti, stte-dependent or deterministi, ommndlike omponents. Moreover, y omining tivtion with funtionl lium imging, we hve lso identified neurl orrelte of the influene of soil experiene on mle ourtship ehvior. RESULTS Optogeneti vs. thermogeneti ontrol of gusttory neurons We resoned tht previously desried hnnelrhodopsin-2 (ChR2) vrints do not work well in dult Drosophil owing, t lest in prt, to low penetrne of lue light through the utile. Indeed, diret mesurements in vivo indited tht the penetrne of lue light through the utile is muh weker (~1%) thn tht of longer wvelengths suh s green or red light (5 1%) (Fig. 1). Therefore, we reted trnsgeni flies tht express the reently developed red-shifted hnnelrhodopsins, (T/T) 16 nd 17 under the ontrol of the Gl upstrem tivting sequene (UAS) system, to test whether red-shifted light n penetrte the utile suffiiently to tivte neurons expressing these hnnels (see Supplementry Tle 1 for listing of ll trnsgeni fly strins reted). We first ompred the effiy of different opsins to tivte sugr-sensing gusttory reeptor neurons (GRNs) tht express the reeptor Gr5 18. Optogeneti tivtion of Gr5 neurons using ChR2 hs previously een shown to trigger the proosis extension reflex (PER) in Drosophil 6,12 (Supplementry Video 1). All of the lue light sensitive opsin vrints tested (ChR2 (refs. 19,2), 1 Howrd Hughes Medil Institute, Psden, Cliforni, USA. 2 Division of Biology, Cliforni Institute of Tehnology, Psden, Cliforni, USA. 3 Deprtment of Phrmology, University of Cliforni, Sn Diego, L Joll, Cliforni, USA. These uthors ontriuted eqully to this work. Correspondene should e ddressed to D.J.A. (wuwei@lteh.edu). Reeived 3 August; epted 18 Novemer; pulished online 22 Deemer 213; doi:1.138/nmeth.2765 nture methods ADVANCE ONLINE PUBLICATION

2 213 Nture Ameri, In. All rights reserved. Figure 1 Optogeneti versus thermogeneti ontrol of Gr5 GRNs. () Penetrne of light through the dult fly utile. n = 3. P =.6 for one-wy ANOVA followed y t-test with Bonferroni orretion (P <.1). () Frtion of flies showing PER triggered y different opsins expressed in Gr5 GRNs. Frtions indite the numer of responders out of the numer of flies tested. Ativtion wvelengths re represented s lue (7 nm), green (53 nm) nd red (627 nm) rs. For the noopsin ontrol, ll the wvelengths were tested. ( e) Behviorl () nd eletrophysiologil (d,e) responses of flies expressing in Gr5 GRNs. Red lines ( e) represent the photostimultion pttern (627 nm, 1.1 mw/mm 2 ); pulsed photostimultion (right) ws delivered t 1 Hz (1-ms pulse width). In, rster plots show PER outs, nd lue urves show the frtion of flies showing PER (time ins: 1 s; n = 16). In d, rster plots show Gr5 GRNs spikes; the lower plots show verge spiking rte (red) nd spiking rtes for individul flies (gry; time ins, 2 ms; n = 6). (e) Smple tres. (f) Ltenies to first spike following photostimultion onset from d. Box plot whiskers represent 1.5 interqurtile rnge of the lower nd upper qurtiles; ox limits indite lower qurtile, medin nd upper qurtile, from ottom to top; + indites outlier dt eyond the whiskers. (g) Overly of normlized PER nd firing frequenies during ontinuous photostimultion sed on,d. (h) Top, mesured temperture hnge used y het soure pled ner the lellum. Center, plots representing spikes in Gr5 GRNs expressing dtrpa1. Bottom, spiking responses plotted s in d; n =. H13R (ref. 21) nd C128T (ref. 22)) indued PER ehvior in response to photostimultion t 7 nm, lthough only H13R Normlized response yielded responses in 1% of flies (Fig. 1). Flies expressing in Gr5 GRNs yielded roust PER responses to oth red (627 nm) nd green (53 nm) light. In ontrst, flies expressing (T/T) did not exhiit PERs in response to either red or green light (Fig. 1). Insted, they moved their proosis slightly, leit in mnner time loked to photostimultion, suggesting tht (T/T) hs only wek ility to tivte Gr5 GRNs. Surprisingly, in flies expressing dtrpa1 in Gr5 GRNs, we did not oserve ny ehviorl response t n mient temperture known to tivte the ion hnnel (32 C) 8,15 (Fig. 1) or during grdul rmping to this temperture from 22 C (dt not shown). Interestingly, tivtion of dtrpa1 in Gr5 GRNs using het pulses from n infrred (IR) lser 23 hs een reported to indue PER. Upon ontinuous urrent injetion, some neurons develop depolriztion lok 2. We resoned tht if Gr5 neurons re ontinuously or grdully tivted vi TrpA1, they my undergo rpid depolriztion lok tht prevents PER ehvior. Consistent with this ide, ontinuous illumintion of Gr5- flies produed only trnsient PER retion (hlf-time for dey, 1.5 s), wheres pulstile illumintion (1 Hz, 1-ms pulse durtion) evoked trin of PERs time loked to eh light pulse (Fig. 1 nd Supplementry Video 1). Frtion of flies showing PER d Firing frequeny (Hz) e f Penetrne (%) g 1 mv Ltenies to spiking (ms) Wvelength (nm) s Continuous P <.1 + 1st 2nd 3rd th 5th Suessive light pulses PER (ehvior) Firing frequeny Frtion of flies showing ehvior /19 h 1..5 Temp ( C) Spike frequeny (Hz) No opsin ChR /11/1 7/1 Gr5 GAL H13R C128T /1 / Het ON 9/1 1/1 dtrpa1 Het OFF Consistent with this result, eletrophysiologil reording of Gr5 GRNs reveled tht pulsed light used ontinuous ursts of spiking throughout the stimultion period (Fig. 1d,e) with short ltenies (Fig. 1f). In ontrst, spiking tivity deyed exponentilly during ontinuous light stimultion (hlf-time for dey, ~1.5 s; Fig. 1d,e). The rpid dey of oth spiking nd PER ehvior during ontinuous tivtion of (Fig. 1g; Person s orreltion oeffiient, r =.96) suggests tht the former likely ounts for the ltter. Similr to the results otined using ontinuous tivtion, TrpA1 tivtion triggered only trnsient spiking in Gr5 GRNs, with strong dey fter severl seonds (Fig. 1h). Together, these dt my explin why PER responses were not indued y onstitutive or grdul therml tivtion in Gr5-TrpA1 expressing flies (Fig. 1). They lso reonfirm the importne of pulsed tivtion of neurons to void depolriztion lok, s reported previously in other systems (ut note tht depolriztion lok does not our in ll neuronl sutypes 8 ). Ativtion of CNS neurons with Only few studies hve reported suessful eliittion of ehvior in dult Drosophil y tivting CNS neurons expressing lue /1 ADVANCE ONLINE PUBLICATION nture methods

3 213 Nture Ameri, In. All rights reserved. light sensitive opsins 1,13. To determine whether tivtion using would e more effetive, we diretly ompred the ehviorl responses of flies expressing lue light nd red light sensitive opsins in GAL lines driving expression in different popultions of CNS neurons. These lines inluded h9 (exex)-gal (ref. 25), whose tivtion indues side wlking (Supplementry Video 2) nd, t higher intensities, prlysis (loss of posturl ontrol nd immoility); Corzonin (Crz)-GAL, whose tivtion indues dominl ending nd ejultion 26 (Supplementry Video 3); fru-gal (ref. 27), whih lels ~1,5 neurons throughout the rin nd whose tivtion in mles indues mting ehvior inluding wing extension 28 nd dominl ending, nd t higher intensities, prlysis is oserved (Supplementry Video ); nd P1-GAL, split GAL (refs. 29,3) driver generted from prentl GAL lines 31 identified in ehviorl sreen (E.D.H. nd D.J.A., unpulished dt) tht is speifilly expressed in ~16 2 mlespeifi P1 neurons nd whose tivtion eliits wing extension in mles in the sene of femles 28,32 (Supplementry Video 5). To filitte the ontrol nd monitoring of light-indued ehviors in freely moving dult flies in high-throughput, ost-effetive nd flexile mnner, we developed high-power LED sed tivtion system (Fig. 2 ; Supplementry Fig. 1, Supplementry Tle 2, Supplementry Softwre nd Online Methods). Strikingly, mong ll five opsins tested using these CNS drivers, ws the only one whose tivtion yielded roust ehviorl phenotypes in light-dependent mnner (Fig. 2d). The evoked ehviors were not due to innte responses to light: ontrol flies lking UAS- did not exhiit them in response to ll the wvelengths tested (Fig. 2d). The ft tht lue light tivted opsins yielded ehviorl response (PER) when expressed in GRNs ut not in the CNS neurons tested here likely reflets the ft tht the peripherl GRNs re loted lose to the utile, where lue light my penetrte more esily. Anlysis of (T/T) expression in CNS neurons reveled tht this opsin is expressed wekly in ell somt nd not trffiked to roriztions, wheres is strongly expressed in somt nd is trffiked to roriztions s well (Supplementry Fig. 2). This differene likely ounts for the different effiies of the two red-shifted opsins in this system. The pek of the tion spetrum (mesured in ultured hippompl neurons) is ~59 nm (ref. 17). The effiy of tivtion y different wvelengths in freely ehving flies will, however, reflet omintion of ftors inluding utiulr penetrtion nd intensity s well s proximity to pek sensitivity. To empirilly determine the optiml wvelength of light for ehviorl ssys, therefore, we ompred the ility of lue (7-nm), green (53-nm), mer (59-nm) nd red (627-nm) light to indue ehvior in flies expressing under the ontrol of different CNS GAL drivers. When not normlized for intensity, green LEDs hd the strongest pity to eliit -dependent ehviors (Fig. 2d,f,g). In some ses (pip1 neurons; see elow), roust ehviorl responses were deteted only using green light nd hrdly t ll using other wvelengths. Although mer light is losest to the pek of the tion spetrum, ommeril LEDs of this wvelength re dimmer thn the others nd therefore did not eliit strong ehviorl responses (Fig. 2f,g). Although TrpA1-medited tivtion of P1 neurons n eliit wing extension 28,32, in our diret omprison the frtion of solitry mle flies showing wing extension phenotype ws muh higher using nd green light thn using TrpA1 (Fig. 2d). This suggests tht the intensity of tivtion otined using (nd green light) n e sustntilly stronger thn tht hieved using dtrpa1, without sujeting flies to the high tempertures neessry to tivte the ltter. Nevertheless, lthough green LEDs eliited the strongest ehviorl responses, flies n see this wvelength, wheres their sensitivity to wvelengths >62 nm is muh lower 33,3 (see, however, ref. 35). Therefore, we used red LEDs whenever possile to void ehviorl rtifts used y strong visul stimultion. To investigte whether the strength of given dependent ehviorl phenotype n e quntittively tuned, we tested multiple frequenies nd intensities of light pulses using the P1-GAL driver (pulse width, 5 ms). There ws frequenydependent inrese in the frtion of flies showing wing extension s well s in the verge numer nd durtion of wing extension outs per fly (Fig. 2e nd Supplementry Fig. 2e), even when we orreted for the totl durtion of illumintion (Supplementry Fig. 2f). The h9-gal nd fru-gal drivers lso yielded n inrese in the frtion of flies showing the respetive ehviorl responses s the intensity ws inresed, leit over different rnges (Fig. 2f,g). Together these dt indite tht n e used to tune ehviorl phenotypes y vrying the light intensity nd/or pulse frequeny, over reltively rod dynmi rnge. Proilisti vs. deterministi ontrol of wing extension Previous studies of the neurl iruitry underlying mle ourtship ehvior in Drosophil hve used neuronl tivtion methods, inluding P2X2 nd TrpA1, to identify different neuronl sulsses tht ontrol ourtship song 28,32,36,37. In prtiulr, studies using TrpA1 hve desried two neuronl lsses in the entrl rin ontrolling this ehvior: one, lled P1 or pmp, onstitutes popultion of interneurons 28,32,37, nd the other, lled pip1, onstitutes smll group of desending neurons tht projet to the ventrl nerve ord 28 (Fig. 3). The presynpti terminls of P1 neurons overlp with the dendrites of pip1 neurons, whih suggests tht they my e synpti prtners 28 ; however, the differene, if ny, etween the roles of these neurons in ontrolling ourtship song hs not een pprent, s similr ehviors re evoked y TrpA1-medited stimultion of oth lsses 28. We used the time-resolved ontrol of neuronl tivtion fforded y to ompre the temporl ptterns of stimultion-evoked ehviorl responses in P1 versus pip1 neurons. To express in the ltter ells, we used n intersetionl strtegy omining speifi GAL line (VT556; ref. 28) with fru-flp 38 nd UAS>mCherry> trnsgene (where > denotes FRT sites, the trget of Flp reominse; see Supplementry Fig. 2, nd Supplementry Tle 1). Antomil nlysis using Citrine reporter fused to the C terminus of onfirmed the restrited expression of in flies of the pproprite intersetionl genotype (Supplementry Fig. 2d). Surprisingly, we found tht the temporl dynmis of wing extension evoked y tivtion of P1 nd pip1 neurons were strikingly different. -medited tivtion of P1 neurons evoked wing extension in proilisti or stohsti mnner: the initition of wing extension ws not time loked to the onset of illumintion ut rther ourred with vrile ltenies nture methods ADVANCE ONLINE PUBLICATION

4 (i) PC (ii) LED ontroller (iv) CMOS mer (iv) (i) Arduino Uno miroontroller Trigger Infrred filter (iii) (ii) PWM 5 V RC LPF Control (V in ): 5 V LED driver 32 V DC (v) LEDs & ehvior hmer 85-nm inditor LED LED urrent 7 ma 627-nm LEDs Het sink Behviorl hmer (v) Het sink High-power LED 85-nm inditor LED Fly 213 Nture Ameri, In. All rights reserved. d Frtion of flies showing ehvior e Frtion of flies showing ehvior /2 /8 /8 /8 /8 /8 P1-GAL No. of wing extension outs 5% point: 38.3 Hz Frequeny (Hz) (pulse width: 5 ms) (iii) Power supply h9-gal n.s. P <.1 7/7 17/2 7/8 No opsin ChR2 H13R C128T dtrpa P1-GAL Frequeny (Hz) (pulse width: 5 ms) Crz-GAL n.s. P <.1 1/6 1/6 /18 /6 /6 /6 No opsin ChR2 H13R C128T f Frtion of flies showing ehvior (h9-gal) 6/6 6/ Infrred k light /2 /8 /8 /8 /8 /8 1 m fru-gal n.s. P <.5 Red light stimultion (627 nm) Amer light stimultion (59 nm) Green light stimultion (53 nm) Blue light stimultion 16/2 8/8 7/7 No opsin ChR2 H13R C128T dtrpa1 No ehvior Side wlking Prlysis (7 nm) g Frtion of flies showing ehvior (fru-gal) P1-GAL n.s. /2 /8 /8 /8 /8 /8 P <.1 n.s. 3/8 8/8 2/7 No opsin ChR2 H13R C128T dtrpa1 Red light stimultion (627 nm) Amer light stimultion (59 nm) No ehvior Wing extension Prlysis Green light stimultion (53 nm) Blue light stimultion (7 nm) Figure 2 enles light-dependent tivtion of CNS neurons in Drosophil. (,) Experimentl setup for high-power LED sed tivtion system. Eh romn numerl in the digrm () orresponds to tht in the photogrph () (see Supplementry Fig. 1 nd Supplementry Tle 2). PWM, pulse-width modultion; RC LPF, resistor-pitor low-pss filter; CMOS, omplementry metl-oxide semiondutor. () View from the CMOS mer. (d) Comprison of ehviorl responses of flies expressing different hnnelrhodopsin vrints in distint CNS supopultions. Plot properties re s in Figure 1. Frtion of flies showing ehvior indites side-wlking or knokout phenotype (h9-gal), ejultion (Crz-GAL), wing extension or knokout (fru-gal), or wing extension (P1-GAL). No opsin is the empty promoter GAL (BFP-GAL; Online Methods) rossed with UAS-. Flies showing ny of the hrteristi ehviors during 1 min of ontinuous photostimultion were sored s responders. P vlues represent Fisher s ext test with Bonferroni orretion (ompring no-opsin ontrol with eh olumn). P vlues for signifint olumns in d, from left to right nd eh 1, re.3, 56, 12, 77, 77, 13, 6.2, 12 nd 6.2. n.s., not signifint. (e) -medited tivtion of P1 neurons using different frequenies of red light pulses (627 nm, 1.1 mw/mm 2, 1 min) (P1-GAL; UAS-(ttP)). The frtion of flies showing wing extension during 1-min photostimultion trils ws fitted y sigmoidl funtion to lulte the 5% point. n = 8. Box plots properties re s in Figure 1f. (f,g) Frtion of flies exhiiting hrteristi ehviors t different photostimultion intensities nd wvelengths, in nimls expressing h9-gal (f) or fru-gal (g) nd UAS-. n = 8. throughout the stimultion period (17.7 ± 27.5 s (men ± s.d.); Fig. 3,). The verge durtion of eh out ws short (.99 ±.8 s) reltive to the durtion of photostimultion (3 s). Finlly, the termintion of the ehvior ws not time loked to the termintion of stimultion; rther, we oserved persistent wing extension outs in the intervls etween photostimultion trils (Fig. 3,e; Person s orreltion oeffiient etween stimultion pttern nd ehviorl response, r =.). In ontrst to the results oserved with P1 neurons, tivtion of pip1 neurons triggered roust wing extension in deterministi mnner (Fig. 3 nd Supplementry Video 5). The onset of the ehvior ws strongly time loked to the onset of stimultion, with very short lteny (.8 ±. s; Fig. 3,). One initited, wing extension ontinued throughout the photostimultion period nd terminted, with few exeptions, with the end of photostimultion (Fig. 3,d; Person s orreltion oeffiient ADVANCE ONLINE PUBLICATION nture methods

5 P1 neurons (n = 8) green light (53 nm),.7 mw/mm 2 pip1 neurons (n = 8) green light (53 nm),.7 mw/mm Nture Ameri, In. All rights reserved. Frtion of flies showing wing extension Sensory ues Brin P1 pip1 VNC CPG Wing extension Ltenies of wing extension to the first light pulse (s) etween stimultion pttern nd ehviorl response, r =.993). With weker intensities of illumintion lose to the wing extension response threshold (.12 mw/mm 2 ), suh responses were less effiiently evoked; ut responses were still restrited to the photostimultion period, nd no persistent ehvior etween trils ws oserved (Supplementry Fig. 3). These differenes etween P1 nd pip1 neurons in the temporl dynmis of tivtion-evoked wing extensions do not reflet higher sensitivity of pip1 neurons reltive to P1 neurons euse the intensity dependene of pip1-evoked wing extension y green light ws lmost identil to tht of P1 neurons (Fig. 3f). Moreover, these properties were lrgely independent of illumintion intensity (Figs. nd 5). Soil isoltion modultes -tivted wing extension The proilisti or ising nture of the wing extension responses eliited y -medited tivtion of P1 neurons suggested tht these neurons might enode, or e modified y, stte-dependent influenes on mle ourtship ehvior. Interestingly, soil isoltion of mle flies for more thn severl dys enhnes ourtship ehvior, inluding singing, towrd femles 39. To investigte whether P1 neurons might e modulted y suh experiene, we first determined whether soil isoltion lowers the threshold for eliiting wing extension y using -medited stimultion of these neurons. Indeed, the intensity of red light tht evoked wing extension in 5% of flies expressing in P1 neurons ws lower in mles tht were soilly isolted for 7 d (single housed mles, or SH) thn in group-housed mles (GH; Fig. ). A similr effet ws oserved using green light P1 P = pip1 d Totl durtion of wing extension during light (s) P1 P = pip e Numer of outs fter the light P = P1 pip1 (Supplementry Fig. 3). For eh of three different prmeters mesured, soilly isolted flies exhiited signifintly higher vlues thn group housed flies (Fig. ). Thus, soil isoltion effetively tuned the response to tivtion of P1 neurons suh tht the proility of wing extension response ws inresed. These dt suggest tht the inresed sensitivity to tivtion of wing extension ours in P1 neurons themselves, or in funtionlly downstrem popultion. Beuse pip1 neurons re thought to e funtionlly downstrem of P1 neurons 28 (Fig. 3), we investigted whether tivtion of wing extension vi these desending neurons ws lso sensitive to soil experiene. Beuse red light ws not strong enough to tivte wing extension in mle flies expressing in pip1 neurons, we used green light to trigger wing extension. Ativtion of pip1 neurons using did not revel ny differenes etween singly housed nd group-housed flies in the effiieny with whih photostimultion evoked wing extension ehvior, even t lower intensities tht evoked responses in only suset of flies (Fig. 5). These dt indite tht the enhned sensitivity of -evoked wing extension in singly housed flies using the P1-GAL driver is likely to our in P1 neurons themselves (or in other downstrem neurons) rther thn in pip1 neurons. They lso indite tht the sensitiztion of the P1 response y soil isoltion does not reflet generl inrese in sensitivity mong ll neurons involved in wing extension ehvior. Funtionl lium imging omined with tivtion To exmine diretly whether soil isoltion enhnes the sensitivity of P1 neurons to tivtion, we performed lium f Frtion of flies showing ehvior during light P1 neurons. pip1 neurons 5% point.2 P1:.13 pip1: Figure 3 Proilisti versus deterministi optogeneti ontrol of ourtship song. () Ativtion of P1 neurons (P1-GAL; UAS-(VK5)) (left) nd pip1 neurons (VT556/UAS>mCherry>(ttP); fru-flp) (right) with green light (53 nm,.7 mw/mm 2 ). Top, rster plot representing wing extension outs (n = 8 flies per genotype). Green rs represent 3-s ontinuous photostimultion trils with 12-s intertril intervls. Bottom, frtion of flies showing wing extension (time ins, 5 s). Note the different y-xis sles. P1 responses during trils 2 nd 3 re more lerly phsed to the onset of photostimultion t lower light intensities (Supplementry Fig. 3). () Shemti illustrting neuronl iruit ontrol of ourtship song, simplified from ref. 28. VNC, ventrl nerve ord; CPG, entrl pttern genertor. () Lteny to first wing extension fter onset of the first photostimultion. (d) Totl durtion of wing extension during photostimultion. (e) Numer of wing extension outs during 3 s following photostimultion termintion. Plots in e re sed on dt in. P vlues represent Mnn-Whitney U tests. Box plots properties re s in Figure 1f. (f) Frtion of flies showing wing extension during single photostimultion tril s funtion of light intensity (green light: 53 nm, ontinuous, 3 s). The dt were fitted y sigmoidl funtion to lulte the 5% point. n = 32 for oth P1 neurons nd pip1 neurons. nture methods ADVANCE ONLINE PUBLICATION

6 213 Nture Ameri, In. All rights reserved. Figure Soil isoltion lowers the threshold for -tivted mle ourtship ehvior. () Rster plots representing wing extension outs from group-housed (GH) or singly housed (SH) flies expressing in P1 neurons (P1-GAL/UAS-(VK5)). Flies were tivted with different intensities of red light (627 nm). red rs in rster plots indite photostimultion trils (3 s of ontinuous light), with different intensities indited ove the rs; n = 32 flies per intensity. () Frtion of flies showing wing extension sed on the rster plots in. Dt were inned every 1 s. The time sle is the sme in nd. () Different prmeters extrted from the rster plots in. Properties of ox plots re s in Figure 1f; + indites outlier dt lrger thn the upper whisker. P vlues were otined from Friedmn s test ompring SH nd GH flies (P = ) followed y Fisher s ext test with Bonferroni orretion ompring SH nd GH flies t eh intensity of light (*P =.1) (, left); Kruskl-Wllis one-wy ANOVA followed y Mnn-Whitney U tests with Bonferroni orretion (*P =.27 nd **P <.5) (, enter nd right); nd Kruskl-Wllis one-wy ANOVA P = (, enter) nd P = (, right). GH flies (n = 32) SH flies (n = 32) imging experiments in isolted fly rins using lser-snning two-photon mirosopy, tking dvntge of the reltive seprtion of the tion spetrum peks for nd GCMP3. (ref. ; Fig. 6). Notly, oexpression of GCMP3. in P1 neurons together with did not diminish the ility of the GH flies (n = 32) SH flies (n = 32).9.11 Frtion of flies showing ehvior Frtion of flies showing ehvior during light intensity (mw/mm 2 ) % point SH:.73 GH: 1.12 * Totl durtion of wing extension (s) * 1 ** Numer of wing extension outs ltter to medite light-evoked wing extension in freely moving flies, result inditing tht the lium-uffering effet of GCMP3. does not interfere with this ehvior (dt not shown). An mer LED (59 nm) ws used for photostimultion during imging experiments in order to mximize overlp with the pek of.2 intensity (mw/mm 2 ) ** Frtion of flies showing ehvior during light All pirs n.s. SH flies GH flies % point SH:.13 GH: Frtion of flies showing ehvior SH flies.8 GH flies Totl durtion of wing extension (s) All pirs n.s Figure 5 Optogeneti tivtion of pip1 neurons is not modulted y soil isoltion. () Rster plot representing wing extension outs from group-housed (GH) or singly housed (SH) flies expressing in pip1 neurons (VT556-GAL (ref. 2)/UAS>mCherry>(ttP); fru-flp). Flies were tivted with different intensities of green light (53 nm). Green rs indite photostimultion trils (3 s of ontinuous light), with different intensities indited ove the rs. n = 32 flies per intensity. () Frtion of flies showing wing extension sed on the rster plot in. The time sle is the sme in nd. () Different prmeters extrted from the rster plots in. The GH dt in the top of (lue points) re the sme s those used in Figure 3f nd re replotted here for omprison purposes. Dt were evluted using Friedmn s test ompring SH nd GH flies followed y Fisher s ext test with Bonferroni orretion ompring SH nd GH t eh light intensity (top) nd using Kruskl-Wllis one-wy ANOVA followed y Mnn-Whitney U tests with Bonferroni orretion (middle nd ottom). All sttistil tests yielded P >.5 (n.s., not signifint). Properties of ox plots re s in Figure 1f. Numer of wing extension outs 2 All pirs n.s ADVANCE ONLINE PUBLICATION nture methods

7 213 Nture Ameri, In. All rights reserved. Figure 6 Funtionl lium imging of P1 neurons. () Experimentl setup for lium imging (Online Methods). () Responses of P1 neurons ( F/F, normlized fluoresene hnge) to tivtion were monitored using two-photon lser-snning mirosopy. Flies expressing oth nd GCMP3 in P1 neurons (P1-GAL/UAS-(ttP); UAS-GCMP3(VK5)) were singly housed (SH; n = 11) or group-housed (GH; n = 16) nd their rins were imged. Amer light (59 nm, 1.7 mw/mm 2 ) with 5-ms pulse width ws delivered t 1 Hz for 3 s (ornge line ove tres). GCMP3. emissions were monitored in the roriztions of P1 neurons. Flies expressing GCMP3. ut not in P1 neurons (P1-GAL; UAS-GCMP3(VK5)) were used s negtive ontrols (n = 3). Solid red nd lue lines represent verge tres, nd envelopes indite s.e.m. () Quntifition of fluoresene hnges. ( F/F)dt, integrted F/F during 3 s of light tivtion. Dt were nlyzed from. n.s., not signifint. (d) Expression level of t the roriztions nd somt of P1 neurons were quntified using Citrine tg fused to the C terminus of. P vlues were otined from Mnn-Whitney U tests with Bonferroni orretion. Box plots properties re s in Figure 1f. the tion spetrum. Exittion snning used n initil inrese in seline GCMP3. fluoresene in fly rins oexpressing in P1 neurons, even in the sene of mer light exittion of (Fig. 6). These inreses were not oserved in fly rins lking UAS-, result implying tht they reflet rosstivtion of y the GCMP3. exittion em (925 nm). Nevertheless, mer light still evoked ler inrese in the strength of GCMP3. emissions over this kground (Fig. 6). Using these onditions, we ompred the GCMP3. response of P1 neurons to tivtion of these sme neurons in rins from singly housed nd group-housed flies. P1 neurons in SH fly rins showed lrger -evoked lium influxes thn did GH fly rins (Fig. 6,). Quntittive nlysis of - Citrine expression in these ells indited tht this differene ws not due to higher levels of P1-GAL expression in SH flies (Fig. 6d). Together these ehviorl nd imging experiments suggest tht the exitility of P1 neurons n e modulted y prior soil experiene. Attempts to monitor lium trnsients in pip1 neurons were preluded y the omplex expression pttern nd low level of GCMP3 expression driven y this GAL line. DISCUSSION Here we desrie system for optogeneti tivtion of ehvior in freely moving dult flies using, newly desried redshifted opsin 17 (see the Supplementry Note for disussion why is more effetive thn other hnnelrhodopsins tested). The strength of tivtion otined using, nd the rod dynmi rnge of intensities nd frequenies over whih stimultion n e delivered, trnsltes to more quntittive nd temporlly ontrolled pproh to investigting the neuronl ontrol of ehvior thn tht provided y ville thermogeneti tools (ut see ref. 23). The use of with red light lso redues the onfounding influene of strong visul stimultion tht ours when using lue light tivted opsins or with the temperture inreses required y thermogeneti effetors. Finlly, the ility to ontrol tivtion using LEDs, rther thn lsers 1,23, permits reltively inexpensive pproh for lrge-sle, high-throughput sreening of ehviors. ( F/F)dt Glvo Dihroi em splitter Ojetive Two-photon lser (925 nm) Brin Opti fier Detetor Bnd-pss filter (589/1 nm) Bnd-pss filter (5/2 nm) Mirror High-power LED (59 nm) n.s. P =.53 n.s. GH SH GH SH GH SH Before light 1 Hz After light F/F d Normlized intensity Hz Aroriztions n.s. SH flies GH flies No.6 GH SH GH SH Using to monitor oth ehviorl sensitivity nd neuronl tivtion, we disovered tht (i) P1 nd pip1 neurons ontrol mle ourtship song in stte-like (proilisti nd persistent) nd ommnd-like (deterministi nd time-loked) mnner, respetively; nd (ii) the effet of soil isoltion to inrese mle ourtship ehvior is medited, t lest in prt, through n inrese in the exitility of P1 neurons (Supplementry Tle 3). It hs een proposed, on the sis of ntomil dt, tht P1 neurons re prt of iruit integrting multimodl sensory ues tht ontrol ourtship ehvior 38. Our oservtions suggest tht P1 neurons lso integrte this informtion with the flies history of soil experiene, in mnner tht influenes the proility tht the flies will exhiit ourtship ehvior. To our knowledge, this represents the first oservtion of neurl orrelte of soil experiene in Drosophil. Interestingly, we did not oserve ny evidene of persistent lium trnsients in P1 neurons fter phototivtion, whih implies tht the persistent wing extension triggered y P1 tivtion is medited y other neurons. The mehnisms underlying the influene of soil stte on P1 exitility, nd persistent tivity, re interesting topis for future investigtion. Although -sed tivtion of ehvior ws effetive in ll the GAL lines tested, the optogeneti toolkit in Drosophil ould enefit from further engineering of red-shifted opsins with nrrower tion spetrum nd fster kinetis, nd lso y development of red-shifted vrints of inhiitory opsins. Together suh tools would further enhne the ppliility of optogenetis to neurl iruit dissetion in Drosophil. Methods Methods nd ny ssoited referenes re ville in the online version of the pper. Note: Any Supplementry Informtion nd Soure Dt files re ville in the online version of the pper. Aknowledgments We thnk K. Deisseroth (Stnford University) nd B. Pfeiffer (Jneli Frm Reserh Cmpus) for plsmids. Fly stoks were generously provided y the Bloomington Stok Center, A. Fil (Georg-August-Universität Göttingen), Normlized intensity Somt n.s. nture methods ADVANCE ONLINE PUBLICATION

8 213 Nture Ameri, In. All rights reserved. G.M. Ruin, L.L. Looger, B.J. Dikson (Jneli Frm Reserh Cmpus) nd P.A. Grrity (Brndeis University). We lso thnk memers of the Anderson l for helpful disussion nd shring of flies. H.K.I. ws supported y the Nkjim Foundtion. J.Y.L. ws funded y Foundtion of Reserh, Siene nd Tehnology New Zelnd. The projet ws supported y grnts from the US Ntionl Institutes of Helth to R.Y.T. (NS27177) nd to D.J.A. (R1DA ). D.J.A. nd R.Y.T. re supported y the Howrd Hughes Medil Institute. AUTHOR CONTRIBUTIONS H.K.I. nd D.J.A. designed the experiments. H.K.I., Y.J. nd N.M. performed ehviorl experiments. H.K.I. nd A.M.W. reted the trnsgeni flies. H.K.I. performed physiologil experiments. E.D.H. provided P1-GAL. J.Y.L. nd R.Y.T. provided the regent nd dvie on its iophysil properties. H.K.I. nd Y.J. performed the dt nlysis. H.K.I. nd D.J.A. prepred the figures nd wrote the pper. COMPETING FINANCIAL INTERESTS The uthors delre no ompeting finnil interests. Reprints nd permissions informtion is ville online t reprints/index.html. 1. Venken, K.J., Simpson, J.H. & Bellen, H.J. Geneti mnipultion of genes nd ells in the nervous system of the fruit fly. Neuron 72, (211). 2. Luo, L., Cllwy, E.M. & Svood, K. Geneti dissetion of neurl iruits. Neuron 57, (28). 3. Fenno, L., Yizhr, O. & Deisseroth, K. The development nd pplition of optogenetis. Annu. Rev. Neurosi. 3, (211).. Yizhr, O., Fenno, L.E., Dvidson, T.J., Mogri, M. & Deisseroth, K. Optogenetis in neurl systems. Neuron 71, 9 3 (211). 5. Shroll, C. et l. -indued tivtion of distint modultory neurons triggers ppetitive or versive lerning in Drosophil lrve. Curr. Biol. 16, (26). 6. Zhng, W., Ge, W. & Wng, Z. A toolox for light ontrol of Drosophil ehviors through Chnnelrhodopsin 2-medited phototivtion of trgeted neurons. Eur. J. Neurosi. 26, (27). 7. Suh, G.S. et l. tivtion of n innte olftory voidne response in Drosophil. Curr. Biol. 17, (27). 8. Pulver, S.R., Pshkovski, S.L., Hornstein, N.J., Grrity, P.A. & Griffith, L.C. Temporl dynmis of neuronl tivtion y Chnnelrhodopsin-2 nd TRPA1 determine ehviorl output in Drosophil lrve. J. Neurophysiol. 11, (29). 9. Gordon, M.D. & Sott, K. Motor ontrol in Drosophil tste iruit. Neuron 61, (29). 1. Zimmermnn, G. et l. Mnipultion of n innte espe response in Drosophil: photoexittion of j6 neurons indues the espe response. PLoS ONE, e51 (29). 11. Bellmnn, D. et l. Optogenetilly indued olftory stimultion in Drosophil lrve revels the neuronl sis of odor-version ehvior. Front. Behv. Neurosi., 27 (21). 12. Ingki, H.K. et l. Visulizing neuromodultion in vivo: TANGO-mpping of dopmine signling revels ppetite ontrol of sugr sensing. Cell 18, (212). 13. de Vries, S.E. & Clndinin, T. Optogeneti stimultion of espe ehvior in Drosophil melnogster. J. Vis. Exp. 71, e5192 (213). 1. Lim, S.Q. & Miesenok, G. Remote ontrol of ehvior through genetilly trgeted photostimultion of neurons. Cell 121, (25). 15. Hmd, F.N. et l. An internl therml sensor ontrolling temperture preferene in Drosophil. Nture 5, (28). 16. Yizhr, O. et l. Neoortil exittion/inhiition lne in informtion proessing nd soil dysfuntion. Nture 77, (211). 17. Lin, J.Y., Knutsen, P.M., Muller, A., Kleinfeld, D. & Tsien, R.Y. : red-shifted vrint of hnnelrhodopsin enles deep trnsrnil optogeneti exittion. Nt. Neurosi. 16, (213). 18. Sott, K. et l. A hemosensory gene fmily enoding ndidte gusttory nd olftory reeptors in Drosophil. Cell 1, (21). 19. Boyden, E.S., Zhng, F., Bmerg, E., Ngel, G. & Deisseroth, K. Milliseond-timesle, genetilly trgeted optil ontrol of neurl tivity. Nt. Neurosi. 8, (25). 2. Ngel, G. et l. Chnnelrhodopsin-2, diretly light-gted tion-seletive memrne hnnel. Pro. Ntl. Ad. Si. USA 1, (23). 21. Ngel, G. et l. tivtion of hnnelrhodopsin-2 in exitle ells of Cenorhditis elegns triggers rpid ehviorl responses. Curr. Biol. 15, (25). 22. Berndt, A., Yizhr, O., Gunydin, L.A., Hegemnn, P. & Deisseroth, K. Bi-stle neurl stte swithes. Nt. Neurosi. 12, (29). 23. Keene, A.C. & Msek, P. Optogeneti indution of versive tste memory. Neurosiene 222, (212). 2. Binhi, D. et l. On the mehnisms underlying the depolriztion lok in the spiking dynmis of CA1 pyrmidl neurons. J. Comput. Neurosi. 33, (212). 25. Odden, J.P., Holrook, S. & Doe, C.Q. Drosophil HB9 is expressed in suset of motoneurons nd interneurons, where it regultes gene expression nd xon pthfinding. J. Neurosi. 22, (22). 26. Tyler, T.D., Pheo, D.A., Hergrden, A.C., Murthy, M. & Anderson, D.J. A neuropeptide iruit tht oordintes sperm trnsfer nd opultion durtion in Drosophil. Pro. Ntl. Ad. Si. USA 19, (212). 27. Stokinger, P., Kvitsini, D., Rotkopf, S., Tirián, L. & Dikson, B.J. Neurl iruitry tht governs Drosophil mle ourtship ehvior. Cell 121, (25). 28. von Philipsorn, A.C. et l. Neuronl ontrol of Drosophil ourtship song. Neuron 69, (211). 29. Lun, H., Peody, N.C., Vinson, C.R. & White, B.H. Refined sptil mnipultion of neuronl funtion y omintoril restrition of trnsgene expression. Neuron 52, (26). 3. Pfeiffer, B.D. et l. Refinement of tools for trgeted gene expression in Drosophil. Genetis 186, (21). 31. Jenett, A. et l. A GAL-driver line resoure for Drosophil neuroiology. Cell Rep. 2, (212). 32. Pn, Y., Meissner, G.W. & Bker, B.S. Joint ontrol of Drosophil mle ourtship ehvior y motion ues nd tivtion of mle-speifi P1 neurons. Pro. Ntl. Ad. Si. USA 19, (212). 33. Ymguhi, S., Despln, C. & Heisenerg, M. Contriution of photoreeptor sutypes to spetrl wvelength preferene in Drosophil. Pro. Ntl. Ad. Si. USA 17, (21). 3. Stveng, D.G. Colour in the eyes of insets. J. Comp. Physiol. A Neuroethol. Sens. Neurl Behv. Physiol. 188, (22). 35. Hni, S., Hmsk, Y. & Ishid, N. Cirdin entrinment to red light in Drosophil: requirement of Rhodopsin 1 nd Rhodopsin 6. Neuroreport 19, 11 1 (28). 36. Clyne, J.D. & Miesenok, G. Sex-speifi ontrol nd tuning of the pttern genertor for ourtship song in Drosophil. Cell 133, (28). 37. Kohtsu, S., Kognezw, M. & Ymmoto, D. Femle ontt tivtes mle-speifi interneurons tht trigger stereotypi ourtship ehvior in Drosophil. Neuron 69, (211). 38. Yu, J.Y., Kni, M.I., Demir, E., Jefferis, G.S. & Dikson, B.J. Cellulr orgniztion of the neurl iruit tht drives Drosophil ourtship ehvior. Curr. Biol. 2, (21). 39. Dnkert, H., Wng, L., Hoopfer, E.D., Anderson, D.J. & Peron, P. Automted monitoring nd nlysis of soil ehvior in Drosophil. Nt. Methods 6, (29).. Tin, L. et l. Imging neurl tivity in worms, flies nd mie with improved GCMP lium inditors. Nt. Methods 6, (29). ADVANCE ONLINE PUBLICATION nture methods

9 213 Nture Ameri, In. All rights reserved. ONLINE METHODS Constrution of trnsgeni nimls. Plsmids were onstruted y stndrd DNA loning nd PCR methods. All PCR retions were performed using PrimeStr HS DNA polymerse (Tkr). Following mplifition, ll sequenes were verified y DNA sequening. UAS-ChR2(H13R)øEYFP-2A-ChR2(H13R)øEYFP. A DNA frgment ontining the ChR2(H13R) oding sequene, kindly provided y K. Deisseroth, nd n intervening F2A sequene 12,1 were mplified y PCR using primers (5F-EoRI-hr2, 3R-2-YFP, 5F-2-Chr2, 3R-X-YFP, 5F-2 nd 3R-2) nd suloned into puast vetor in tndem mnner using restrition enzymes (see Supplementry Tle for primer sequenes). Severl trnsgeni flies were reted with different insertion sites. We piked the line tht exhiited the strongest indution of PER when rossed to Gr5-GAL. UAS-(T/T). A DNA frgment ontining the oding sequene of (E122T/E162T)-TS-EYFP kindly provided y K. Deisseroth ws mplified y PCR using primers (-f nd -EGFP-r; see Supplementry Tle ). This PCR produt ws suloned into the vetor pjfrc2 (ref. 3) using SLIC loning 2. This vetor ws injeted nd integrted into ttp nd VK5 sites 3. UAS-, LexAop-, UAS-FRT-mCherry-FRT- nd LexAop-FRT-mCherry-FRT-. A DNA frgment ontining the øcitrine oding sequene ws mplified y PCR using primers (-f nd -itrine-r; see Supplementry Tle ). This PCR produt ws suloned into pjfrc2 nd pjfrc19 (ref. 3) using SLIC loning 2 for UASnd LexAop-driven versions, respetively. For the version ontining n FRT mcherry Stop-FRT ssette, the FRT sequenes (GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC) nd DNA frgments were suloned together into pjfrc2 nd pjfrc19 using SLIC loning 2. These vetors were injeted nd integrted into ttp, ttp5 nd VK5 sites 3. Fly strins. UAS-ChR2 (ref. 5), UAS-dTrpA1 (ref. 15), UAS- GCMP3. (ref. ), Gr5-GAL (ref. 18) nd BDP-GAL (ref. 3) (empty promoter GAL: n enhnerless GAL ontining Drosophil sl promoter) were generously provided y A. Fil, P.A. Grrity, L.L. Looger, K. Sott nd G.M. Ruin, respetively. fru-gal (ref. 27), fru-flp 38 nd VT556 GAL (ref. 28) were kindly provided y B.J. Dikson. h9-gal ws otined from Bloomington Stok Center (BL #32555). Crz-GAL (ref. 26) nd UAS-C128T 12 were previously reted in the l. All the trnsgeni flies reted for this pper re summrized in Supplementry Tle 1. These flies re ville on request. All experimentl flies were mintined on 12/12 h dy-night yle. Newly elosed mle flies were CO 2 nesthetized nd llowed to reover for more thn 3 7 d efore ehviorl tests t 25 C. For dtrpa1 experiments, flies were rised t 18 C. For experiments with Gr5-GAL, femle flies were used; for ll the other experiments, mle flies were used. Feeding of retinl. All-trns-retinl powder (Sigm) ws stored in 2 C s mm stok solution dissolved in DMSO ( 1). µl of sugr-retinl solution ( µm ll-trns-retinl diluted in 89 mm surose) ws diretly dded to surfe of solid food in food vils when lrve were t the first or seond instr stge. After olletion of newly elosed flies, they were trnsferred into vil ontining food with µm ll-trns-retinl (food ws heted nd liquefied to mix the retinl evenly in the food). We found tht lrvl feeding is not neessry, ut it ws performed for ll the experiments in this pper to e onsistent. Behviorl setup. See Supplementry Tle 2 for list of omponents used to ssemle the ehviorl setup. See Supplementry Figure 1 for detils of the setup nd the ehviorl hmer. In rief, high-power LEDs mounted on het sinks were pled ove the ehviorl hmer to provide n illumintion soure (Fig. 2 nd Supplementry Fig. 1,). The rnge of ville light intensities in our setup is pproximtely.1 1 mw/mm 2 (note tht intensity rnges re different for different LEDs; see Supplementry Fig. 1d). LED units were designed to e swithle to filitte testing of different photostimultion wvelengths. The LEDs were ontrolled y n externlly dimmle LED driver (7 ma, externlly dimmle, Bukpuk DC driver with leds), nd its output ws djusted using ustom softwre ontrolling n Arduino Uno ord (Smrt Projets). The Arduino digitl PWM output ws onverted into nlog voltge using n RC filter (eletroni low-pss filter omposed of resistor nd pitor; RC LPF in Fig. 2) ontining 2-Ω resistor nd 1-µF pitor to ontrol the output urrent of the LED driver. Fly ehvior ws monitored using CMOS mer equipped with n IR long-pss filter to void detetion of light from the high-power LEDs. IR k light ws used to visulize the ehving flies. Video pture nd LED ontrol were time loked using the Arduino Uno ord. To time-stmp photostimultion trils in the videos, we pled n IR inditor LED, whose illumintion ws synhronized to tht of the photostimultion LEDs, in the field of view of the mer. The temperture inside the ehviorl hmer ws minimlly ffeted y the high-intensity photostimultion: fter illumintion using the highest ville intensities of lue, green or red LEDs (1.1,.67 nd 1.27 mw/mm 2, respetively) for 1 min, the iggest hnge in mient temperture, deteted using thermoouple inserted into the hmer, ws.7 C. Behviorl experiments nd quntifition of ehviors. For experiments to tivte Gr5-GRNs, nonstrved flies were mounted into 2-µl Pipetmn tips s desried previously 12. Mounted flies were pled eneth high-power LEDs, nd PERs were monitored using video mer. Mounted flies were not pled in the ehviorl hmer ut pled t the sme lotion s the wells of ehviorl hmer in Supplementry Figure 1. Bouts of PER were ounted mnully. A out ws defined s eginning when flies strt extending their proosis nd ending when they retrt the proosis. Inomplete proosis extensions were not ounted. LEDs were used t mximum intensities in Figures 1, nd 2d,e (red, 1.1 mw/mm 2 ; mer,.22 mw/mm 2 ; green,.67 mw/mm 2 ; lue, 1.27 mw/mm 2 ). For Figure 1, 1-ms photostimultion trils (1 Hz) were delivered (three trils), nd flies showing more thn one PER during this tivtion period were ounted s responders. Fly genotype: w ; Gr5-GAL(II); GR5-GAL(III)/UAS-(VK5) (Fig. 1 g); w ; Gr5- GAL(II)/UAS-dTrpA1(II); GR5(III)-GAL/UAS-dTrpA1(III) (Fig. 1h). To tivte Crz neurons (Fig. 2d), mles expressing eh opsin in Crz-GAL neurons were mounted dorsl side down on glss doi:1.138/nmeth.2765 nture methods

10 213 Nture Ameri, In. All rights reserved. slide s previously desried 26. Flies were illuminted using the mximum ville intensity of light for eh type of LED, ontinuously for 1 min, while we monitored them from the ventrl side using video mer. The numer of flies exhiiting ejultion during light stimultion ws mnully ounted. For ll other ehviorl experiments, we used ryli ehviorl hmers (16-mm dimeter) in 2 rry (Fig. 2 nd Supplementry Fig. 1) to monitor fly ehvior. Unless otherwise indited, hmers were photostimulted using the mximum intensity ville for eh LED, for 1 min using ontinuous illumintion, while we monitored them with the mer from ove. The numer of flies showing ontinuous side wlking during stimultion using the h9-gal driver ws mnully ounted (Fig. 2d,f). fru-gal neurons were tivted in the sme mnner, nd flies showing wing extension or prlysis phenotypes were ounted mnully (Fig. 2d,g). Prlysis ws defined s the esstion of loomotion nd loss of posturl ontrol. Flies tht showed weker ehviorl phenotypes (HB9, side wlk; Fru, wing extension) t the onset of photostimultion, ut tht were prlyzed efore the 1-min stimultion ws terminted, were ounted s prlysis (Fig. 2f,g). Wing extension evoked y tivtion of P1 or pip1 neurons were tested in solitry mles in the sene of femle flies. The wing extension ws mnully sored (Figs. 2 5). Grooming (rpid wing movements while touhing with hind leg) ws exluded. A out ws defined s strting when flies egin to inrese the wing ngle nd ending when they stop deresing it. In order to fit the dt into sigmoidl urve, sigmoid interpoltion ws performed. The sigmoid urves were defined s follows Fehv = 1 X log 2 X 1 + e 5 where F ehv is the frtion of flies showing the ehvior, X is the light intensity (Figs. 3f, nd 5) or frequeny (Fig. 2e), X 5 is the light intensity (Figs. 3f, nd 5) or frequeny (Fig. 2e) where 5% of flies show the ehvior, nd α is the slope of the sigmoid urve. On the sis of the experimentlly mesured quntities (X nd F ehv ), X 5 nd α were hosen to est fit the dt. For ll experimentl dt, polynomil urve fitting whih finds the oeffiients tht fit the dt y the lest-squres method ws lulted with Mtl (MthWorks). Goodness of fit ws tested y two-wy ANOVA etween the sigmoidl urve nd the tul PER response urve, whih indited good fit for ll ses (P <.5, two-wy ANOVA). The X 5 is shown s 5% point in the figures (Figs. 2e, 3f, nd 5). Mesurement of light intensity. A photodiode power sensor (S13VC, Thorls) ws pled t the lotion of the ehviorl hmer ut in the sene of the hmer. The pek wvelength of eh LED (red, 627 nm; mer, 59 nm; green, 53 nm; lue, 7 nm) ws mesured t different voltge inputs. Mesurements were repeted four times nd verged. The seline intensity of eh wvelength efore LED illumintion ws sutrted. Note tht light intensity n drop during stimultion t high input voltges. In this study, intensity fter 1 s of stimultion ws mesured. Mesurement of penetrne of different wvelengths of light through the fly utile. The proosis of femle dult fly ws removed, nd 1-µm multimode opti fier (NA,.1; Thorls) ws inserted into the rin through the window. The mount of light entering the opti fier inside or outside the fly ws mesured using power meter (Model 1931, Newport). Penetrne ws lulted s the mount of light tht entered the opti fier inside the fly divided y the mount of light mesured outside the fly. The long xis of the opti fier ws lwys ligned with the light soure. Different wvelengths of high power LEDs (7 nm, 53 nm, 59 m, 627 nm) were used s light soures. Fly histology. All fixtion nd stining proedures were performed t C in PBS unless otherwise speified. Disseted rins were fixed in % formldehyde in PEM (.1 M PIPES, ph 6.95, 2 mm EGTA, 1 mm MgSO ) for 2 h. After three 15-min rinses with PBS, rins were inuted with primry ntiodies overnight. Following three 15 min rinses with PBS, rins were inuted with seondry ntiody overnight. Following three 15-min rinses, rins were inuted in 5% glyerol in PBS for 2 h nd lered with Vetshield (Vetor Ls). All proedures were performed t C. A FluoView FV1 Confol lser snning iologil mirosope (Olympus) with 3 /1.5-NA silione oil ojetive (Olympus) ws used to otin onfol seril optil setions. The ntiodies used for Supplementry Figure 2,d were nti-gfp, rit polylonl ntiody unonjugted (A11122, Invitrogen) nd Alex Fluor 88 donkey nti-rit IgG(H+L) (A118, Invitrogen). Both of the ntiodies were diluted to 1/3. Expression of mcherry in Supplementry Figure 2d ws monitored using ntive fluoresene without ntiody stining. FluoRender softwre ( softwre/127-fluorender.html) ws used to mke 3D imge reonstrutions. To mesure the expression levels of øcitrine in P1 neurons in Figure 6d, the ntive fluoresene of Citrine in different speimens ws monitored using the sme intensity of lser power (7 nm) nd PMT voltge. Signl intensity ws quntified in ImgeJ ( Clium imging. Two-photon imging ws performed on n Ultim two-photon lser-snning mirosope (Pririe Tehnology) with n imging wvelength of 925 nm (Fig. 6). To filter out utofluoresene of the rin nd light from the mer stimultion LED (for tivtion), we used 5/2 nm (enter wvelength/ndwidth) nd-pss filter (Chrom) in the emission pthwy to detet the GCMP3 fluoresene. With this lser nd filter setting, fluoresene emissions from the Citrine tg (on ) were not detetle y our PMT. This ws onfirmed y exmintion of P1-GAL;UAS-øCitrine flies (the flies without GCMP3.), whih exhiited no fluoresene signl under our imging onditions. Therefore, the deteted fluoresene signls re purely from GCMP3.. The snning resolution ws pixels, dwell time per pixel ws 8 µse nd the optil zoom ws. The snning speed ws ~1 Hz. The exittion intensity of the two-photon lser ws vried mong smples depending on the level of GCMP3. nture methods doi:1.138/nmeth.2765