arxiv: v3 [cond-mat.soft] 12 Aug 2015

Transcription

1 Swimming in Crystl Aidn T. Brown, Ion D. Vldesu,, Angel Dwson, Teun Vissers, Jn Shwrz-Linek, Juho S. Lintuvuori,, nd Wilson C. K. Poon rxiv: v3 [ond-mt.soft] 12 Aug 2015 Reeived Xth XXXXXXXXXX 20XX, Aepted Xth XXXXXXXXX 20XX First pulished on the we Xth XXXXXXXXXX 200X DOI: /000000x We study tlyti Jnus swimmers nd Esherihi oli teri swimming in two-dimensionl olloidl rystl. The Jnus swimmers orit individul olloids nd hop etween olloids stohstilly, with hopping rte tht vries inversely with fuel hydrogen peroxide onentrtion. At high fuel onentrtion, these orits re stle for 100s of revolutions, nd the oritl speed osilltes periodilly s result of hydrodynmi, nd possily lso phoreti, intertions etween the swimmer nd the six neighouring olloids. Motile E. oli teri ehve very differently in the sme olloidl rystl: their irulr orits on plin glss re retified into long, stright runs, euse the teri re unle to turn orners inside the rystl. 1 Introdution Non-equilirium systems pose grnd hllenge utting ross mny res of physis. An exiting frontier onerns mirosopi swimmers, oth motile miro-orgnisms suh s teri nd lge, nd, inresingly, rnge of syntheti selfpropelled olloids 1,2. Suh swimmers ttrt interest in terms of their propulsive mehnisms 2 8 nd their olletive ehviour 9. These spets re oupled: the olletive ehviour depends on how swimmers intert, nd spets of these intertions re diretly relted to the propulsive mehnism. Miroswimmers intert with eh other nd with their surroundings vi two lsses of intertions. Vrious thermodynmi intertions vn der Wls, eletrostti,... re shred with pssive prtiles. Their effet, s lest on quiesent pssive prtiles, n e treted using equilirium sttistil mehnis. A seond lss of intertions rises diretly from self propulsion, nd is responsile for the ovementioned oupling etween propulsive mehnism nd olletive ehviour. There is s yet no generl theory to predit the effet of these detiled-lne-violting intertions. The most si type of tive intertion rises simply due to persistene, nd explins the uiquitous oservtion tht onfined miroswimmers umulte t onfining oundries. One swimmer rehes wll, it tkes finite time to reorient nd swim wy 10. When mny miroswimmers re present, this intertion n indue phse seprtion 11,12 nd olle- Eletroni Supplementry Informtion ESI ville online. See Appendix A for ptions to Supplementry Videos 1-4. See DOI: /000000x/. SUPA, Shool of Physis nd Astronomy, The University of Edinurgh, King s Buildings, Peter Guthrie Tit Rod, Edinurgh, EH9 3FD, United Kingdom, E-mil: rown20@stffmil.ed..uk Lortoire de Physique des Solides, Université Pris-Sud, UMR Orsy, Frne. tive motion 13. Another uiquitous tive intertion rises from the flow fields responsile for self propulsion round eh miroswimmer. Suh hydrodynmi intertions HI n produe qulittively different ehviour from pesisteneindued intertions 9,14. Indeed, phse seprtion driven y the ltter my e suppressed y HI 15. Considering persistene-indued intertion nd HI often suffies for understnding iologil miroswimmers, euse the ioenergetis powering self propulsion 16 re typilly internl. By ontrst, syntheti tive olloids often swim vi self-generted externl grdients, e.g. of eletrostti potentil, hemil onentrtion or temperture. Phoreti intertions PI rise from the oupling of these grdients to other surfes nd swimmers. These PI should in generl hve omprle mgnitude to the HI, euse the grdients re y definition strong enough to generte propulsion. Ative intertions n e essed experimentlly y diretly studying swimmer-swimmer intertions in dilute suspensions 22, ut lso y looking t the intertions etween swimmers nd pssive trer prtiles 23 25, surfes 18,26 30 or porous medi 10,31. In this rtile, we fous on the intertion etween swimmers nd model porous medium. We oserve two populr swimmers, motile Esherihi oli teri nd tlyti Pt-polystyrene Jnus prtiles fuelled y H 2 5, interting with lose-pked 2D rystl of pssive olloids. This environment hs opposite effets on these two swimmers: it destroys the usul oritl motion of E. oli on plne surfes 32 34, ut indues oritl motion of the Jnus swimmers round individul olloids in the rystl. We n explin the ehviour of E. oli ells simply, in terms of the steri hinderne etween their long flgell undles nd their rystlline surroundings. Oriting Jnus swimmers re hrder to understnd. They hop stohstilly etween orits round

2 Speed mms -1 1% 2 Mterils nd Methods 2.1 Jnus Swimmers Crystl Glss [H 2 ] % u u g d 10% 50 mm Fig. 1 Shemti of experimentl setup. Men llisti speed u inside u,, nd outside u g, rystl. Solid nd dshed lines re fits to Eq. 1. -d Trked video of Jnus swimmers inside olloidl rystl t 1% nd d 10% H 2, eh of 3 min durtion. neighouring olloids. The hopping rte sles inversely with the onentrtion of the fuel, H 2, ut is independent of the speed of the swimmers t prtiulr fuel onentrtion, suggesting tht oritl trpping is not just hydrodynmi effet, ut lso involves PI. While there is insuffiient informtion to pin down speifi trpping mehnism, we hve hrterised the trpping empirilly in terms of stiffness nd n effetive potentil, whih should help future theory onstrution in swimmer trpping t surfes. We oserved extremely long-lived orits t high H 2 onentrtions, lsting for 100s of rottions 10s of minutes. These ould form the sis for useful devies most oviously, mirofluidi stirrer 31, nd for studying the omplex intertions etween multiple oriting swimmers. Finlly, we find tht the oritl speed osilltes, resulting from intertions of n oriting swimmer with the six nerestneighour olloids. These osilltions ontin informtion on the propulsion mehnism, whih dittes the hrter of the tive intertions. However, urrent, inomplete understnding of the phoreti propulsion of Jnus swimmers 7,8 mens tht we nnot unmiguously disentngle the ontriutions of HI nd PI to the oserved speed osilltions. We therefore disuss our results in terms of simple model swimmer interting purely vi HI with its surroundings. With future dvnes in understnding of PI in tlyti swimmers, our results should help onstrin proposls for their propulsion mehnism. We prepred Jnus prtiles 5 nm Pt sputtered on 2 µm dimeter fluoresent polystyrene olloids from Invitrogen 7 nd suspended them t volume frtion 10 6 in queous H 2 Aros solutions in hmers formed etween glss slides Menzel nd mm 2 glss overslips Bettering with 300 µm thik prfilm spers. On the overslips, 2D olloidl rystls hd een formed eforehnd y depositing 10 µm dimeter polystyrene olloids Thermo- Fisher t 1% v/v in wter nd evporting t 70 C. The rdii of the stti olloids, R = 5.06 ± 0.02 µm, nd Jnus swimmers, = 0.96 ± 0.04 µm, were determined y repeted 25 mesurement of interprtile distnes in lose-pked 2D rystls. The eletrophoreti moilities of these olloids were otined in 100 µm NNO 3 Fluk using Mlvern Zetsizer. These were, for the 2 µm dimeter, unoted olloids, µ u = 5.3 ± m 2 V 1 s 1 ; for the 10 µm, stti olloids µ s = 4.4 ± m 2 V 1 s 1 ; nd for the Jnus prtiles, µ j = 5.3 ± m 2 V 1 s 1. Applying the Smoluhowski theory for the eletrophoreti moility, the surfe hrge density on these olloids is pproximtely q = µηκ, with κ 1 = 30 nm the Deye length, nd η = 10 3 P s the visosity of wter, whih gives q u = q j = Cm 2, nd q s = Cm 2. Our ottom-hevy Jnus swimmers swim upwrds 7,35. In ddition, they eome trpped nd swim stly t ny surfe irrespetive of its orienttion 7. Hene, to ollet the swimmers in the olloidl rystl, we initilly oriented the hmer with the oted overslip uppermost, llowing the swimmers to ollet there, efore inverting the hmer for oservtion with n inverted epifluoresene mirosope Ti Elipse, Nikon, 20 ojetive with CCD mer Eosens, Mikrotron. This inversion left swimmer ehviour unhnged. On olliding with olloid t the edge of the rystl, the swimmers orit tht olloid in the wedge-like spe etween olloid nd overslip, Fig. 1, efore hopping out of the rystl or into orit round nother olloid. We vried the onentrtion of H 2 etween 0.1 nd 10% v/v, nd trked the swimmers using MATLAB 7,36 to determine the men hopping rte nd the swimming speed inside nd outside the rystl t eh H 2 onentrtion 7. We lso mesured t high mgnifition using 100 ojetive the temporl vrition in speed of swimmers in 10% H 2, with nd without 100 µm NNO 3, in orit round olloids within nd t the edge of olloidl rystls. From these videos, we extrted dditionlly the instntneous oritl rdius ρ, nd the swimmer s orienttion with respet to the tngent to the orit in horizontl β nd vertil τ plnes defined in Fig. 2. Further mesurement detils n e found in Appendix C

3 r f + t 0 Coverslip - 90 d Puller Neutrl Pusher 0 Pusher Fig. 2 Pln nd side views of Jnus swimmer oriting olloid, showing the definition of the orienttion ngles φ, β nd τ, nd the oritl rdius ρ. Crtoon illustrting the reonstrution of the speed vrition on pssing ner single neighouring olloid. For lokwise orit, points in the red regions re ssigned φ > 0, nd the lue regions φ < 0, with φ = 0 t the ontt point etween the entrl olloid nd eh respetive neighour. The unoloured regions re not inluded, s they re within 90 of two neighouring olloids. Shemtis of the flow-fields round neutrl, pusher nd puller swimmers, in the l frme. Pln view of pusher oriting dshed line entrl olloid grey outline with one neighouring olloid solid green. 2.2 E. oli teri Motile, GFP-lelled smooth-swimming E. oli strin AB1157 hey, were ultured s previously desried 16,37 nd suspended in motility uffer see Appendix B for detils efore eing loded into hmers with or without olloidl rystls. Further geneti modifition permits tight inding of fluoresent dye Alex Fluor 633 to the flgell undle see Appendix B for detils. The flgell-lelled GFP-expressing E. oli were oserved in Zeiss onfol mirosope t 4 fps using lser exittion t 488 nm for GFP nd 633 nm for Alex Fluor 633. We dded 0.2 wt% TWEEN 20 to minimise dhesion of teri to the glss 16. Hopping Rte Hz [H 2 ] % Hopping Rte Hz 10 Speed µms - 1 [H 2 ] % Fig. 3 Hopping rte vs. H 2 onentrtion, [H 2 ]. Solid line: Γ [H 2 ] 1. Hopping rte inned y speed for eh [H 2 ] olour-oded. Solid lines: exponentil fits within eh [H 2 ]; dshed line: exponentil fit through the men of eh dt set. 3 Results 3.1 Oritl trpping of Jnus swimmers Figure 1-d shows typil trjetories of Jnus swimmers in olloidl rystls in 1% nd 10% H 2. In 1% H 2, swimmers hop rpidly through the rystl supplementry video SV1, wheres in 10% H 2, they remin in orit round olloids ner the edge of the rystl for mny minutes. Figure 3 shows Γ, the rte t whih swimmers hop etween orits, s funtion of H 2 onentrtion. The solid line is fit to Γ [H 2 ] 1 ; power lw fit returns Γ [H 2 ] 1.06±0.03. Figure 4 shows the men squred displement MSD of Jnus swimmers inside nd outside the rystl t 1% H 2. Outside, the Jnus swimmers move llistilly MSD t 2, with t = dely time t short times, eoming diffusive MSD t t long times due to rottionl diffusion 5. Inside the rystl, they re diffusive t ll times longer thn the oritl time euse oriting destroys orienttionl memory. This distintion exists t ll the H 2 onentrtions tested. Vrying H 2 onentrtion ffets the swimming speed, oth inside nd outside the rystl, s shown in Fig. 1. At ll H 2 onentrtions, the men speed u inside the rystl is lrger thn tht on plin glss, u g. The speed sturtes t high H 2 onentrtion, s previously oserved 5. This hs een ttriuted to the sturtion of Pt inding sites y H 2 moleules, whih gives predited speed of the form 5 u = u [H 2 ] [H 2 ] + [H 2 ], 1 where u is the sturtion speed, nd [H 2 ] is the H 2 onentrtion t hlf mximum. The solid nd dshed lines in Fig. 1 re est fits to Eq. 1 with u g = 6.6 ± 1 µms 1 nd u = 11.1 ± 2 µms 1, nd [H 2 ] = 0.22 ± 0.1% nd [H 2 ] g = 0.27 ± 0.1%. On plin glss surfes, the swimmers motion lso hs trnsltionl diffusive omponent, otinle y fitting the MSD t short dely times 5,7,8 the first five frmes, i.e s,

4 MSD mm 2 50 mm d g Dely Time s g 5 mm Fig. 4 Trked videos of smooth-swimming E. oli on plin glss, nd inside rystl. MSD on plin glss = Jnus; = E. oli nd inside the rystl = Jnus, + = E. oli. Solid lines: diffusive t nd llisti t 2 sling. Arrows highlight the effet of moving from glss into the rystl g. d Confol imge of flgell stined red terium inside olloidl rystl. Colloids green touh eh other, ut only smll, polr slie is visile. Blue: 6 s trjetory of terium with shorter flgell not shown. giving D g = 0.21 ± 0.01 µm 2 s 1 independent of H 2 onentrtion, in greement with previous mesurement 5,7,8. At eh H 2 onentrtion, we mesured wide rnge of swimming speeds u of individul Jnus prtiles, presumly due to vriility of the Pt oting. Figure 3 shows the hopping rte Γ s funtion of individul swimming speed u for eh H 2 onentrtion dt set. Eh oloured line is n exponentil fit to the dt t prtiulr H 2 onentrtion. The dshed lk line is n exponentil fit through the men speed u t eh H 2 onentrtion. The oloured lines re ll muh fltter thn the men fit, implying tht there is little dependene of the hopping rte on swimming speed eyond the dependene on H 2 onentrtion. 3.2 Speed osilltions in Jnus-swimmer orits In 10% H 2, the orits re extremely stle, nd we trked Jnus swimmers oriting single olloids within the rystl for 100s of revolutions see SV2. The speed uφ s funtion of the oritl ngle φ defined in Fig. 2 shows sinusoidl osilltions, Fig. 5. The solid urve is fit of the form uφ = u {1 + ũos [ 6φ δ ]}, 2 with δ 30,30 ]. The origin for φ is hosen so tht the neighouring olloids re t φ = 0,60, et. We mesure from 17 videos frtionl mplitude ũ = 7.7 ± 0.5% nd retrdtion δ = 13.5 ± 1.5. Identil osilltions re found in 10% H µm NNO 3 with ũ = 7.3 ± 0.6% nd δ = 14 ± 2. We lso mesured uφ for 35 swimmers oriting olloids t the edge of the rystl with fewer 2 to 4 neighours. For eh swimmer, we nlyse only those prts of its orit where the swimmer does not hve more thn one neighouring olloid within ±90 setor, Fig. 2. We then verge these prtil trjetories together to reonstrut the effet of single neighour. The uφ so onstruted is shown in Fig. 5. Next, we determine the verge position nd orienttion of the swimmer, with respet to the entrl olloid. To do so, we mesure the ngles β nd τ defining the orienttion of the Jnus prtile reltive to the oritl tngent, Fig. 2, nd the verge oritl rdius, ρ, Fig. 6. Following methods detiled in Appendix C, we find β = 7 ± 2, τ = 1 ± 2 nd ρ = 4.56 ± 0.02µm. These prmeters do not fully onstrin the 3D position of the Jnus swimmer, ut do ple n upper ound on the distne g js etween the swimmer nd the entrl olloid of g js 200 nm. If we ssume tht g js = g jg, the distne etween the swimmer nd the glss surfe, then g js = g jg = 70 ± 10 nm. The men temporl stndrd devition of β nd of ρ re σ β = 1.9 nd σ ρ = 12 nm respetively. Note tht these re verges of the stndrd devitions otined from single orits, rther thn orit-to-orit vritions. We found no osilltions in β nd ρ, so tht σ β nd σ ρ represent omintion of rel temporl vriilites in these prmeters nd experimentl unertinties in their mesurement. Finlly, we n determine trnsltionl diffusion oeffiient D for oriting swimmers. Integrting Eq. 2 nd ssuming diffusive term unorrelted with the speed, we find, in the limit of time t 0, nd ũ 0, φt 2 φ0 = 1 ũ2 2 u ρ 2 t 2 + 2D ρ 2 t. 3 Fitting Eq. 3 to dt from the first five frmes of 52 videos of swimmers oriting in 10% H 2 gives D = ± µm 2 s 1, independent of the swimming speed. To vlidte this proedure, we generted rtifiil dt y stepping through the relevnt Lngevin eqution φt + t = φt + u t ρ [ ] ξ t 1 + ũsin6φ + D t, ρ 4 for 10 5 steps of t = 0.01 s nd with ξ t = ±1 t eh step. Using experimentl vlues for the other prmeters, we reovered the input vlues for D nd u y fitting to Eq. 3 nd verging over 100 simulted swimmers. 3.3 Retifition of E. oli trjetories Fig. 4- shows trjetories of E. oli teri outside nd inside olloidl rystl. On plin glss, these teri irulte

5 lokwise viewed from the fluid side due to their rotting flgell The rystl retifies this irultion into stright trjetories. Figure 4 show the MSD of E. oli verged over 5 videos per urve. Outside the rystl, trjetories re initilly llisti, levelling off t long times due to the irulr motion. Inside the rystl, the llisti regime is extended, euse the teri nnot irulte. We lso oserved individul teri with stined flgell in more detil. As shown in Fig. 4d, nd SV3, few ells with shorter flgell 3 µm, ompred to 7 µm on verge do osionlly show irulr trjetories. These irulr trjetories hve rdii t the lower end of the rnge of oritl rdii oserved on plin glss, so tht the irultion is proly just tht produed y the teri themselves, nd is not indued y the olloids. 4 Disussion 4.1 Oritl trpping of Jnus swimmers We first disuss the oritl trpping of the Jnus swimmers in terms of its uiquity nd reltionship with trpping t surfes nd edges, its stility, nd potentil trpping mehnisms Uiquity As previously noted 7, miron-sized tlyti Jnus swimmers re stly trpped t glss surfes. Additionlly, we hve oserved their trpping on the surfes of 100 µm polystyrene eds Thermo Sientifi, nd of hexdene Sigm Aldrih droplets. If suh trpping is generl, then the oritl ehviour found in this work, Fig. 1,d, should lso e generi. Indeed, we hve lso oserved stle orits round sili eds Bngs Ls, hexdene droplets, nd oxygen ules from H 2 deomposition. These swimmers lso follow the internl edge of wter droplets on glss in ir or in oil, nd orit round the horizontl xis etween two olloids within the rystls studied here when defet in the struture leves suffiient spe to do this. Finlly, oriting ehviour ws previously reported for Pt-Au nnorods Effetive trpping potentil Our stle orit orresponds to fixed point in 4-dimensionl phse spe two orienttionl nd two trnsltionl degrees of freedom, ssuming tht the swimmer is xisymmetri nd tht we n ignore the intertions with neighouring olloids. Assuming tht there re no limit yles ner this fixed point, we n tret the swimmer s though it were trpped in potentil well in β, ρ spe nd use the equiprtition theorem to trnslte the mesured stndrd devitions, σ ρ nd σ β into the stiffness of the trpping potentil, k ρ = k B T /σ 2 ρ = Jm 2 nd In perfetly hexgonlly ordered lyer of 10 µm dimeter spheres, the interstie etween three neighouring spheres is too smll for the pssge of 2 µm dimeter sphere. k β = k B T /σβ 2 = J in these two diretions. Similrly, from the hopping rte, Γ, we n estimte the depth of the effetive trpping potentil U using the Krmers theory of rrier espe, whih gives n espe frequeny of 38 Γ Aexp U k B T. 5 The ttempt rte A depends on the form of the potentil, whih is unknown; ut A typilly hs the form 38 A = kd 2πk B T, 6 where k hs the dimensions of stiffness nd D is relevnt diffusivity. In our se, the simplest espe routes ome from lrge flututions in β or ρ. For flututions in ρ, we estimte k = k ρ. To estimte the relevnt D, we hve to know the effet of nery surfes on diffusion norml to these surfes. It is known tht for surfe-to-surfe gp of g = 0.1, the diffusivity D ρ is 10% of the free-prtile diffusivity for swimmer lose to single plne wll 39. Using these vlues, we find A ρ 30 s 1, whih, together with Γ = 10 3 s 1 t 10% H 2, gives U 12k B T from Eq. 5. Considering flututions in β gives similr result. Beuse the mesured σ ρ nd σ β re upper ounds on the true stndrd devitions, our estimte for U is n pproximte lower ound Phse stility The low mesured diffusivity in the ngle φ, Eq. 3, mens tht these oriters show long-term phse stility. The numer of revolutions over whih phse is retined, or the qulity ftor, Q, is relted to the time tken to diffuse π/2 wy from the llisti predition φ = u t/ρ: Q = πu ρ 16D. 7 Our dt give Q = 107 ± 5. Suh phse stility mens tht it would e interesting to study the oupling etween two neighouring oriters, prtiulrly to ompre with previous work on eds drgged in irulr orits y optil trps Pssive intertions nd persistene The distnes etween the swimmer nd the olloid nd glss surfes re of order 100 nm. This llows us to exlude lmost ll pssive intertions from eing signifint for oritl trpping. Dispersion fores simply re too short in rnge order nm. While eletrostti intertions hve suffiient rnge, ll the pssive, eletrostti intertions should e repulsive, sine ll relevnt surfes re negtively hrged under our onditions 41,42. The effet of grvity n lso e ruled out, sine these swimmers eome trpped on oth the upper nd lower surfes of glss slides 7, nd on vertil, glss surfes 35, nd orit within olloidl rystls on ll of these surfes. We n lso rule out the possiility tht the swimmers re trpped in stle orits simply euse they do not rotte wy

6 Speed Vrition Speed Vrition Speed mms -1 Speed Vrition quikly enough, s hs een oserved for other tlyti swimmers trpped t plne surfes 10. The trpping timesles t surfes 7 nd within the rystl re muh longer thn the rottionl diffusion time, whih is 5 s for these swimmers 7. In ddition, unlike t plne surfe, suh mehnism ould not trp swimmer in orit without some dditionl orienttionl onstrint. Another possiility is tht the swimmers re trpped just y n orienttionl onstrint, i.e. tht they orient towrds the surfe, nd their propulsion mintins them there. However, our swimmers re oriented wy from the olloid surfe, so this mehnism nnot pply here. f degrees d f degrees HI nd PI It hs een suggested 31 tht the oritl trpping of Pt-Au nnorods is purely hydrodynmi. In trpping y pure HI, the hopping rte Γ would e determined y lne etween HI, whih mintin stle swimmer orienttion nd position, nd therml flututions, whih disrupt this stility 31. HI inrese with swimming speed, whih would give strong negtive orreltion etween swimming speed nd Γ. Our mesured Γ shows no suh diret speed dependene. At eh H 2 onentrtion, there is wide vrition in u, ut there is no systemti vrition of Γ with u Fig. 3. Hene, the trpping is strongly dependent on H 2 onentrtion Fig. 3, ut vi some speed-independent mehnism. This indites signifint ontriution from PI, s previously disussed theoretilly for self-diffusiophoresis on plne surfes 18. While dt do not unmiguously pin down speifi mehnism, the oserved Γ [H 2 ] 1 dependene provides strong onstrint for future theories on the propulsion nd intertion of these swimmers. 4.2 Speed osilltions in Jnus swimmer orits We next onsider the possile origins of the osilltions in oritl speed of Jnus swimmers, whih lerly rise from intertions etween the swimmer nd the neighours to the olloid eing orited Pssive intertions The surfe to surfe distne etween the Jnus swimmer nd these neighouring olloids is t lest 800 nm, so, gin, the only plusile pssive intertion mehnism is eletrostti. Adding 100 µm NNO 3 with Deye length, κ 1 30 nm left the osilltions unhnged, nd in this se we n estimte the minimum hrge density q needed to give the oserved osilltion mplitude. The sreened potentil etween two hrged spheres is 43 U = 4πq 2 R εκ 2 exp κd, 8 g + + R e f degrees f degrees f f degrees f degrees Fig. 5 Typil osilltions in oritl speed, from 200 revolutions of Jnus swimmer inside rystl, in 10% H 2. Solid urve: 60 Fourier omponent. Reonstruted, frtionl speed vrition used y oriting pst single neighouring olloid t φ = 0, verged over 35 swimmers. Symmetri, nd d ntisymmetri prts of the speed vrition in. Dshed, horizontl lines indite the verge speed outside the pertured region, 90 < φ < 90. e Periodi osilltion generted y repetedly shifting the rw dt in y 60 nd dding the resulting speed vritions together. The solid line is the 60 sinusoidl omponents. f Theoretil frtionl speed vrition lk, solid of pusher with stresslet mplitude α = 1 swimming pst neighouring olloid, s desried in the text. The ntisymmetri red, dshed nd symmetri lue, dot-dshed omponents re lso shown. where g is the surfe-surfe seprtion nd ε is the dieletri permittivity of wter. The mximum mplitude is therefore δu mx 1 U 6πη g. 9 The oserved mplitude of δu 1 µms 1 requires n unrelistilly high hrge density of q 1 Cm 2, pproximtely 1000 times our mesured vlues of 10 3 Cm 2. Hene, pssive eletrostti intertions nnot generte the oserved speed osilltions

7 4.2.2 Fuel Conentrtion Vrition In priniple, the osilltions ould e due to sptil vritions in solute H 2 onentrtion diretly ffeting the swimming speed. However, the propulsion speed is insensitive to the onentrtion t 10% H 2 Fig. 1, nd the mesured H 2 onsumption rte 7 implies tht these swimmers will deplete the H 2 onentrtion t their surfe y only round 1% of the ulk onentrtion. Therefore, these lol vritions in fuel onentrtion nnot ount for the oserved speed osilltions HI nd PI To exmine the potentil roles of HI nd PI in generting the oserved speed osilltions, we exmined the orits of swimmers oriting olloids t the edge of our rystls with fewer 2-4 neighours, nd reonstruted the effet of single neighour on the oriting speed Fig. 5. A single pek is seen just fter the swimmer psses neighour Fig. 5, onsistent with the positive retrdtion seen inside the rystl. The speed vrition is prtilly nil y φ = 60, i.e., swimmer is little ffeted y olloids eyond the one or two neighouring olloids whih it is losest to t ny point. We now sum six suitly shifted opies of the dt in Fig. 5 to predit the speed osilltions expeted for swimmer oriting olloid in the ulk of our olloidl rystl Fig. 5e, points. The 60 -period sinusoidl omponent Fig. 5e, line hs mplitude 7% nd retrdtion 13, onsistent with experiments performed inside the rystl. Interpreting these osilltions is diffiult due to unertinties in the swimmers propulsion mehnism. While there is strong evidene ginst the originlly-proposed self-diffusiophoreti mehnism 7, the detils of the true mehnism, whih ppers to e some version of selfeletrophoresis, remin osure 7,8. Moreover, the eletri field produed y self-eletrophoreti swimmer ould produe PI in two wys: y eing refleted from dieletri disontinuities, here liquid stti-olloid interfes; nd y dvetion in the eletroosmoti flow indued y the intertion of the field with the fixed hrge on those interfes. Unlike pssive eletrostti intertions, these tive eletrostti intertions re long rnged: they involve ioni urrents, so re not sujet to the equilirium ioni sreening. Due to these omplitions, we neglet PI here nd disuss speed vritions expeted for model swimmer in our geometry sujet only to HI, nd ompre these to experiments. Understnding the role of hydrodynmis should, of ourse, ontriute to future full theory tht lso involves PI. We use the lowest-order model for the flow field u round fore-free swimmer, whih is stresslet fore dipole field S of mplitude α. So, u = αs with, in spheril polrs, S = os2θ ˆr, 10 2r2 where θ is the ngle from the swimmer s unpertured propulsion diretion nd rˆr is the vetor displement from its enter. Different types of swimmers re distinguished y the symmetry of their surrounding flow fields, i.e. the sign of the preftor α Fig. 2. Pushers e.g. E. oli hve mplitude α > 0, while pullers e.g. vrious Chlmydomons lge hve α < 0. In neutrl swimmers, α = 0, nd higher order terms eome importnt. In Fig 5-d, we split the oserved speed vrition up into ntisymmetri nd symmetri prts round the point where swimmer psses neighouring olloid. Comprison of Fig. 2-d with Fig. 5d shows our oservtions re onsistent with pusher. As pusher pprohes the neighouring olloid, the fluid pushed out in front is refleted y the olloid nd slows the swimmer down; one the swimmer hs pssed the olloid, the fluid pushed out ehind speeds it up. If this speed vrition is solely due to the stresslet omponent, we n estimte α y lulting the pproximte hydrodynmi intertion etween free stresslet swimmer in irulr orit nd spheril surfe outside tht orit. We use the mesured position ssuming g js = g jg = 70 nm nd orienttion τ,β of the swimmer with respet to the entrl olloid, nd fr-field nlytil expression for the intertion of stresslet with spheril surfe 44. Clultionl detils re in Appendix 2. Figure 5e shows the predited frtionl speed vrition u/u 0 for α = u 0 2 lk solid, nd the ntisymmetri red dshed nd symmetri lue dot-dshed omponents of this vrition. The predited speed vrition would e ompletely ntisymmetri for swimmer oriented tngent to the orit, ut the inlintion of the swimmer wy from the orit reks this symmetry slightly. To mth the pek heights etween Fig. 5d nd the ntisymmetri omponent of Fig. 5f requires α 30 µm 3 s 1. This ppers resonle, s E.oli of similr size moving t similr speed hve mesured α = 40 µm 3 s Nevertheless, our vlue is no more thn very rough estimte. Moreover, the stresslet ontriution lerly nnot fully explin the oserved speed osilltion. Further nlysis of the HI, inluding intertion with the entrl olloid nd the plne surfe, s well s future dvnes enling the inluding of PI, will e neessry efore firm onlusions n e drwn. 4.3 Retifition of E. oli trjetories The ehviour of E. oli n e explined more simply. Their typil irultion rdius Fig. 4 is muh lrger thn the inter-olloid sping, nd t 7 µm, their flgell re likely to hinder turning out of the stright hnnels etween olloids. Osionlly, teri do riefly orit individul olloids, ut imging E. oli with fluoresent flgell, shows tht these ells typilly hve shorter, 3 µm flgell Fig. 4d nd SV3, nd so should lso hve nturlly tighter irultion rdius thn teri with longer flgell 33. Unlike Jnus swimmers, teri do not pper to e trpped y the olloid t the entre

8 of their orit, nd do not pproh it losely Fig. 4d. It is interesting tht the omplex environment of the olloidl rystl n effetively simplify the trjetories of E. oli teri ompred to their ehviour on plne surfes. This my hve pplitions in studying vrious -txes hemotxis, phototxis et. on surfes, where irultion would normlly prevent the teri from issing their motion long fvourle grdients. 5 Conlusion We hve studied the ehviour of tlyti Jnus swimmers nd motile E. oli teri inside model 2D olloidl rystl. The effet of this porous environment on these two swimmers is, respetively, to rete nd destroy, oritl motion. Our mesurement of the ehviour of Jnus swimmers inside the olloid rystl hs generted welth of dt on their ehviour in this environment, inluding detiled hrteristion of oritl speed osilltions. These dt set onstrints for future work on the propulsion mehnism of these swimmers. Suh understnding would then llow n ssessment of the importne of PI in our rystlline geometry. If PI turn out to e minor, then our nlysis of HI suggests tht Jnus swimmers re pushers with similr dipolr flow field mplitude to E. oli. In tht se, then the very different response to the rystlline environment of these two self-propelled prtile systems is noteworthy: mny theoretil lultions nd simultions ssume, t lest impliitly, tht it is fruitful to disuss generi pusher ehviour. Our dt suggest otherwise. Our oservtions immeditely suggest other studies. For exmple, the irultion of E. oli next to surfes presents n ostle to the study of hemotxis, whih rystlline retifition would presumly overome. The stle Jnus swimmer orits t high fuel onentrtion ould form the sis for onstruting vrious mirofluidi devies, e.g., mixer on the miro level 31. Aknowledgements - This work ws funded y UK EP- SRC grnt EP/J007404/1, EU Intr-Europen Fellowships LivPC FP7-PEOPLE-2013-IEF nd Dy- CoCoS FP7-PEOPLE-2013-IEF, nd ERC Advned Grnt ERC-2013-AdG PHYSAPS. We thnk Mike Ctes, Elise Drmon, Dvide Mrenduzzo, Elliot Mrsden, Alexnder Morozov, Anne Pwsey, Jerko Rosko nd Jokim Stenhmmr for helpful disussions. Referenes 1 W. C. K. Poon, Physis of Complex Colloids, Soietà Itlin di Fisi, Bologn, 2013, pp = rxiv: S. J. Eens nd J. R. Howse, Soft Mtter, 2010, 6, W. F. Pxton, K. C. Kistler, C. C. Olmed, A. Sen, S. K. St. Angelo, Y. Co, T. E. Mllouk, P. E. Lmmert nd V. H. Crespi, J. Am. Chem. So., 2004, 126, J. G. Gis nd Y.-P. Zho, Appl. Phys. Lett., 2009, 94, J. R. Howse, R. A. L. Jones, A. J. Ryn, T. Gough, R. Vfkhsh nd R. Golestnin, Phys. Rev. Lett., 2007, 99, S. Eens, M.-H. Tu, J. R. Howse nd R. Golestnin, Phys. Rev. E, 2012, 85, A. T. Brown nd W. C. K. Poon, Soft Mtter, 2014, 10, S. Eens, D. A. Gregory, G. Dunderdle, J. R. Howse, Y. Irhim, T. B. Liverpool nd R. Golestnin, Euro. Phys. Lett., 2014, 106, M. C. Mrhetti, J. F. Jonny, S. Rmswmy, T. B. Liverpool, J. Prost, M. Ro nd R. A. Simh, Rev. Mod. Phys., 2014, 85, G. Volpe, I. Buttinoni, D. Vogt, H.-J. Kümmerer nd C. Behinger, Soft Mtter, 2011, 7, Y. Fily nd M. C. Mrhetti, Phys. Rev. Lett., 2012, 108, J. Stenhmmr, A. Tiriohi, R. J. Allen, D. Mrenduzzo nd M. E. Ctes, Phys. Rev. Lett., 2013, 111, J. Dunkel, S. Heidenreih, K. Dresher, H. H. Wensink, M. Bär nd R. E. Goldstein, Phys. Rev. Lett., 2013, 110, Y. Htwlne, S. Rmswmy, M. Ro nd R. A. Simh, Phys. Rev. Lett., 2004, 92, A. Zöttl nd H. Strk, Phys. Rev. Lett., 2014, 112, J. Shwrz-Linek, J. Arlt, A. Jepson, A. Dwson, T. Vissers, D. Miroli, T. Pilizot, V. A. Mrtinez nd W. C. K. Poon, Colloids Surf., 2015, in press, = rxiv: R. Soto nd R. Golestnin, Phys. Rev. Lett., 2014, 112, W. E. Uspl, M. N. Popesu, S. Dietrih nd M. Tsinkevyh, Soft Mtter, 2015, 11, T. Bikel, A. Mjee nd A. Würger, Physil Review E, 2013, 88, F. Ginot, I. Theurkuff, D. Levis, C. Yert, L. Boquet, L. Berthier nd C. Cottin-Bizonne, Phys. Rev. X, 2015, 5, I. Theurkuff, C. Cottin-Bizonne, J. Pli, C. Yert nd L. Boquet, Phys. Rev. Lett., 2012, 108, Q. Lio, G. Surmnin, M. P. DeLis, D. L. Koh nd M. Wu, Phys. Fluids, 2007, 19, K. Dresher, R. E. Goldstein, N. Mihel, M. Polin nd I. Tuvl, Phys. Rev. Lett., 2010, 105, K. Dresher, J. Dunkel, L. H. Cisneros, S. Gnguly nd R. E. Goldstein, Pro. Ntl Ad. Si., 2011, 108, J. S. Gusto, K. A. Johnson nd J. P. Gollu, Physil review letters, 2010, 105, T.-Y. Ching nd D. Velegol, Lngmuir, 2014, 30, K. Ishimoto nd E. A. Gffney, Phys. Rev. E, 2013, 88, G. Li nd J. X. Tng, Phys Rev Lett, 2009, 103, G.-J. Li nd A. M. Ardekni, Phys. Rev. E, 2014, 90, G.-J. Li, A. Krimi nd A. Ardekni, Rheologi At, 2014, 53, D. Tkgi, J. Pli, A. B. Brunshweig, M. J. Shelley nd J. Zhng, Soft Mtter, 2014, 10, M. A.-S. Vigent, R. M. Ford, M. Wgner nd L. K. Tmm, Appl. Environ. Miroiol., 2002, 68, E. Lug, W. R. DiLuzio, G. M. Whitesides nd H. A. Stone, Biophys. J., 2006, 90, H. Shum, E. A. Gffney nd D. J. Smith, Pro. Royl So. A, 2010, 466, A. I. Cmpell nd S. J. Eens, Lngmuir, 2013, 29, J. C. Croker nd D. G. Grier, J. Colloid Interfe Si., 1996, 179, I. D. Vldesu, E. J. Mrsden, J. Shwrz-Linek, V. A. Mrtinez, J. Arlt, A. N. Morozov, D. Mrenduzzo, M. E. Ctes nd W. C. K. Poon, Phys. Rev. Lett., 2014, 113, P. Hänggi, P. Tlkner nd M. Borkove, Rev. Mod. Phys., 1990, 62,

9 39 R. G. Cox nd H. Brenner, Chemil Engineering Siene, 1967, 22, J. Kotr, L. Deono, N. Bruot, S. Box, D. Phillips, S. Simpson, S. Hnn nd P. Ciut, Phys. Rev. Lett., 2013, 111, Y. Gu nd D. Li, Journl of Colloid nd Interfe Siene, 2000, 226, F. S. Lmeirs, A. L. d. Souz, V. A. R. d. Melo, E. H. M. Nunes nd I. D. Brg, Mter. Res., 2008, 11, M. Leunissen, C. Christov, A.-P. Hynninen, C. Royll, A. Cmpell, A. Imhof, M. Dijkstr, R. Vn Roij nd A. Vn Blderen, Nture, 2005, 437, S. E. Spgnolie, G. R. Moreno-Flores, D. Brtolo nd E. Lug, Soft mtter, 2015, 11, L. Turner, R. Zhng, N. C. Drnton nd H. C. Berg, J. Bt., 2010, 192, C. Merlin, S. MAteer nd M. Msters, J. Bt., 2002, 184, S. Kim nd S. J. Krril, Mirohydrodynmis: priniples nd seleted pplitions, Courier Dover Pulitions, A. Miymur, S. Iwski nd T. Ishii, Int. J. Multiphse Flow, 1981, 7, A. Edelstein, N. Amodj, K. Hoover, R. Vle nd N. Stuurmn, in Computer Control of Mirosopes Using µmnger, John Wiley, Appendies A Supplementry Video Informtion SV1 - Jnus swimmers moving through olloidl rystl in 1% H 2. Epifluoresene, t 3 fps, 50µm sle r. SV2 - High mgnifition video of Jnus swimmer oriting single olloid inside rystl t 10% H 2. Epifluoresene initilly rightfield to show lotion of neighouring olloids t 20 fps, 5µm sle r. SV3 - Confol video of E. oli teri with green stined odies nd red stined flgell swimming inside olloidl rystl green. Colloids touh eh other, ut only smll, polr end ps re visile. Erly in the video, n E. oli with short flgell orits the olloid mrked with lue irle. 4 fps, 10µm sle r. SV4 - High mgnifition, edge-on video of Jnus swimmer oriting single olloid t the edge of rystl in 10% H 2. Epifluoresene t 20 fps, 5µm sle r. B Flgell Stined E. oli Constrution of the smooth swimming E. oli strin AB1157 hey hs een desried previously 37. For the urrent work, the strin ws further modified y replement of the hromosoml opy of the flic gene with modified opy enoding mutnt FliC protein in whih the serine mino id t position 353 is repled with ysteine mino id. Strin HCB1668 is Tn5 flic null derivtive of AW405 in whih FliC S353C is expressed from the plsmid pbad This plsmid ws used s templte to mplify 803 p of flic y PCR. This enompssed the AGT to TGC muttion whih ws flnked on eh side y 400 p of the flic gene. The primers used for mplifition were GCAACTCGAGCAATTGAGGGTGTTTATACTGA nd GCAAGTCGACCCTGGTTAGCTTTTGCCAACA. Restrition sites for XhoI nd SlI were inluded. The PCR produt ws purified, digested with XhoI nd SlI nd ligted into the plsmid ptof24, whih hd een digested with the sme enzymes. The resultnt reominnt plsmid ptof24 flic ws trnsformed into AB1157 hey nd used to reple the wild type flic llele with the flic muttion y plsmid medited gene replement using previously pulished method 46. Corret insertion of the muttion ws verified y sequening. The resultnt strin AB1157 hey phc60 FliC S353C ws grown from single olony in 10 ml Luri-Bertni roth ontining 30 µgml 1 knmyin nd 5 µgml 1 tetryline overnight t 30 C nd 200 rpm. Bteri were diluted 1:100 into 35 ml tryptone roth ontining ntiiotis s ove nd grown for further 4 h. Next, three wshes were performed using phosphte motility uffer 6.2 mm K 2 HPO 4, 3.8 mm KH 2 PO 4, 67 mm NCl, 0.1 mm EDTA t ph 7.0 nd ells onentrted to totl volume of 3 ml. To perform flgell lelling the protool of Turner et l. 45 ws followed. Briefly, 10 µl of Alex Fluor 633 C5 mleimide 1 mgml 1 in dimethyl sulfoxide, Moleulr Proes ws dded to 1 ml of wshed teri nd inuted t room temperture nd 100 rpm for 60 min. Three wshes were performed s desried ove nd finl density ws djusted to optil density 0.3 t 600 nm in motility uffer ontining wt% TWEEN 20. C Geometril Considertions In this setion, we give detils of how we estimte the gp sizes nd inlintion ngles etween the surfe of the swimmer, nd the stti olloid nd glss surfes. As the swimmer orits single olloid, we wish to mesure the rdius ρ of its orit, the zimuthl ngle of the swimmer round its orit φ, nd the inlintion β nd τ of the swimmer s orienttion wy from the tngent to tht orit see Fig. 6. However, sine the Jnus prtile hs non-uniform fluoresene intensity, we nnot strightforwrdly determine the entre of the prtile. We insted mesure equivlent prmeters ρ, φ, β for n ellipse fitted to thresholded imge of the swimmer t eh frme, whose entre will e offset from the true entre of the swimmer y some smll distne long the swimmer s orienttion vetor. The expeted shpe of the imge of the swimmer is not

10 Slide Coverslip A D/ ler, sine the Pt oting ppers to only prtilly lok out the underlying fluoresene see supplementry video SV2. We estimte from the spet rtio of the fitted ellipse y performing identil ellipse fitting in MATLAB on two models of the hnging thresholded shpe of the swimmer, whih tke the lower hlf of the imge to e either hlf-ellipse or trunted semiirle Fig. 6. We plot the reltionship etween the differene L in the fitted mjor nd minor xis lengths, nd the offset of the entroid in these two models, nd use the verge of these two urves to estimte the experimentl vlue of. The rdius of the Jnus swimmers is = 0.96 ± 0.04 µm, nd, verging over 17 videos, we find L = 360 ± 20 nm, giving = 135 ± 30 nm, where the differene etween the two urves in Fig. 6 hs een tken into ount in the unertinty. To lowest order in, the orretions to ρ, φ nd β re then given y ρ = ρ sinβ, Hlf Ellipse Prfilm Coverslip A Crystl Trunted Semiirle DL/ 10 mm Slide Coverslip B Glue R--g jg d Glue R r g js g jg Prfilm Crystl Coverslip B φ = φ ρ osβ, 11 β = β ρ osβ. The orretions re pproximtely 20 nm, nd 2 respetively, nd these hve lredy een pplied here nd in the ody of the rtile, to give ρ = 4.56 ± 0.02 µm nd β = 7 ± 2. From the verge vlue of the oritl rdius ρ, we lulte the size of the gps etween the swimmer surfe nd the stti olloid g js or the plne glss surfe g jg. The geometri onstrution in Fig. 6 gives the following expression for g js nd g jg ρ 2 + R g jg 2 = R + gjs + 2, 12 where the rdius of the stti olloids, R = 5.06 ± 0.02 µm, nd the verges... hve een dropped for onveniene. This single eqution nnot e used to solve for oth g js nd g jg. However, sine oth gp sizes must e positive, we n otin upper ounds on eh g jg < ρ2 4R 2R, g js < ρ2 4R 2R +, 13 where we hve ignored smll terms qudrti in g jg, g js. Clulting these limits gives g js < 200 nm nd g jg < 300 nm, tking the lrgest vlue within experimentl error. If insted, we ssume tht g jg = g js = g, Eq. 12 gives g = ρ2 = 70 ± 10nm. 14 4R Fig. 6 Results of estimting the offset of fitted ellipse / from the differene in fitted xis lengths L/ sed on two models shown here nd desried in the text. Side view of swimmer oriting olloid not to sle with geometril onstrution to determine the size of the gps g js nd g jg etween the swimmer nd the olloid or plne. -d Digrms of the smple ell for oservtion long the plne of the overslip. Oservtion is from elow overslip B, through the rystl nd long the plne of overslip A. Digrm hs een ut in hlf long the left edge of the figure. For n order-of-mgnitude onsisteny hek on this vlue, we note tht the mesured trnsltionl diffusivity within eh orit, D, is ftor of 3 smller thn the predited Stokes- Einstein ulk diffusivity D SE = k B T /6πη = 0.23 µm 2 s 1 in the ulk. Proximity to wlls generlly dereses the trnsltionl diffusivity of prtiles 47. Our geometry is rther omplex, nd, to our knowledge, hs not een treted theoretilly. However, sine the swimmer is lose to two surfes, nd nnot rotte, we my expet redution in diffusivity similr to tht for prtile moving in the entrl plne etween two prllel pltes. Experiments hve een performed mesuring the drg on spheres moving xilly long the entre line of retngulr prisms of spet rtios 10:1, nd these lso find orretion ftor 3 for g/ = , where g is the gp width. Eqution 14 gives g/ 0.07 in our se, so tht the similrity in the diffusivity redution ftors is ressuring. To otin the inlintion τ w.r.t. the glss plne Fig. 6, 10 Jnus swimmers oriting olloids in the rystl were oserved Note tht the diffusivity mesured on plin glss D g is similr to the Stokes- Einstein predition. However, without preise mesurement of the ulk diffusivity or visosity, we nnot use this mesurement to estimte the swimmer-surfe gp in this se

11 long the plne of the overslip using ustom-uilt smple hmer, shown in Fig. 6d-e. A olloidl rystl ws formed t the edge of mm 2 overslip A, s in the min text. Coverslip A ws tthed with 600 µm prfilm to glss slide previously ut down to 50 mm, so tht the edge of overslip A ws flush with the long edge of the slide, with the rystl fing inwrds. The slide ws then glued onto mm 2 overslip B, with the rystl lying next to overslip B. Jnus swimmers in 10% H 2 solution were dded s usul, nd viewed through overslip B using 100 oil immersion ojetive. Swimmers were reorded oriting single olloids t the lower edge of the rystl, nd imges were ptured with CoolSNAP Photometris mer using MiroMnger 49 see SV4. The inlintion τ = 1 ± 2 of the swimmers w.r.t. overslip A ws determined y fitting ellipses to thresholded imges of the swimmers, s ove. D Hydrodynmi Intertions In this setion, we write down, for swimmer moving in irulr orit in free spe, the speed vrition indued y hydrodynmi intertion with spheril ojet outside tht orit. The swimmer is modelled s stresslet of strength α, oriented long swimming diretion ˆv. The swimmer is instntneously loted t position s, lying on irulr orit whose lol tngent vetor is ˆp. A olloid of rdius A is loted t some ritrry position X. The displement vetor l of the swimmer from the stti olloid is l = s X, with enterto-entre distne l = l. The distne etween the entre of the swimmer nd the surfe of the neighouring olloid is h = l R. We deompose the swimmer s orienttion into omponents perpendiulr nd prllel to the neighouring olloid s surfe, in order to use the expressions for the dveted veloity given in 44. We therefore define two unit vetors, ˆl, whih is perpendiulr to the olloid surfe, nd ˆk whih is prllel to the olloid surfe, nd lies in the ˆv, ˆl plne. These two unit vetors re In this oordinte system ˆl = l l, ˆk = ˆl ˆv ˆl, 15 ˆv ˆl ˆv = ˆkosω +ˆlsinω, 16 where ω is the inlintion of the swimmer wy from the tngent plne to the olloid s surfe sinω = ˆv ˆl. We n define two other ngles likewise: sinψ = ˆp ˆl, nd os χ = ˆp ˆv. The hydrodynmi intertions etween free swimmer, moving originlly t speed u 0 long diretion ˆv, nd the sphere, would in generl result in n dditionl swimmer veloity u, whih n e deomposed long ˆl nd ˆk u = u l h,ω,u 0 ˆl + u k h,ω,u 0 ˆk. 17 In the present se, however, the prtile veloity is onstrined to lie on the tngent, ˆp, so the oserved vrition in swimmer speed will e u = ˆp u, or u = u l sinψ + u k os χ sinψ sinω osω, 18 where, for the veloity omponents u l nd u k, we n diretly use reently derived fr-field intertion formule 44. Trnslting into our oordinte system, these re 1 3sin 2 ω 3Rα u l = 2h 2 2R + h 2 3R 3 α u k = R + h 2R 2 + 6Rh + 3h 2 sin2ω 4h 2 R + h 3 2R + h nd omining Eq will then give the predited frtionl speed vrition u /u 0. It remins to write down the relevnt oordintes. The fititious glss surfe is on the x y plne, with z pointing into the smple, nd the origin is t the point of ontt etween the fititious entrl olloid nd the plne. We tke the swimmer to e smll distne g jg ove the plne, nd oriting t horizontl distne ρ from the z-xis through the entre of the entrl olloid x = y = 0, nd define its position s in terms of the zimuthl ngle φ s = ρ osφ, ρ sinφ, + g jg. 20 The neighouring olloid is fixed t X = 2R, 0, R, 21 while the tngent to the irulr orit of the swimmer is ˆp = sinφ, osφ, 0, 22 nd the orienttion of the swimmer is ˆv = sinφ βosτ, osφ βosτ, sinτ, 23 where β is the fixed ngle etween the tngent to the orit nd the orienttion of the swimmer in the x-y plne, nd τ is the fixed inlintion of the swimmer wy from the horizontl plne Fig. 6. This gives os χ = os β os τ